Published online before print March 17, 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
production in phorbol ester/ionomycin-activated mouse splenocytes independent of CB1 or CB2
Department of Pharmacology and Toxicology and Center for Integrative Toxicology, Michigan State University, East Lansing
1 Correspondence: Department of Pharmacology and Toxicology, 315 National Food Safety and Toxicology Center, Michigan State University, East Lansing, MI 48824. E-mail: kamins11{at}msu.edu
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
(IFN-) expression and associated upstream signaling events. Pretreatment of splenocytes with 2-AG markedly suppressed phorbol 12-myristate 13-acetate plus calcium ionophore (PMA/Io)-induced IFN- secretion. In addition, 2-AG suppressed IFN- steady-state mRNA expression in a concentration-dependent manner. To unequivocally determine the putative involvement of CB1 and CB2, splenocytes derived from CB1–/–/CB2–/– knockout mice were used. No difference in the magnitude of IFN- suppression by 2-AG in wild-type versus CB1/CB2 null mice was observed. Time-of-addition studies revealed that 2-AG treatment up to 12 h post-cellular activation resulted in suppression of IFN-, which was consistent with a time course conducted with cyclosporin A, an inhibitor of NFAT activity. Coincidentally, 2-AG perturbed the nuclear translocation of NFAT protein and blocked thapsigargin-induced elevation in intracellular calcium, suggesting that altered calcium regulation might partly explain the suppression of NFAT nuclear translocation and subsequent IFN- production. Indeed, Io partially attenuated the 2-AG-induced suppression of PMA/Io-stimulated IFN- production. Taken together, these data demonstrate that 2-AG suppresses IFN- expression in murine splenocytes in a CB receptor-independent manner and that the mechanism partially involves suppression of intracellular calcium signaling and perturbation of NFAT nuclear translocation.
Key Words: cannabinoid • nuclear factor of activated T cells
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
9-tetrahydrocannabinol (THC), although other nonpsychoactive compounds have been identified, such as cannabinol and cannabidiol [1
]. It is interesting that despite the fact that not all of these compounds possess psychoactive effects, all three exhibit immunosuppressive actions, including suppression of mitogen-stimulated proliferation, interleukin (IL)-2 production, and T cell-dependent antibody responses [2
3
4
5
]. Although evidence is limited for a role for the CB receptors in the immunosuppressive actions of these compounds [2
, 3
], the central nervous system (CNS) effects of THC have been primarily attributed to the CB1 receptor [4
, 5
].
Identification of CB1 (brain receptor) [6
] and CB2 (peripheral receptor) [7
] in mammalian tissues suggested the existence of endogenous ligands for these receptors. The search first led to the isolation and identification of arachidonoyl ethanolamine (AEA; anandamide), which has been reported to have various cannabimimetic biological activities [8
9
10
11
]. Shortly following the identification of AEA, 2-arachidonoyl-glycerol (2-AG), a monoacylglycerol, was isolated from canine gut and was found to bind to both CB receptors as demonstrated in CB1- and CB2-transfected Chinese hamster ovary cells [12
]. In addition to CNS effects [12
], 2-AG exhibits immunomodulatory activity. A broad in vitro evaluation of 2-AG on immune function demonstrated suppression of mitogen-induced T and B cell proliferation in a 2-AG concentration-dependent manner [13
]. Furthermore, 2-AG robustly suppressed phorbol 12-myristate 13-acetate plus calcium ionophore (PMA/Io)-stimulated IL-2 expression at the protein and mRNA levels, and this inhibition was mediated, in part, at the level of gene transcription, as demonstrated by a suppression of pIL-2-chloramphenicol acetyltransferase promoter activity [14
]. An examination of the transcription factors involved in this suppression revealed that 2-AG suppressed nuclear factor (NF)-
B and to a greater extent, NF of activated T cells (NFAT) DNA-binding activities.
Another critical cytokine produced by lymphocytes and regulated in part by NF-B and NFAT is interferon- (IFN-) [15
]. In addition to the above transcription factors, IFN- expression is strictly regulated by cyclic adenosine monophosphate response element-binding protein/activating transcription factor, activated protein-1, ying-yang, and methylation of CpG dinucleotides [15
]. IFN- is a pleiotropic, immunomodulatory cytokine predominantly produced by T lymphocytes and natural killer (NK) cells (reviewed in ref. [16
]). The effects of IFN- include immunoglobulin (Ig) synthesis in B cells, up-regulation of major histocompatibility complexes I and II in macrophages and other cells, activation of macrophages and NK cells, and direct inhibition of viral replication (reviewed in ref. [16
]).
As IFN- plays such a crucial role in immune and inflammatory responses, it has been a therapeutic target. In addition to suppression of IFN- by cyclosporin A (CsA) and corticosteroids [16
], CB compounds have been reported to exert biphasic modulation of IFN- production. At higher but noncytotoxic concentrations, 9-tetrahydrocannabinol (9-THC) has been demonstrated to suppress IFN- production [17
], whereas at lower concentrations, 9-THC was observed to stimulate IFN- secretion in human peripheral blood mononuclear cells (PBMC) [18
, 19
]. In addition, AEA was reported to suppress IFN- production in human PBMC [18
], as was the newly described synthetic CB, PRS-211092, which suppressed IFN- mRNA levels modestly, concomitant with a decrease in NFAT luciferase reporter activity [20
].
In light of the aforementioned observations combined with our demonstration that 2-AG suppressed IL-2 expression, in part through an inhibition of NFAT DNA-binding activity, the objective of the present studies was to evaluate the effect of 2-AG on IFN- expression in PMA/Io-stimulated mouse splenocytes. Furthermore, we sought to determine the underlying mechanisms that contribute to this inhibition, including a detailed analysis of the effect of 2-AG on NFAT cellular localization, intracellular calcium signaling, and the putative involvement of CB1 and CB2 using CB1–/–/CB2–/– knockout mice. The results suggest that 2-AG suppresses IFN- in a CB1- and CB2-independent manner and that 2-AG-induced inhibition of intracellular calcium signaling and subsequent NFAT DNA-binding activity might contribute to the mechanisms underlying the pleiotropic effects of these compounds in lymphocytes.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Reagents and cell culture
All reagents were purchased from Sigma Chemical Co. (St. Louis, MO) unless otherwise noted. Thapsigargin (TG) was purchased from Calbiochem (La Jolla, CA). 2-AG was obtained from the National Institute on Drug Abuse (Bethesda, MD). 2-AG purity was found to be greater than 99%, as determined by gas chromatography–mass spectrometry. 2-AG was reconstituted in absolute ethanol, aliquoted, and stored under nitrogen at –80°C. Working solutions were freshly prepared just prior to addition to culture.
Single-cell suspensions from splenocytes were prepared and cultured in RPMI-1640 medium (Gibco-BRL/Invitrogen, Carlsbad, CA) supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, 5 x 10–5 M 2-mercaptoethanol, and 5% bovine calf serum (Hyclone, Logan, UT). In concentration-dependent studies, splenocytes (1x106c/ml) were pretreated with vehicle (VH; 0.1% ethanol), 2-AG (1, 5, 10, and 20 µM), or CsA (1 µM), followed by stimulation with PMA/Io. In time-course studies, splenocytes (1x106c/ml) were treated with VH (0.1% ethanol), 2-AG (20 µM), or CsA (1 µM) at the same time as PMA/Io stimulation or at 2, 4, 6, 8, or 12 h after stimulation. To identify signaling pathways involved in 2-AG-mediated inhibition of IFN- expression, splenocytes (1x106c/ml) were pretreated with the indicated reagents followed by VH (0.1% ethanol) or 2-AG (20 µM) after which, the cells were stimulated with PMA/Io for various times. For the Io-reversal studies, splenocytes (1x106 cells/ml) were treated with VH (0.1% ethanol) or 2-AG (20 µM), after which the cells were stimulated with 40 nM PMA and Io (0.5–1.5 µM). In all cases, leukocytes were cultured at 37°C in 5% CO2, and the cell viability was monitored by trypan blue exclusion.
In the present studies, we demonstrate that we do not find any difference in the ability of CBs to suppress IFN- and other associated endpoints using 80 nM/1 µM or 40 nM/0.5 µM PMA/Io. We have conducted several concentration responses for PMA/Io, and it was determined that several endpoints of cellular activation become saturated at concentrations above 40 nM PMA/0.5 µM Io; thus, we have recently adopted the standard of 40 nM/0.5 µM for cellular stimulation. Some of the studies in the manuscript were conducted during the same time that we conducted the PMA/Io concentration responses, and our standard at that time, 80 nM/1 µM, was used. Again, it is important to emphasize that the difference in PMA/Io concentrations has no bearing on the ability of CBs to inhibit IFN- (see and compare Figs. 1
3
and 8
).
 View larger version (15K): [in a new window] |
Figure 1. Concentration-dependent suppression of IFN- production by 2-AG. Splenocytes (B6C3F1; 1x106 cells/ml) were pretreated with VH (0.1% ethanol), 2-AG (1, 5, 10, and 20 µM), or CsA (1 µM) for 15 min followed by stimulation with PMA/Io (80 nM/1 µM) for 24 h at 37°C. Supernatants were harvested, and IFN- was quantified by ELISA. The data are expressed as the mean units/ml ± SE of triplicate cultures. *, Values that are significantly different from the VH control at P < 0.05. The results are representative of two separate experiments.
|
 View larger version (32K): [in a new window] |
Figure 3. 2-AG-induced suppression of IFN- production occurs independent of CB1 and CB2. Splenocytes (C57BL/6J or CB1–/–/CB2–/–; 1x106 cells/ml) were pretreated with VH (0.1% ethanol) and 2-AG (0.1, 1, 2.5, 5, 10 15, and 20 µM) for 30 min, followed by stimulation with PMA/Io (40 nM/0.5 µM) for 24 h at 37°C. Supernatants were harvested, and IFN- was quantified by ELISA. (A) The data are expressed as the mean percent VH control ± SE of triplicate experiments. *, Values that are significantly different from the VH control for wild-type mice at P < 0.05; **, values that are significantly different from the VH control for CB1–/–/CB2–/– mice at P < 0.05. (B) The data are expressed as mean units/ml ± SE of one representative experiment. *, Values that are significantly different from the VH control at P < 0.05. NA, naive.
|
 View larger version (14K): [in a new window] |
Figure 8. Io attenuates 2-AG-induced suppression of IFN-. Splenocytes (B6C3F1; 1x106 cells/ml) were pretreated with VH (0.1% ethanol) or 2-AG (20 µM) for 30 min followed by stimulation with PMA (40 nM) and Io (0.5, 0.75, 1.0, 1.25, and 1.5 µM) for 24 h at 37°C. Supernatants were harvested, and IFN- was quantified by ELISA. The data are expressed as the mean units/ml ± SE of triplicate experiments. Numbers along the bottom of the graph are mean percent VH control for 2-AG versus its VH-matched control. *, Values that are significantly different from the VH-matched control at P < 0.05; **, values that are significantly different from our standard stimulation concentrations of 40 nM PMA/0.5 µM Io;  , values that are significantly different from 2-AG-induced inhibition of 40 nM PMA/0.5 µM Io-stimulated IFN- production.
|
steady-state mRNA expression was quantified by quantitative competitive RT-PCR, as described previously with minor modifications [14
]. All isolated RNA samples were confirmed to be free of DNA contamination, as determined by the absence of product following PCR amplification in the absence of RT (Gibco-BRL/Invitrogen; data not shown). Briefly, known amounts of total RNA and internal standard (IS) mRNA were reverse-transcribed simultaneously in the same reaction tube into cDNA using oligo(dT)15 as primers. A PCR master mixture consisting of PCR buffer, 4 mM MgCl2, 6 pmol each of the forward and reverse primers, and 1.25 U Taq DNA polymerase was added to the cDNA samples, which were then heated to 94°C for 4 min and cycled 25 times at 94°C for 15 s, 59°C for 30 s, and 72°C for 30 s, after which, an additional extension step at 72°C for 5 min was included. PCR products were electrophoresed in 3% NuSieve 3:1 gels (FMC Bioproducts, Rockland, ME) and visualized by ethidium bromide staining. Quantification was performed by assessing the optical density for both of the DNA bands (i.e., IS vs. target gene) using a Gel Doc 100 video imaging system (Bio-Rad, Melville, NY). The number of transcripts was calculated from a standard curve, generated by using the density ratio between the gene of interest and the different IS concentrations used [22
]. The primer sequences for IFN- were: forward, 5'-GGATATCTGGAGGAACTGGC; reverse, 5'-GAGCTCATTGAATGCTTGGC. The IS primer design and recombinant RNA IS preparation were conducted as described previously [23
]. The primers for IS were as follows: IS forward, 5'-T7 promoter (TAATACGACTCACTATAGG) + IFN- forward (as above) + "spacer" rat ß-globin forward (AAGCCTGATGCTGTAGAGCC); IS reverse, 5'-oligo dT18 + IFN- reverse (as above) + spacer rat ß-globin reverse (AACCTGGATACCAACCTGCC).
IL-2 and IFN- protein quantification
Mouse recombinant IL-2 or IFN- (as standards), purified rat anti-mouse IL-2 or IFN- antibody, and biotinylated anti-mouse IL-2 or IFN- antibody were purchased from PharMingen (San Diego, CA). Splenocytes (1x106c/ml) were cultured in triplicate in 48-well cell culture plates (0.8 ml/well, Corning Inc., Corning, NY). The supernatants were collected at the indicated time points, and IL-2 or IFN- was quantified by enzyme-linked immunosorbent assay (ELISA).
Western blot analysis
Cytoplasmic and nuclear proteins were prepared as described previously with minor modifications [14
]. Briefly, splenocytes were treated with lysis buffer (10 mM Tris-HCl, 3 mM CaCl2, and 2 mM MgCl2, pH 7.4), supplemented with 0.1% igepal, 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 µg/ml aprotinin and leupeptin, 1 mM sodium orthovanadate (NaVO4), and 10 mM sodium fluoride (NaF). Nuclei were pelleted by centrifugation at 200 g for 5 min, and the supernatant was retained for cytoplasmic protein. Nuclei were lysed using a hypertonic buffer (20 mM HEPES, 400 mM NaCl, 1 mM EDTA,1 mM EGTA, 0.1% igepal, 1 mM DTT, 1 mM PMSF, 10 µg/ml aprotinin and lepeptin, 1 mM NaVO4, and 10 mM NaF, pH 7.2) for 30 min at 4°C with gentle rocking. The proteins were then centrifuged at 1200 g for 15 min, and the supernatants were retained as the nuclear fraction. Cytoplasmic (15 µg) or 10 µg nuclear protein was loaded in each lane of a mini-gel apparatus and resolved on an 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel and transferred to nitrocellulose by electroblotting. The resultant membrane was incubated with a monoclonal antibody (mAb) to NFAT2 (Clone 7A6, Affinity Bioreagents, Inc., Golden, CO) or an anti-67.1 antiserum to NFAT1 (a generous gift from Dr. Anjana Rao, Center for Blood Research, Department of Pathology, Harvard Medical School, Boston, MA) [24
]. Subsequently, the membranes were incubated with a sheep anti-mouse IgG-horseradish peroxidase conjugate (Amersham, Arlington Heights, IL) and detected using SuperSignal® BLAZETM chemiluminescent substrate (Pierce, Rockford, IL).
Calcium determination
Splenocytes were isolated and treated with Gey’s balanced salt solution to lyse erythrocytes. The splenocytes were then washed in calcium–KREB buffer 129 mM NaCl, 5 mM KCl, 1.2 mM KH2PO4, 1.2 mM MgSO4, 1 mM CaCl2, 5 mM NaHCO3, 10 mM HEPES, 2.8 mM glucose, 0.2% bovine serum albumin, pH 7.2, and loaded with fura-2 AM (1 µM, Molecular Research Products, Eugene, OR) for 30 min. Intracellular calcium was determined by measuring the fluorescence of fura-2, which is dually excited at 340 nm and 380 nm. Cells were placed in a 3-ml quartz cuvette with constant stirring. Calcium determinations were performed at room temperature in a Beckman Spex 1681 0.22 m spectrometer with dual excitation at 340 and 380 nm and emission at 510 nm (all slit-widths were 1 mm). Maximum and minimum calcium values were assessed with use of 0.1% Triton-X and 500 mM EGTA, respectively. The dissociation constant for the fura-2–calcium complex was 1.45 x 10–7 M. All compounds used in intracellular calcium determination were screened for autofluorescence using fura-2 sodium salt-containing calcium–KREB buffer.
Statistical analysis
The mean ± SE was determined for each treatment group in the individual experiments. Homogeneous data were evaluated by a parametric ANOVA. Dunnett’s two-tailed t-test was used to compare treatment groups with the VH control when significant differences were observed [25
]. For the temporal studies, Student-Newman-Keul’s test was used to make pair-wise comparisons [26
].
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
expression by 2-AG [27
], we evaluated the effect of 2-AG on PMA/Io-induced IFN- expression. PMA/Io-activated splenocytes exhibited a robust, concentration-dependent inhibition of IFN- secretion in the presence of 2-AG as compared with the VH control (Fig. 1
). Although the suppression of IFN- occurs with 2-AG concentrations in the micromolar range, there was no adverse effect on cell viability. In fact, as 2-AG is synthesized de novo from membrane components, it is likely that concentrations of 2-AG in the T cell microenvironment might be in this concentration range, as observed for other derivatives of arachidonate under certain conditions [28
]. CsA, which acts by blocking NFAT activation [29
], was used as a positive control and resulted in complete inhibition of IFN- production. The inhibitory concentration 50% (IC50) value for suppression of IFN- by 2-AG in PMA/Io-stimulated splenocytes was 3.4 µM, which is comparable with that determined for IL-2 suppression by 2-AG under similar conditions (2.0 µM) [14
]. The effect of 2-AG on steady-state IFN- mRNA was also evaluated using competitive RT-PCR. It has been demonstrated that peak, steady-state IFN- mRNA expression occurs between 4 and 8 h and rapidly decreases thereafter [16
]; thus, the effect of 2-AG on IFN- steady-state mRNA expression was determined at 6 h post-cellular activation. 2-AG suppressed steady-state IFN- mRNA expression in a concentration-dependent manner as compared with the VH control (Fig. 2
). The calculated IC50 for suppression of steady-state IFN- mRNA expression was 3.3 µM. Overall, 2-AG exhibited a similar magnitude of potency in its ability to suppress IFN- steady-state mRNA and protein expression, suggesting that the two effects are mechanistically related.
 View larger version (17K): [in a new window] |
Figure 2. Concentration-dependent suppression of IFN- steady-state mRNA expression by 2-AG. Splenocytes (B6C3F1; 1x106 cells/ml) were pretreated with VH (0.1% ethanol), 2-AG (1, 5, 10, and 20 µM), or CsA (1 µM) for 15 min followed by stimulation with PMA/Io (80 nM/1 µM) for 6 h at 37°C. The cells were harvested, and total RNA was isolated as described in Materials and Methods. IFN- mRNA levels were analyzed by quantitative RT-PCR. The data are expressed as the mean number of molecules of RNA per 100 ng total RNA ± SE of triplicate cultures. *, Values that are significantly different from the VH control at P < 0.05. The results are representative of two separate experiments.
|
secretion by splenocytes derived from CB1–/–/CB2–/– mice production by activated leukocytes, splenocytes were used from mice possessing a targeted deletion of a portion of the CB1 and CB2 translated region (CB1–/–/CB2–/–), rendering both receptors nonfunctional. As seen in Figure 3
, there was no difference in IFN- suppression by 2-AG when comparing leukocytes derived from wild-type and CB1–/–/CB2–/– knockout mice.
Time-dependent suppression of IFN- expression by 2-AG
Time-of-addition studies were performed to evaluate the relationship between cellular activation and suppression by 2-AG of IFN- up-regulation. As the duration of time between cellular activation and 2-AG treatment was increased, the magnitude of IFN- suppression was decreased (Fig. 4A
). It is important to note, however, that 2-AG treatment, even 12 h post-cellular activation, still resulted in significant inhibition of IFN- production as compared with VH control. The time-dependent suppression of IFN- by 2-AG was also demonstrated for IL-2, suggesting that common intracellular mediators might be modulated by 2-AG (Fig. 4B)
. It is interesting that a similar, time-dependent trend on IFN- suppression was also observed with CsA (Fig. 4C)
, demonstrating that a perturbation of NFAT, even as late as 12 h post-cellular activation, contributes to suppression of IL-2 and IFN-.
 View larger version (17K): [in a new window] |
Figure 4. Temporal addition of 2-AG on cytokine production. Splenocytes (B6C3F1; 1x106 cells/ml) were treated with VH (0.1% ethanol), 2-AG (20 µM), or CsA (1µM) at the same time as PMA/Io (80 nM/1 µM) or 2, 4, 6, 8, or 12 h post-cellular activation. Determination of IFN- (A, C) or IL-2 (B) and expression of the results are the same as described in Figure 1
. The results are representative of three separate experiments.
|
in PMA/Io-stimulated splenocytes, combined with our previous demonstration that 2-AG suppressed NFAT DNA-binding and promoter activity [14
], we evaluated the effect of 2-AG on NFAT protein expression. Specifically, the ability of 2-AG to alter the subcellular localization of NFAT protein was determined. Of the NFAT family members, NFAT1 (NFATp) and NFAT2 (NFATc) are the predominant forms in mature lymphocytes [31
]; thus, Western analysis was performed for NFAT1 and NFAT2. NFAT1 was constitutively expressed in cytoplasm and remained in cytoplasm in unstimulated splenocytes (Fig. 5
). Activation of the splenocytes with PMA/Io induced a shift in mobility of NFAT1, as evidenced by the presence of a lower band (apparent molecular weight, 
145 kDa vs. 130 kDa), which may indicate that NFAT1 was dephosphorylated in response to cellular activation. Consistent with this observation, CsA prevented this shift in NFAT in PMA/Io-stimulated splenocytes, again, indicating the lower band likely represents a dephosphorylated state. In addition, PMA/Io induced expression and/or translocation of NFAT1 into the nucleus (Fig. 5)
. Notably, two bands with masses of 140 kDa and 130 kDa were detected in the nuclear compartment. Pretreatment of splenocytes with increasing concentrations of 2-AG resulted in a gradual increase in the relative magnitude of NFAT1 protein expression in the cytoplasmic compartment concomitant with a decrease in the nuclear compartment (compare Fig. 5
, nuclear vs. cytoplasmic), suggesting that 2-AG blocked nuclear translocation of NFAT1. It is important that this effect occurred at 2-AG concentrations as low as 1 µM, which was consistent with our previous observation in which 2-AG inhibited NFAT DNA-binding activity at low concentrations [14
].
 View larger version (69K): [in a new window] |
Figure 5. The effect of 2-AG on NFAT1 nuclear translocation. Splenocytes (B6C3F1; 1x106 cells/ml) were untreated or pretreated with 2-AG (1, 5, 10, and 20 µM) or CsA (1 µM) for 15 min followed by stimulation with PMA/Io (80 nM/1 µM) for 30 min at 37°C. Cytoplasmic (15 µg) or nuclear (10 µg) protein was resolved on a SDS-PAGE gel and detected using anti-67.1 antiserum to NFAT1. The left arrows indicate the molecular weights (kDa), and the right arrows indicate the target proteins. Densitometry was performed for each set of bands, and the intensity in the control lane was arbitrarily assigned a value of 1. ND, NFAT1 was below the level of detection. The results are representative of three independent experiments.
|
130, 110, and 95 kDa (Fig. 6)
, which is consistent with the results of Lyakh et al. [32
], in which they detected three NFAT2 proteins with molecular weights of 140, 110, and 86 kDa in normal human T cells by immunoprecipitation. These various molecular weight proteins were reported to be a result of translation of NFAT2 from two different start codons and various phosphorylation states [32
]. As with NFAT1, 2-AG induced an increase in cytoplasmic expression concomitant with a decrease in nuclear expression (Fig. 6)
. CsA again also serves as a positive control, as nuclear translocation of NFAT2 is completely suppressed in the presence of CsA in PMA/Io-stimulated splenocytes.
 View larger version (60K): [in a new window] |
Figure 6. The effect of 2-AG on NFAT2 nuclear translocation. Analysis and quantification for NFAT2 were conducted as described in Figure 5
, with the exception that the protein was detected using a mAb to NFAT2. No relative intensities are reported for cytoplasmic NFAT2, as there was none detected in the stimulated group from which to compare. The results are representative of three independent experiments.
|
 View larger version (15K): [in a new window] |
Figure 7. The effect of 2-AG on intracellular calcium. (A) 2-AG has no effect on resting splenocytes. A 3-ml aliquot of fura-2 AM-loaded splenocytes (B6C3F1; 1x106 cells/ml) was treated with 2-AG (20 µM) or VH (0.1% ethanol) at 300 s. Intracellular calcium was measured for 1600 s. (B) 2-AG attenuates the TG-induced elevation in intracellular calcium. A 3-ml aliquot of fura-2 AM-loaded splenocytes (B6C3F1; 1x106 cells/ml) was treated with 2-AG (20 µM) and/or VH (0.1% ethanol) before beginning calcium measurements. At 300 s, TG (1 µM) or VH (0.1% ethanol) was injected into the cuvette, and the elevation in intracellular calcium was measured for 1600 s. Intracellular calcium changes are presented as changes in the ratio of bound to free calcium (340 nm/380 nm). At the end of the experiment, cellular viability was assessed with the use of 0.1% Triton-X to induced a maximal intracellular calcium elevation (not shown). The calcium traces represent three independent experiments.
|
production, and with increasing concentrations of Io, this inhibition was partially attenuated. Although there was a modest suppression of IFN- production by higher concentrations of Io alone, the partial attenuation of 2-AG-induced suppression was also seen at Io concentrations that did not exhibit suppression. |
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
production in mouse splenocytes in a CB receptor-independent manner. It is interesting that addition of 2-AG, several hours after cellular activation, induced a suppression of IFN- in a manner similar to that observed with CsA, suggesting that 2-AG and CsA exert their effects on cytokine production even after cellular activation changes have occurred. The demonstration that 2-AG and CsA possess similar effects on IFN- suggests that both might mediate their effects via NFAT, a critical transcription factor for IFN- gene transcription [27
]. Indeed, we have previously demonstrated that 2-AG suppresses IL-2 production, in part, as a result of a decrease in NFAT DNA-binding activity [14
]. It is interesting that although 2-AG decreases DNA-binding activity to several regulatory elements, NFAT DNA-binding and promoter activity are the most sensitive to inhibition by these compounds [14
]. We now demonstrate that 2-AG perturbs the nuclear translocation of NFAT1 and NFAT2, two of the predominant forms of NFAT in mature lymphocytes [31
, 35
].
It is interesting to note that as opposed to suppressing NFAT protein expression, 2-AG only alters the subcellular localization of NFAT1 and NFAT2. This suggests that 2-AG disrupts a cellular process important for NFAT regulation, which contributes to the suppression of NFAT-dependent cytokine production. Nuclear translocation of NFAT is tightly regulated, in part, by fluctuations in the intracellular calcium concentration. Specifically, NFAT is dephosphorylated by calcineurin, a calcium- and calmodulin-dependent phosphatase, which is the major target of the immunosuppressive agents CsA and FK506 [36
]. The dephosphorylation of NFAT by calcineurin promotes NFAT nuclear translocation, where it interacts with other nuclear transcription factors, such as fos and jun, binds DNA, and activates gene transcription (reviewed in ref. [31
]). Thus, a likely mechanism involved in the suppression of NFAT nuclear translocation and subsequent DNA binding is a perturbation in intracellular calcium. In support of this notion, we demonstrate that TG-induced elevation in intracellular calcium, which is independent of signaling networks involved in cellular activation, was inhibited by 2-AG. Furthermore, we have demonstrated that Io partially attenuates the 2-AG-induced suppression of IFN- production, providing a critical link between the early effects on calcium and the later effects on NFAT-regulated cytokines. Collectively, our findings suggest that 2-AG does indeed alter the regulation of NFAT, at least in part, via a suppression of the intracellular calcium rise. It is interesting that in resting lymphocytes, 2-AG does not enhance intracellular calcium as shown for certain plant-derived compounds such as cannabinol and 9-THC [2
, 30
]. Although the reasons for this are not clear, these results demonstrate that despite common downstream effects (e.g., suppression of NFAT DNA-binding and promoter activity) [14
, 33
, 34
], the plant-derived and endogenous CB compounds exhibit distinct mechanisms of action. It is also noteworthy that our results are in contrast to those reported by Sugiura and colleagues [37
], who demonstrated that 2-AG induced a rapid and transient elevation in intracellular calcium in neuroblastoma-glioma hybrid cells in the same concentration range as our studies. These results suggest that 2-AG might exert differential effects in distinct cell populations.
Although there are several similarities in the mechanism by which 2-AG and CsA suppress IFN- and other cellular targets, as seen in our time-of-addition studies, there are distinct differences between the two compounds, as evidenced by our Western analyses of NFAT1 and NFAT2. 2-AG suppresses nuclear expression of NFAT1 and NFAT2, concomitant with an increase in cytoplasmic expression of each. However, it is clear from the NFAT2 Western analysis that although 2-AG and CsA appear to possess similar effects on NFAT2, the effects with 2-AG are not nearly as robust. In addition, 2-AG does not induce a robust shift in NFAT1 mobility as CsA does in the nuclear and cytoplasmic fractions, indicating that the primary mechanism by which 2-AG perturbs subcellular localization is not likely to be modulation of phosphorylation. The mechanism of 2-AG-induced changes in NFAT subcellular localization is the focus of ongoing investigations.
The mechanism by which 2-AG suppresses IFN- production in primary splenocytes is CB receptor-independent, as demonstrated using CB1–/–/CB2–/– mice. This result is consistent with our previous studies showing that CB1 and CB2 receptor antagonists, alone and in combination, were incapable of attenuating CB-induced modulation of IL-2 and AEA-induced suppression of IL-2 [2
, 11
, 38
]. Although there are a few studies demonstrating that 9-THC-induced suppression of IFN- is CB receptor-dependent, these studies were conducted in vivo using SR141716A and SR144528 and therefore, might be a result of indirect effects that are mediated via CB1 and/or CB2 [17
, 39
]. Direct T cell effects of 2-AG might involve a still-unidentified CB receptor or another receptor for which CBs are also ligands, such as the vanilloid receptor (VR1) [40
]. However, capsazepine, the VR1 antagonist, does not antagonize AEA-induced IL-2 suppression in primary mouse splenocytes [11
]. Of note, however, is the demonstration that AEA-induced IL-2 suppression was partially attenuated by a peroxisome proliferator-activated receptor- (PPAR) antagonist [11
]. This is supported by our more recent findings that a cyclooxygenase 2 metabolite of 2-AG acts as a PPAR agonist (C. E. Rockwell, N. T. Snider, J. Thompson, J. Vanden Heuvel, N. E. Kaminski, unpublished information), again, providing evidence that the CB receptor-independent mechanism of 2-AG-induced suppression of cytokine signaling involves activation of PPAR receptors. Concordant with the aforementioned results, it has recently been demonstrated that in addition to IL-2 suppression [41
], PPAR agonists suppress IFN- production through protein–protein interactions with NFAT [42
43
44
].
Overall, the present studies demonstrate that 2-AG exerts its immunosuppressive effects on IFN-, in part, via NFAT. We have previously demonstrated that NFAT is particularly sensitive to inhibition by plant-derived and endogenous CB compounds [14
, 33
, 34
], and we now demonstrate that the mechanism of 2-AG-induced suppression of NFAT activity involves, at least in part, suppression of intracellular calcium and subsequent perturbation of subcellular localization of the proteins. It is important that these data provide a critical link between the early suppression of TG-induced calcium elevation and later suppression of PMA/Io-induced IFN- production by 2-AG. These data further support the notion that 2-AG renders leukocytes unresponsive, as characterized by suppression of NFAT activity and IL-2 and IFN- production. Finally, this state of leukocyte unresponsiveness occurs independent of CB receptors, CB1 and CB2.
Received November 10, 2004; revised January 26, 2005; accepted February 14, 2005.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
gene expression J. Interferon Cytokine Res. 16,563-568[Medline] in immune cell regulation J. Leukoc. Biol. 58,373-381[Abstract] 9-Tetrahydrocannabinol treatment suppresses immunity and early IFN-, IL-12, and IL-12 receptor ß 2 responses to Legionella pneumophila infection J. Immunol. 164,6461-64669-tetrahydrocannabinol on cytokine and arachidonate release by mononuclear cells Eur. J. Pharmacol. 330,231-240[CrossRef][Medline] and suppress interleukin-1 
in vitro Int. J. Immunopharmacol. 13,1091-1097[Medline] promoter in T cells J. Biol. Chem. 273,34775-34783(9)-tetrahydrocannabinol in resting T cells J. Leukoc. Biol. 75,884-892(9)-tetrahydrocannabinol-induced inhibition of natural killer activity Eur. J. Pharmacol. 387,343-347[CrossRef][Medline] (PPAR) agonists. PPAR co-association with transcription factor NFAT J. Biol. Chem. 275,4541-4544} and its ligands attenuate biological functions of human natural killer cells Blood 104,3276-3284 agonists on T lymphocytes derived from MS patients J. Leukoc. Biol. 75,478-485 ligands ameliorate experimental autoimmune myocarditis Cardiovasc. Res. 59,685-694This article has been cited by other articles:
 |
|
 |
|
  J. P. Buchweitz, P. W. F. Karmaus, K. J. Williams, J. R. Harkema, and N. E. Kaminski Targeted deletion of cannabinoid receptors CB1 and CB2 produced enhanced inflammatory responses to influenza A/PR/8/34 in the absence and presence of {Delta}9-tetrahydrocannabinol J. Leukoc. Biol., March 1, 2008; 83(3): 785 - 796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Raduner, A. Majewska, J.-Z. Chen, X.-Q. Xie, J. Hamon, B. Faller, K.-H. Altmann, and J. Gertsch Alkylamides from Echinacea Are a New Class of Cannabinomimetics: CANNABINOID TYPE 2 RECEPTOR-DEPENDENT AND -INDEPENDENT IMMUNOMODULATORY EFFECTS J. Biol. Chem., May 19, 2006; 281(20): 14192 - 14206. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
