Published online before print March 16, 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

* Department of Pathology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; and
Laboratory of Protein Dynamics and Signaling, National Cancer Institute-Frederick, Maryland
1 Correspondence: Department of Pathology, USUHS, 4301 Jones Bridge Rd., Bethesda, MD 20814. E-mail: gdveksler{at}usuhs.mil
|
|
|---|
Key Words: reproductive immunology cytokines
|
|
|---|
fetoprotein [2
]. Treatment of monkeys and mice with anti-PSG antibodies resulted in spontaneous abortion [3
, 4
], and abnormally low levels of PSGs are associated with several serious complications of pregnancy, including fetal hypoxia, fetal growth retardation, pre-eclampsia, and spontaneous abortion [5
6
7
8
]. PSG homologues have been identified in mice, rats, and primates [9
10
11
]. We have previously shown that treatment of human monocytes with recombinant human (rh)PSG1, PSG6, and PSG11 induced the production of anti-inflammatory cytokines [12 ]. It is interesting that activated monocytes from women with recurrent spontaneous abortion display a decrease in PSG11-induced expression of interleukin (IL)-10 [13 ]. Together, these findings suggest that human PSGs are key immune-regulatory factors.
There are 17 murine PSG genes (psg 1632) localized to chromosome 7 in a region syntenic to human chromosome 19 [10 ]. Murine PSGs are similar to human PSGs in that they contain several immunoglobulin (Ig)-like domains and are heavily glycosylated. Although human PSGs consist of only one Ig-variable-like domain, murine PSGs contain multiple Ig-variable-like domains that are preceded by a short hydrophobic leader-like sequence. We have demonstrated for several murine and human PSGs that the N-terminal Ig-variable-like domain is sufficient to elicit biological activity [12 , 14 ].
Previously, we reported that the receptor for PSG17 in macrophages is the tetraspanin CD9 [15 ] and that PSG17N binds to the large, extracellular loop of this molecule [16 ]. The identity of the receptor for human PSGs remains unknown. In this study, we investigated the induction of cytokine secretion by murine PSG17N in the murine macrophage cell line RAW 264.7 and thioglycollate-induced peritoneal macrophages from T helper cell type 1 (Th1)- and Th2-prone mice. In addition, we examined the response to murine PSG17N and human PSG11 in bone marrow-derived macrophages (BMDM) obtained from wild-type and CD9-deficient mice. Furthermore, we took the first steps to elucidate the signaling mechanisms responsible for the CD9-dependent response to PSG17N, and we examined whether the tetraspanin CD81, which is closely related to CD9, can compensate for the absence of CD9 in macrophages. Our results are consistent with a role for human and murine PSGs as inducers of anti-inflammatory cytokines through the engagement of different receptors.
|
|
|---|
Five- to 6-week-old BALB/c mice were purchased from the National Cancer Institute Laboratories (Frederick, MD). C57BL/6 mice deficient in CD9 were bred from the CD9+/ breeding pair received from Dr. Claude Boucheix (Hopital Paul Brousse, Villejuif, France) [18
], and CD81-deficient mice were obtained after breeding CD81+/ received from Dr. Shoshana Levy (Division of Oncology, Stanford University School of Medicine, CA) [19
]. All animals were placed in cages with filter tops and fed standard chow and water ad libitum according to National Institutes of Health (NIH) guidelines. Peritoneal macrophages were harvested and cultured as described previously [14
]. BMDM were isolated from the femur and tibia of wild-type and CD9-deficient C57BL/6 mice. The cells were disaggregated by passage through an 18-g needle and pelleted at 1000 rpm for 5 min, and red blood cells were lysed using NH4Cl lysis solution (Sigma Chemical Co., St. Louis, MO). After 5 min, 45 ml phosphate-buffered saline (PBS) containing 2% FBS was added, and the cells were pelleted. To generate an immortalized macrophage cell line, 2 x 107 bone marrow cells were resuspended in 5 ml
CREJ2 cell supernatant (a source of the J2 transforming retrovirus) [20
] with 500 µl of 500 µg/ml polybrene (Sigma Chemical Co.) and 5 µl of 106 U/ml granulocyte macrophage-colony stimulating factor (GM-CSF; Peprotech, Rocky Hill, NJ). After 24 h at 37°C, the supernatant was removed, and the cells were grown in DMEM/10% FBS containing GM-CSF for 7 days. GM-CSF was then withdrawn, and the cells were cultured further in DMEM/10% FBS to establish growth factor-independent cell lines. These cells were maintained in DMEM supplemented with 5% heat-inactivated FBS, 200 mM L-glutamine, and PSA. For some experiments, when lower levels of FBS were desired, the cells were maintained in Advanced D-MEM (Invitrogen, Carlsbad, CA) with 2% heat-inactivated FBS.
Fluorescein-activated cell sorter (FACS) analysis
BMDM from wild-type and CD9-deficient mice were subjected to analysis with an EPICS XL-MCL flow cytometer (Beckman Coulter, Fullerton, CA) using the KMC8.8 phycoerythrin (PE)-labeled anti-CD9 monoclonal antibody (mAb; BD PharMingen, San Diego, CA), PE-labeled mAb target of antiproliferative antibody 1 (eat2) to detect expression of CD81, and a fluorescein isothiocyanate-conjugated anti-F4/80 mAb (Serotec, Raleigh, NC). The data were collected for 1 x 104 cells. Prior to incubation with the specific antibodies, the cells were incubated with 1 µg of Fc block (BD PharMingen) per 1 x 106 cells.
Generation of recombinant proteins
To generate the recombinant PSG17N-Myc-His protein, the N-terminal domain of PSG17 was amplified by polymerase chain reaction (PCR) from full-length PSG17 [8
] in pBluescript II KS+ (Stratagene, La Jolla, CA) with primers 5' GAAGATCTAGAGATATGGAG(T/G)TGTC 3' (underlined BglII site) and 5' TTGGTACCCTCATTT (A/G)TCACAG(C/T) CAGG 3' (underlined KpnI site). The PCR product was inserted into the pCRII-TOPO vector (Invitrogen). The PSG17N cDNA was removed from pCRII-TOPO by digestion with BglII and KpnI and ligated into pcDNA3.1 Myc-His (Invitrogen), resulting in the in-frame addition of the myc-epitope and 6x histidines at the C-terminus. PSG17N-Myc-His was then inserted into the NotI- and PstI-digested pFastBac (Invitrogen). Recombinant baculovirus was obtained following the manufacturers instructions (Invitrogen) and purified from insect cell supernatant as described previously for PSG18N-Myc-His [15
]. Glutathione S-tranferase (GST)-PSG11 and the GST-His-XylE control protein were purified as described previously [12
] using glutathione-sepharose beads (Amersham Pharmacia, Little Chalfont, UK).
The initial characterization of the activity of PSG17N in RAW cells and BALB/c peritoneal macrophages was performed using the recombinant protein produced in insect cells. Subsequent studies were performed using PSG17N-Myc-His secreted from CHO cells. To generate PSG17N-Myc-His in CHO cells, PSG17N-Myc-His was excised from pcDNA3.1 Myc-His with PmeI and subcloned into the EcoRV site of the pEAK10 vector which contains the elongation factor 1-alpha promoter (Edge Biosystems, Gaithersburg, MD). Dihydrofolate reductase-deficient CHO cells were cotransfected using the Fugene 6 reagent (Roche, Indianapolis, IN) with PSG17N-Myc-His in pEAK10 and pDHIP at a 10:1 molar ratio as described previously [21 ]. Dr. Gerardo Kaplan [Center for Biologics Evaluation and Research, U.S. Food and Drug Administration (CBER, FDA), Rockville, MD] provided the pDHIP plasmid, which codes for the CHO cell dhfr 2.5-Kb minigene that contains the six exons of the gene but lacks introns 2 to 5 and confers methotrexate resistance. A single-cell clone expressing the highest level of PSG17N-Myc-His was selected for amplification and inoculation in a Cell Max cartridge (Spectrum Laboratories, Rancho Dominguez, CA).
PSG17N-Myc-His, harvested from the supernatant of Sf9 insect cells grown in SF900 II media (Invitrogen) with 2% FBS or PSG17N-Myc-His harvested from the CHO cell medium, was purified using identical conditions. The supernatant was first dialyzed in 160x vol 300 mM NaCl and 50 mM NaHPO4, pH 7.4, overnight at 4°C prior to the incubation with Ni-NTA agarose beads (Qiagen, Valencia, CA) followed by washes and a final elution with 250 mM imidazole, pH 7.3, as per the manufacturers recommendations. The eluted proteins were then loaded onto a 1011% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in a Model 491 Prep Cell apparatus (Bio-Rad, Hercules, CA), and fractions were collected as they migrated out of the gel and were analyzed by immunoblot. To remove the SDS, fractions were electroeluted using a 2-kDa MW cutoff cellulose acetate membrane in 0.01 M Tris.HCl, pH 8 (Harvard Apparatus, Holliston, MA). Prep cell fractions that reacted with R90 polyclonal antibody (pAb; see Antibodies and reagents) and anti-myc mAb (Invitrogen) were pooled together, concentrated using a Centriprep 10 (Millipore, Bedford, MA), dialyzed against PBS, and quantitated against bovine serum albumin standards (Pierce, Rockford, IL) after Coommassie blue staining of the SDS-PAGE-separated proteins. Fractions that contained proteins that did not react with R90 and anti-myc were pooled together as well, their concentration adjusted to match that of the R90 and anti-myc-reactive fractions, and used as a control for the CHO cell-produced PSG17N-Myc-His. All recombinant proteins were tested for endotoxin contamination using the Limulus amebocyte lysate assay (BioWhittaker, Woburn, MA). When endotoxin was detected, the proteins were further incubated with the ActiClean Etox resin (Sterogene Bioseparations, Carlsbad, CA) for its removal. Only lipopolysaccharide (LPS)-free recombinant proteins were used for all experiments.
Antibodies and reagents
We generated R90 by immunizing a rabbit with PSG17N-Myc-His produced in CHO cells using standard methodology (Southern Biotechnology, Birmingham, AL). For immunoblot analysis, the following antibodies were used: anti-myc (Invitrogen), anti-cyclooxygenase-2 (COX-2) pAb (Upstate Biotechnology, Lake Placid, NY), and anti-GST mAb (Santa Cruz Biotechnology, CA). The endotoxin-free, azide-free, anti-murine CD9 mAb KMC8.8 was obtained from BD PharMingen. The COX-2-specific inhibitor NS-398 (Cayman Chemicals, Ann Arbor, MI) was added to the cells at a concentration of 1 µM, 30 min prior to PSG17N or control protein addition. The protein kinase A (PKA) inhibitor KT5720 (Calbiochem) was added to the cells at a concentration of 50 nM for 6 h before the addition of PSG17N or control protein. The PKC inhibitors Go6983 and Go6976 (Biomol) or vehicle only [dimethyl sulfoxide (DMSO)] were added 60 min prior to PSG17N treatment. Cell viability was monitored using trypan blue exclusion and the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay (Promega, Madison, WI). Phorbol 12-myristate 13-acetate (PMA) was obtained from LC Laboratories (Woburn, MA) and added at a 1-µM final concentration. The neutralizing anti-transforming growth factor-ß1 (TGF-ß1)/1.2 polyclonal chicken IgY antibody (R&D Systems, Minneapolis, MN) and the control antibody of the same isotype were added at 50 µg/ml for 30 min prior to PSG17N treatment.
Cytokine and prostaglandin E2 (PGE2) enzyme-linked immunosorbent assay (ELISA)
RAW 264.7 cells and peritoneal macrophages were seeded in 24-well tissue-culture plates at 1 x 106 or 1.5 x 106 cells per well, respectively. BMDM were seeded at a density of 1.2 x 106 cells per well. After 24 h, the cells were treated in triplicate with PSG17N-Myc-His or the control protein for 4 h at 37°C in 300 µl media. When the treatments were for less than 2 h, the volume was kept to 300 µl; after 4 h, the volume was increased to 1 ml in each well by addition of cell culture media. Supernatants were harvested at different times post-treatment depending on the cytokine under study, as indicated in Results. ELISA was used to measure secreted IL-10, IL-12p40, IL-6 (Pierce-Endogen, Woburn, MA), and TGF-ß1 (R&D Systems) in cell supernatants. The limit of detection was 31 pg/ml for IL-10 and 15 pg/ml for IL-6, IL-12p40, and TGF-ß1. PGE2 secretion was determined using the high-sensitivity (8.26 pg/ml) ELISA kit (Assay Designs, Ann Arbor, MI). Treatment with 0.11 µg/ml LPS was used as a positive control.
Immunoblot analysis
BMDM lysates were obtained by adding 120 µl phosphosafe buffer (Novagen, Madison, WI) with protease inhibitors to cells seeded at a density of 5 x 106 cells/well of a six-well plate the previous day. The protein concentration in each well was determined using the bicinchoninic acid reagent (Pierce), and equal amounts (100 µg) were loaded per lane of a 420% NuPage gel (Invitrogen). After transferring to a polyvinylidene difluoride membrane and blocking, the membranes were incubated overnight at 4°C with the specific antibody at the concentration recommended by the manufacturer. For analysis of COX-2 induction, an anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mAb (Research Diagnostics, Flanders, NJ) was used for loading normalization.
Data analysis
Data were obtained from at least three independent experiments. Results were evaluated for statistical significance using the unpaired Students t-test. Data were expressed as mean ± SE, and significance was defined at P < 0.05.
|
|
|---|
(TNF-
) or IL-12 measured up to 48 h post-treatment. In addition, we did not observe induction of cytokines (IL-10, IL-6, IL-12 p40) upon treatment of cells with up to 50 µg/ml anti-CD9 mAb KMC8.8 (data not shown), which is in agreement with results obtained by Takeda and coworkers [17
] using a different anti-CD9 mAb.
Induction of IL-10, IL-6, and TGF-ß1 by PSG17 is CD9-mediated
We identified the receptor for PSG17 in macrophages as the tetraspanin CD9 by screening an expression library [15
]. Our next objective was to determine whether the observed biological responses to PSG17 treatment were CD9-mediated. In addition, we examined whether the absence of CD81, a tetraspanin known to complex with CD9, could interfere with the ability of PSG17 to stimulate the production of immunoregulatory molecules in murine macrophages.
CD9-deficient mice are of the C57BL/6 background; therefore, we repeated the studies performed in the RAW cells and BALB/c peritoneal macrophages described above in macrophages isolated from C57BL/6 wild-type and CD9-deficient mice. Figure 1 shows that PSG17N induced secretion of IL-10, IL-6, and TGF-ß1 in thioglycollate-elicited macrophages isolated from wild-type mice. However, in macrophages isolated from CD9-deficient mice, the level of all three cytokines was the same in the control and PSG17N-treated cells. Thus, induction of anti-inflammatory cytokines by PSG17N is blocked in the absence of CD9. Wild-type and CD9-deficient macrophages, although responding equally to LPS treatment, did not up-regulate IL-12p40 in response to PSG17N treatment (Fig. 1D and 1E) .
![]() View larger version (36K): [in a new window] |
Figure 1. PSG17N induces IL-10, IL-6, and TGF-ß1 secretion in C57BL/6 thioglycollate-elicited peritoneal macrophages expressing CD9. Peritoneal macrophages isolated from wild-type and CD9-deficient (CD9KO) mice were treated in triplicate with PSG17N-Myc-His (PSG17N), the control protein (GST-His-XylE), or LPS as a control (100 ng/ml) (E). Supernatants were harvested at 24 h post-treatment (A, B, D, and E) or at 2 h post-treatment (C). PSG17N and the control protein were added at a concentration of 25 µg/ml for the analysis of IL-10, IL-12, and TGF-ß1 and 15 µg/ml for the analysis of IL-6. For IL-10 quantitation, the cells were cotreated with PSG17N and a suboptimal concentration of LPS (1 ng/ml) and therefore measured in different supernatants than the other cytokines. The results are expressed as the means ± SEM and are representative of three experiments. *, P < 0.05, compared with control-treated cells.
|
![]() View larger version (31K): [in a new window] |
Figure 2. CD9 is required for the dose-dependent induction of IL-10, IL-6, and TGF-ß1 by PSG17 in BMDM. J2-transformed BMDM from C57BL/6 wild-type (WT) and CD9-deficient (CD9KO) mice were treated in triplicate with PSG17N or the control protein, and the cytokines in the supernatants were measured by ELISA. As described in Figure 1
, IL-10 production was measured in response to PSG17N and 1 ng/ml LPS treatment. IL-10, IL-6, and IL-12 were analyzed in the supernatants at 24 h post-treatment, and TGF-ß1 was measured at 2 h post-treatment. All data are representative of three experiments. *, P < 0.05, compared with control-treated cells.
|
PSG17 induces PGE2 and up-regulates COX-2 expression
Up-regulation of IL-6 and IL-10 mRNA in RAW 264.7 cells after treatment with PSG17 requires de novo protein synthesis, as demonstrated by the significant inhibition in the expression of these cytokines upon treatment of the cells with 5 µg/ml cycloheximide (data not shown). PGE2 has been shown to play a role in regulating the Th1/Th2 balance [22
, 23
]. This prompted us to investigate whether PSG17N can induce PGE2 secretion and as a result, has the ability to potentially regulate the innate and acquired immune responses. RAW 264.7 cells were treated with 10 µg/ml PSG17N. In response to PSG17N, significant levels of PGE2 were produced (Fig. 3A
). Supernatants analyzed at 2, 4, and 6 h post-treatment showed that PGE2 secretion peaked at 2 h post-treatment and at later time-points, was no longer significant compared with treatment with the control protein (data not shown). When PGE2 levels were measured in BMDM supernatants, they were up-regulated in response to PSG17N and reached a maximal concentration at 6 h post-treatment. PGE2 secretion in response to PSG17N treatment was observed only in CD9 wild-type mice, which correlated with the induction of COX-2 expression, the rate-limiting, catalyzing enzyme involved in PGE2 synthesis (Fig. 3B
and 3C)
.
![]() View larger version (26K): [in a new window] |
Figure 3. The PSG17-CD9-mediated induction of COX-2 results in the secretion of PGE2. (A). RAW cells were treated with PSG17N or the control protein in triplicate, and the supernatants were harvested at 2 h for the analysis of PGE2 by ELISA. (B). Wild-type (WT) and CD9-deficient (CD9KO) BMDM were treated with control protein or PSG17N in the presence or absence of NS-398. At 6 h post-treatment, PGE2 was measured in the supernatants by ELISA. *, P < 0.05, compared with control-treated cells. (C) BMDM from wild-type and CD9-deficient mice were treated with 20 µg/ml PSG17N, control protein, or LPS (1 µg/ml) for 6 h. Cell lysates were analyzed for the expression of COX-2 and GAPDH by Western blot.
|
![]() View larger version (39K): [in a new window] |
Figure 4. PSG17N-induced IL-10 and IL-6 secretion requires induction of COX-2 and activation of PKA. BMDM were treated in triplicate with 20 µg/ml PSG17N or control protein in the presence or absence of the COX-2 inhibitor NS-398 (A) and the cyclic adenosine monophosphate (cAMP)-dependent PKA inhibitor KT5720 (B). The supernatants were harvested at 24 h post-treatment for IL-10 and IL-6 ELISA analysis. For IL-10, the supernatants were concentrated eightfold prior to the ELISA. All data are representative of three experiments. *, P < 0.05, compared with PSG17N and inhibitor-cotreated cells.
|
TGF-ß1 has been reported to induce IL-6 production in peripheral blood mononuclear cells and up-regulate IL-10 production in murine macrophages, which may explain the significance of early production of this cytokine by activated macrophages [29 , 30 ]. We, therefore, investigated whether neutralization of TGF-ß1 had an effect on IL-6 and IL-10 induction. No difference in the levels of PSG17N-mediated IL-6 and IL-10 was observed in BMDM cotreated with anti-TGF-ß antibody or with an isotype-matched antibody control or in the cells treated with PSG17N only (data not shown).
PKC regulates macrophage production of TGF-ß1 and COX-2 in response to PSG17 treatment
Two regions in the TGF-ß1 promoter are responsive to TGF-ß1 autoinduction and to the induction by phorbol ester. Treatment of RAW 264.7 cells and primary macrophages with PMA resulted in the up-regulation of TGF-ß1 secretion (data not shown). Because of this observation and the reported interaction of CD9 with PKC, we pretreated RAW 264.7 cells with Go6983, which inhibits the conventional PKC-
, -ß, and -
and the nonconventional PKC-
. Treatment with Go6983 inhibited the PSG17-induced secretion of TGF-ß1 at all concentrations tested in RAW 264.7 cells (Fig. 5A
) and primary macrophages (data not shown). In addition, Go6983 resulted in a significant reduction of the PSG17-mediated induction of COX-2. Treatment of RAW 264.7 cells with 10 nM Go6983 resulted in a significant reduction of the PSG17N-mediated induction of COX-2 (twofold induction over control-treated cells in the presence of 10 nM Go6983 vs. 3.15-fold induction observed without the inhibitor). When the cells were treated with 100 or 1000 nM Go6983 prior to PSG17N, COX-2 was reduced to baseline level (data not shown). In accordance with these results, Go6983 (10, 100, and 1000 nM) added prior to PSG17N treatment resulted in a significant inhibition of IL-6 (Fig. 5B)
and IL-10 induction (data not shown) when compared with PSG17N-treated cells in the absence of inhibitor. Similar results were obtained upon treatment of primary peritoneal macrophages (data not shown).
![]() View larger version (35K): [in a new window] |
Figure 5. PKC is required for the PSG17N-mediated induction of TGF-ß1 IL-6, and IL-10. RAW 264.7 cells were treated in triplicate with the indicated concentrations of Go6983 or vehicle (DMSO) for 1 h before the addition of PSG17N or control protein. The supernatants were harvested at 3 h post-treatment for quantitation of TGF-ß1 (A) or 24 h post-treatment for quantitation of IL-6 (B) and IL-10 (C) by ELISA. For IL-10, the supernatants were concentrated eightfold prior to the ELISA. All data are representative of three experiments. *, P < 0.05, compared with PSG17N and inhibitor-cotreated cells.
|
![]() View larger version (21K): [in a new window] |
Figure 6. Induction of cytokines by human PSGs is independent of the expression of CD9. BMDM isolated from wild-type or CD9-deficient (CD9KO) mice were treated in triplicate with 7 µg/ml recombinant GST-PSG11 (A), GST-PSG1d (B) or control protein (GST-XylE), and the supernatants were harvested 24 h post-treatment for the analysis of IL-6 (A) or at 2 h post-treatment for TGF-ß1 (B) by ELISA. All data are representative of three experiments. *, P< 0.05, compared with control-treated cells.
|
|
|
|---|
Tetraspanins are expressed together as part of a multimolecular complex on the cell surface [39 ]. In some instances, one tetraspanin could compensate for the lack of expression of the other. This is the case for CD81, which has been shown to compensate for the deficiency of CD9 in egg-sperm fusion [40 ]. In other cases, the specific function of some members of the family has been revealed [41 ]. In this investigation, we demonstrated that this seems to be the case for CD9, being the unique receptor for PSG17. In previous studies, we were unable to detect binding of PSG17 to any of the other tetraspanins tested [15 ], and here, we confirmed that the lack of the CD9 partner CD81 does not alter the response of macrophages to PSG17N.
Although kinetics and fold induction of IL-10, IL-6, PGE2, and TGF-ß1 in response to PSG17N treatment were different in RAW 264.7 cells, thioglycollate-induced BALB/c and C57BL/6 peritoneal macrophages, and BMDM, it is clear that these cytokines were induced by PSG17N in all the macrophages studied. The lack of induction of IL-12 and TNF-
by PSG17 concurs with our previous data on macrophage treatment with human PSG1, -6, and -11 and murine PSG18, none of which increased secretion of inflammatory cytokines at the RNA or protein level.
Through induction of IL-10, PSGs may contribute to the down-regulation of inflammatory Th1 cytokines, locally at the fetal maternal junction and/or systemically. Increased concentrations of IL-10 have been reported at the fetal-maternal interface in normal pregnancies in mice and humans [42 ]. IL-6 is a multifunctional cytokine with the ability to stimulate a variety of different cells and has been demonstrated to function as an important anti-inflammatory cytokine locally and systemically [43 ]. Uterine decidual cells and macrophages have been reported to express IL-6 during implantation and throughout pregnancy in mice [44 45 46 ]. In addition to its role during the immune response, IL-6 induces production of human chorionic gonadotropin from first-trimester human trophoblasts in culture [47 ].
PGE2 has been reported to regulate IL-6 and IL-10 production by activated macrophages and to regulate T cell differentiation, favoring Th2 cell development, through induction of IL-10 [23 , 48 ]. In BMDM, COX-2 induction was observed starting at 2 h post-PSG17N treatment followed by an increase of PGE2 secretion detected at 6 h post-treatment. Inhibition of COX-2 resulted in a significant reduction in the PSG17N-mediated up-regulation of IL-6 and in a less-significant manner, inhibited the induction of IL-10, which could be regulated to some extent by TGF-ß secretion, which is not affected by COX-2 inhibition.
We next studied the involvement of the cAMP-dependent PKA pathway in the PSG17N-mediated induction of IL-10 and IL-6. We found that the introduction of the cAMP/PKA-selective inhibitor KT5720 reduced the secretion of IL-10 and IL-6 significantly. Most of the genes regulated by cAMP/PKA contain a cis-acting DNA sequence, CRE, which is the binding site for the transcriptional factor CREB. It is interesting that the COX-2, IL-10, and IL-6 genes have CRE sites in their 5' flanking promoter region [49 50 51 52 ]. Preliminary experiments to examine the effect of PSG17N on CREB phosphorylation showed that phosphorylated CREB could be detected 15 min post-PSG17N treatment only in wild-type but not in CD9-deficient BMDM. Future studies are needed to determine the duration and magnitude of the phosphorylation of CREB and the regulation of other transcription factors in response to PSG17N.
It has been reported that TGF-ß up-regulates IL-10 and IL-6 in various cell lines [53 54 55 ]. Hence, we decided to investigate the effect of PSG17N-mediated secretion of TGF-ß1 on IL-10 and IL-6 production. However, we were unable, via neutralization of TGF-ß1 during PSG17N treatment, to demonstrate a relationship between TGF-ß1 secretion and the up-regulation of IL-10 and IL-6. Autoinduction of TGF-ß1 has been reported, and treatment with neutralizing anti-TGF-ß1 antibodies may not be efficient for its complete neutralization (John Letterio, (NCI, NIH, Bethesda, MD) personal communication). Therefore, at this point, we cannot conclusively rule out the involvement of TGF-ß1 in the up-regulation of IL-10 or IL-6 in our system.
Our data indicate that induction of TGF-ß1 as well as of COX-2, IL-6, and IL-10 is significantly inhibited in the presence of the conventional and nonconventional PKC inhibitor Go6983. As observed in the COX-2 and PKA inhibition experiments, although PSG17N-mediated induction of IL-10 and IL-6 was reduced significantly in the presence of the PKC inhibitor when compared with PSG17N-treated cells in the absence of inhibitor, IL-10 and IL-6 were not reduced to basal levels. This suggests that an additional pathway is involved in the PSG17 up-regulation of these cytokines. In an attempt to better identify the PKC isozyme implicated in the response to PSG17, we pretreated the cells with 0.12 µM Go6976, which inhibits the conventional PKC-
and -ß1 and PKD. Although Go6976 significantly reduced the secretion of cytokines, Go6976 treatment resulted in reduced cell viability at all concentrations. Therefore, although our data suggest that conventional PKCs might be implicated in the PSG17-mediated induction of cytokines, further experiments are required to better identify the PKC isozyme(s) involved.
We propose that PKC activation could be one of the initial steps following binding of PSG17 to CD9 in the cascade of signaling events, resulting in the secretion of cytokines. CD9 has been shown to associate with conventional PKC isoforms in multiple adherent and nonadherent cell lines, and Giroux and Descoteaux [56
] reported that PKC-
modulates COX-2 expression in macrophages exposed to LPS and inteferon-
[57
]. In addition, in some cell types, activation of PKC has been implicated in the up-regulation of TGF-ß1 [58
]. In light of these findings, the relationship among individual PKC isoforms, the mitogen-activated protein kinase family, and PSG-mediated cytokine secretion merits further investigation.
In conclusion, our results indicate that the biological effect of murine PSG17 is similar to that of three human PSG family members in macrophages isolated from Th1-dominant (C57BL/6) and Th2-dominant (BALB/c) mice. It is important that the tetraspanin CD9 is required for the PSG17-mediated cytokine induction, which raises the possibility that all murine PSGs share the same receptor. PSG19, like PSG17, induces the secretion of the same cytokines in macrophages, and PSG19 uses CD9 as its receptor (unpublished results). In contrast, human PSG1d and -11 and most likely other human PSGs do not use CD9 as their receptor. In this respect, it is important to note that members of the human and murine PSG family have only 60% homology in the N-terminal domain, which we have shown is sufficient for the ability of these proteins to induce cytokines. Conversely, the homology between human PSGs is greater than 85%, which suggests that they might use the same receptor. Through binding to different receptors, human and murine PSGs may use identical signaling mechanisms that result in the secretion of the same cytokines. The identity of the receptor for human PSGs as well as the signaling molecules involved remain to be elucidated.
High levels of PSG expression in human pregnancy and decreased production in fetal pathologies imply a critical role for these proteins in pregnancy. We suggest that the induction of anti-inflammatory mediators in macrophages by placentally produced PSGs plays a role in the generation of an immune environment compatible with successful pregnancy.
Received August 13, 2004; revised February 15, 2005; accepted February 17, 2005.
|
|
|---|
2-glycoprotein Biomed. Biochim. Acta 44,1255-1259[Medline]
-fetoprotein in serum in threatened abortion Int. J. Gynaecol. Obstet. 21,111-117[CrossRef][Medline]
2-macroglobulin-induced cellular proliferation J. Biol. Chem. 277,36509-36520
in mouse uterus during the peri-implantation period of pregnancy J. Reprod. Fertil. 97,83-89
and cAMP elevating drugs Int. Immunol. 7,517-523
J. Immunol. 165,3985-3991This article has been cited by other articles:
![]() |
J. A. Wu, B. L. Johnson, Y. Chen, C. T. Ha, and G. S. Dveksler Murine Pregnancy-Specific Glycoprotein 23 Induces the Proangiogenic Factors Transforming-Growth Factor Beta 1 and Vascular Endothelial Growth Factor A in Cell Types Involved in Vascular Remodeling in Pregnancy Biol Reprod, December 1, 2008; 79(6): 1054 - 1061. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Lindemann, Z. Hu, M. Benczik, K. D. Liu, and S. L. Gaffen Differential Regulation of the IL-17 Receptor by {gamma}c Cytokines: INHIBITORY SIGNALING BY THE PHOSPHATIDYLINOSITOL 3-KINASE PATHWAY J. Biol. Chem., May 16, 2008; 283(20): 14100 - 14108. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Colino and C. M. Snapper Dendritic Cell-Derived Exosomes Express a Streptococcus pneumoniae Capsular Polysaccharide Type 14 Cross-Reactive Antigen That Induces Protective Immunoglobulin Responses against Pneumococcal Infection in Mice Infect. Immun., January 1, 2007; 75(1): 220 - 230. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Gellersen, J. Briese, M. Oberndorfer, K. Redlin, A. Samalecos, D.-U. Richter, T. Loning, H.-M. Schulte, and A.-M. Bamberger Expression of the Metastasis Suppressor KAI1 in Decidual Cells at the Human Maternal-Fetal Interface: Regulation and Functional Implications Am. J. Pathol., January 1, 2007; 170(1): 126 - 139. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Seavey and T. R. Mosmann Paternal Antigen-Bearing Cells Transferred during Insemination Do Not Stimulate Anti-Paternal CD8+ T Cells: Role of Estradiol in Locally Inhibiting CD8+ T Cell Responses J. Immunol., December 1, 2006; 177(11): 7567 - 7578. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Wynne, M. Ball, A. S McLellan, P. Dockery, W. Zimmermann, and T. Moore Mouse pregnancy-specific glycoproteins: tissue-specific expression and evidence of association with maternal vasculature. Reproduction, April 1, 2006; 131(4): 721 - 732. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||