Published online before print April 13, 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,25-dihydroxyvitamin D3

* Department of Cell Biology and Neurosciences, Istituto Superiore di Sanità, Roma, Italy; and
BioXell, Milano, Italy
1 Correspondence: Department of Cell Biology and Neurosciences, Istituto Superiore di Sanità, Viale Regina Elena 299, 00161 Rome, Italy. E-mail: gessani{at}iss.it
|
|
|---|
,25-dihydroxyvitamin D3 [1,25(OH)2D3], a potent inhibitor of DC differentiation, completely abolished IRF-4 up-regulation. IRF-4 was also detected in blood P-DC and M-DC. However, up-regulation upon in vitro culture and down-regulation by 1,25(OH)2D3 was observed in M-DC but not in P-DC. These results point to IRF-4 as a potential player in human myeloid DC differentiation and as a novel target for the immunomodulatory activity of 1,25(OH)2D3.
Key Words: transcription factor immunomodulator gene regulation
|
|
|---|
Dendritic cells (DC) are professional antigen-presenting cells playing a pivotal role in the regulation of the immune response [5
]. Their flexibility can be explained by the existence of distinct subsets differing in phenotype, function, activation state, and location [6
]. However, the origins and the genetic events determining the development of specific DC subsets from hematopoietic precursors have not been fully elucidated. Studies in gene-disrupted mice revealed the importance of IRF family members as key checkpoints for the development of distinct murine DC subsets [7
8
9
10
11
12
13
]. In particular, IRF-4 was shown to be crucial for the development of CD11b+CD8
conventional DC [9
].
In this study, we have characterized the expression of IRF-4 in human monocyte-derived macrophages (MDM) and DC (MDDC), and in blood DC, reporting a clear-cut up-regulation of IRF-4 expression strictly associated with the induction of myeloid DC differentiation. Moreover, we show that IRF-4 up-regulation is blocked by 1
,25-dihydroxyvitamin D3 [1,25(OH)2D3], a potent inhibitor of myeloid DC differentiation [14
].
We have first analyzed the expression of IRF-4 mRNA and protein in MDM and MDDC, generated by two cytokine cocktails, granulocyte macrophage-colony stimulating factor (GM-CSF)/interleukin (IL-4-DC) and GM-CSF/IFN-ß (IFN-DC). Although IRF-4 mRNA was not detectable in MDM, it was clearly expressed in IL-4-DC and IFN-DC (Fig. 1A ). Similarly, IRF-4 protein was barely or not detectable in ex vivo monocytes and MDM, whereas it was strongly up-regulated in both MDDC types (Fig. 1B) . A time-course analysis of IRF-4 expression (Fig. 1C) showed that maximum protein level was achieved within 1624 h of cytokine exposure. IRF-4 expression was further up-regulated upon LPS treatment of both DC types (Fig. 1D) . Monocytes cultured in the absence of cytokines or with GM-CSF alone exhibited barely detectable levels of IRF-4 but also responded to LPS stimulation by up-regulating its expression (Fig. 1D) .
![]() View larger version (41K): [in a new window] |
Figure 1. Monocyte differentiation into DC correlates with IRF-4 up-regulation. Human peripheral blood monocytes were isolated as described elsewhere [15
]. MDM were obtained by culture in Iscoves modified Dulbeccos medium (Gibco-BRL, Grand Island, NY), 15% fetal bovine serum (FBS), without exogenous cytokines. DC were obtained by culture in RPMI 1640 (Gibco-BRL), 10% FBS, supplemented with 50 ng/ml GM-CSF and 500 U/ml IL-4 (IL-4-DC) or with 50 ng/ml GM-CSF and 1000 IU/ml IFN-ß (IFN-DC). (A) IRF-4 mRNA expression. Total RNA, extracted from MDM and IL-4 DC at day 7 of culture and from IFN-DC at day 5, was subjected to reverse transcriptase-polymerase chain reaction (RT-PCR) with primers specific for IRF-4 (forward, CCAGTCGACGCAAGCTCTTTGACACAC; reverse, CCAGCGGCCGCCTTTTCATTCTTGAATAG) and as an internal control, for the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH; forward, CCATGGAGAAGGCTGGGG; reverse, CAAAG-TTGTCATGGATGACC). (BD) IRF-4 protein expression. Cells were lysed in radio immunoprecipitation assay buffer [150 mM NaCl, 50 mM Tris-Cl, pH 7.5, 1% Nonidet P-40, 0.5% sodium deoxicholate, 0.1% sodium dodecyl sulfate (SDS)] containing the complete protease inhibitor cocktail (Roche Molecular Biochemicals, Indianapolis, IN). Lysate (1520 µg) was fractionated on 10% SDS-polyacrylamide gel electrophoresis, electroblotted to nitrocellulose filters, and probed with a goat anti-human IRF-4 antibody (M-17, Santa Cruz Biotechnology, CA). Blots were then stripped and reprobed with a mouse monoclonal anti-actin antibody (Ab-1, Oncogene, Cambridge, MA) to ensure equal protein loading. Within each single panel, the different cell types were derived from the same donor. (B) Cell extracts were prepared from monocytes ex vivo or after in vitro culture for 5 days (IFN-DC) or 7 days (MDM and IL-4-DC). (C) Cell extracts were prepared at the indicated time-points from monocytes ex vivo or cultured in the absence or presence of the indicated cytokines. (D) Cells, cultured in the presence of the indicated cytokines, were left untreated or lipopolysaccharide (LPS)-stimulated (100 ng/ml, 48 h) and analyzed at day 5.
|
![]() View larger version (41K): [in a new window] |
Figure 2. Inhibition of DC differentiation by 1,25(OH)2D3 abolishes IRF-4 up-regulation. (A) IRF-4 mRNA expression. RT-PCR was performed as described in the legend to Figure 1
. 1,25(OH)2D3(10 nm), absent in control cultures, was added at cell-seeding (D3) or at day 3 (IFN-DC) or day 5 (IL-4-DC) for 8 h (D3, 8h). (B) IRF-4 protein expression. Western blot analysis was performed as described in the legend to Figure 1
. 1,25(OH)2D3, absent in control cultures, was added at seeding (D3) or at day 3 (IFN-DC) or day 5 (IL-4-DC) and maintained for 48 h (D3, 48h). Within each single panel, the different cell types were derived from the same donor.
|
![]() View larger version (45K): [in a new window] |
Figure 3. IRF-4 expression is differentially modulated in blood DC subsets upon culture and 1,25(OH)2D3 exposure. Blood DC, sorted from peripheral blood mononuclear cells with blood DC antigen-1 (BDCA-1; M-DC) or BDCA-2 (P-DC) isolation kits (Miltenyi Biotec, Auburn, CA), were analyzed soon after their isolation (ex-vivo) or after 48 h of culture in RPMI 5% FBS plus 10 ng/ml IL-3 (P-DC) or 50 ng/ml GM-CSF and 500 IU/ml IL-4 (M-DC) in the presence or absence of 10 nM 1,25(OH)2D3. IRF-4 expression was analyzed by Western blot, as described in the legend to Figure 1
.
|
|
|
|---|
[21
] and IL-4 [3
] in lymphocytes. Furthermore, IRF-4 expression in lymphocytes is regulated by pathways known to drive their activation [3
], and we detected a LPS-induced up-regulation of IRF-4 in all cell types tested, including MDM. All this suggests that the pathways of activation/repression of IRF-4 in the human myeloid lineage resemble those occurring in the lymphoid compartment. In addition, previous studies carried out in murine and human B and T cells have demonstrated that IRF-4 activates or represses the transcription of some lineage-specific genes, which include the immunoglobulin light chain, CD20, and IL-2, depending on the target sequence in the promoter and/or specific interaction with other transcriptional regulators [2
, 3
]. Studies are in progress to address the mechanistic aspects of IRF-4 activity on DC differentiation.
We also report for the first time that IRF-4 expression can be inhibited by 1,25(OH)2D3. The observation that a well-known inhibitor of DC differentiation and maturation, such as 1,25(OH)2D3, is a potent inhibitor of IRF-4 expression further highlights the important role this factor may play in human myeloid DC differentiation. Of note, some of the inhibitory effects of 1,25(OH)2D3 on DC have been associated with its capacity to impair nuclear factor (NF)-
B activation [22
]. It is interesting that IRF-4 mRNA is not induced in lymphocytes isolated from c-rel/ mice, and two
B elements within the IRF-4 promoter are necessary and sufficient for Rel-dependent IRF-4 transcription [23
]. IRF-4 expression is also controlled by regulatory elements interacting with NF of activated T cells (NF-AT) and specificity protein-1 [24
], and 1,25(OH)2D3 can impair NF-AT complex formation [14
]. Thus, the inhibitory effect of 1,25(OH)2D3 on IRF-4 expression could be related to its capacity to interfere with activation of these transcription factors. Once induced during DC differentiation, IRF-4 expression was quite stable over the culture period examined, without being reduced significantly by 1,25(OH)2D3, suggesting that different mechanisms could be involved in the control of IRF-4 expression in distinct cell types. It is notable that IRF-4 is similarly expressed in blood P-DC and M-DC, but its expression is inhibited by 1,25(OH)2D3 only in M-DC, showing that MDDC and blood M-DC exhibit a qualitatively similar pattern of IRF-4 expression and regulation.
In the lymphoid lineage, IRF-4 may serve as an integrator of lymphocyte responses rather than as a master regulator of specific differentiation programs [3 ]. Based on our results, it is tempting to speculate that IRF-4 may play a similar role in human M-DC.
Received February 14, 2005; revised March 15, 2005; accepted March 18, 2005.
|
|
|---|
/ß signaling by IFN regulatory factor 2 for homeostatic development of dendritic cells Proc. Natl. Acad. Sci. USA 101,2416-2421
-dendritic cell development Proc. Natl. Acad. Sci. USA 101,8981-8986
+ dendritic cells J. Exp. Med. 196,1415-1425
+ dendritic cells Blood 101,305-310
,25-dihydroxyvitamin D3 on type I IFN-mediated monocyte differentiation into dendritic cells: impairment of functional activities and chemotaxis J. Immunol. 174,270-276
,25-Dihydroxyvitmin D3 inhibits differentiation, maturation, activation, and survival of dendritic cells leading to impaired alloreactive T cell activation J. Immunol. 164,2405-2411
expression in human plasmacytoid and monocyte-derived dendritic cells J. Leukoc. Biol. 74,1125-1138
and IL-12 activate IFN regulatory factor 1 (IRF-1), IRF-4, and IRF-8 gene expression in human NK and T cells Cytokine 24,81-90[CrossRef][Medline]
,25-dihydroxyvitamin D3 and its analogs: physiologic and therapeutic implications for dendritic cell function J. Biol. Chem. 278,49378-49385
B J. Exp. Med. 191,1281-1291This article has been cited by other articles:
![]() |
E. Carreras, S. Turner, M. B. Frank, N. Knowlton, J. Osban, M. Centola, C. G. Park, A. Simmons, J. Alberola-Ila, and S. Kovats Estrogen receptor signaling promotes dendritic cell differentiation by increasing expression of the transcription factor IRF4 Blood, January 14, 2010; 115(2): 238 - 246. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Holm, C. C. Petersen, M. Hvid, L. Petersen, S. R. Paludan, B. Deleuran, and M. Hokland TLR3 Ligand Polyinosinic:Polycytidylic Acid Induces IL-17A and IL-21 Synthesis in Human Th Cells J. Immunol., October 1, 2009; 183(7): 4422 - 4431. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Szeles, G. Keresztes, D. Torocsik, Z. Balajthy, L. Krenacs, S. Poliska, A. Steinmeyer, U. Zuegel, M. Pruenster, A. Rot, et al. 1,25-Dihydroxyvitamin D3 Is an Autonomous Regulator of the Transcriptional Changes Leading to a Tolerogenic Dendritic Cell Phenotype J. Immunol., February 15, 2009; 182(4): 2074 - 2083. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Oz-Arslan, W. Ruscher, D. Myrtek, M. Ziemer, Y. Jin, B. B. Damaj, S. Sorichter, M. Idzko, J. Norgauer, and A. A. Maghazachi IL-6 and IL-8 release is mediated via multiple signaling pathways after stimulating dendritic cells with lysophospholipids J. Leukoc. Biol., August 1, 2006; 80(2): 287 - 297. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lehtonen, V. Veckman, T. Nikula, R. Lahesmaa, L. Kinnunen, S. Matikainen, and I. Julkunen Differential Expression of IFN Regulatory Factor 4 Gene in Human Monocyte-Derived Dendritic Cells and Macrophages J. Immunol., November 15, 2005; 175(10): 6570 - 6579. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||