Journal of Leukocyte Biology BioLegend: Treg, Th17, Stem Cell
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0205090 on April 13, 2005

Published online before print April 13, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0205090v1
77/6/944    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gauzzi, M. C.
Right arrow Articles by Gessani, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gauzzi, M. C.
Right arrow Articles by Gessani, S.
(Journal of Leukocyte Biology. 2005;77:944-947.)
© 2005 by Society for Leukocyte Biology

IRF-4 expression in the human myeloid lineage: up-regulation during dendritic cell differentiation and inhibition by 1{alpha},25-dihydroxyvitamin D3

Maria Cristina Gauzzi*, Cristina Purificato*, Lucia Conti*, Luciano Adorini{dagger}, Filippo Belardelli* and Sandra Gessani*,1

* Department of Cell Biology and Neurosciences, Istituto Superiore di Sanità, Roma, Italy; and
{dagger} BioXell, Milano, Italy

1 Correspondence: Department of Cell Biology and Neurosciences, Istituto Superiore di Sanità, Viale Regina Elena 299, 00161 Rome, Italy. E-mail: gessani{at}iss.it


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 DISCUSSION
 REFERENCES
 
Interferon (IFN) regulatory factor (IRF)-4 is a lymphoid- and myeloid-restricted transcription factor of the IRF family. We analyzed its expression during differentiation of human monocytes along the macrophage or the dendritic cell (DC) pathway and in blood myeloid and plasmacytoid DC (M-DC and P-DC, respectively) subsets. Monocyte differentiation into DC, driven by granulocyte macrophage-colony stimulating factor (GM-CSF)/interleukin-4 or GM-CSF/IFN-ß, resulted in a strong up-regulation of IRF-4 mRNA and protein, which was further increased by lipopolysaccharide. It is interesting that 1{alpha},25-dihydroxyvitamin D3 [1,25(OH)2D3], a potent inhibitor of DC differentiation, completely abolished IRF-4 up-regulation. IRF-4 was also detected in blood P-DC and M-DC. However, up-regulation upon in vitro culture and down-regulation by 1,25(OH)2D3 was observed in M-DC but not in P-DC. These results point to IRF-4 as a potential player in human myeloid DC differentiation and as a novel target for the immunomodulatory activity of 1,25(OH)2D3.

Key Words: transcription factor • immunomodulator • gene regulation


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
DISCUSSION
 REFERENCES
 
Transcription factors of the interferon (IFN) regulatory factor (IRF) family are involved in the host response to pathogens, in immunomodulation, and in hematopoietic differentiation [1 ]. IRF-4 is a critical effector of mature lymphocyte function, and its expression is up-regulated by cell activation [2 , 3 ]. Initially thought to be restricted to the lymphoid lineage, IRF-4 was subsequently also shown to be expressed in the myeloid compartment [4 ].

Dendritic cells (DC) are professional antigen-presenting cells playing a pivotal role in the regulation of the immune response [5 ]. Their flexibility can be explained by the existence of distinct subsets differing in phenotype, function, activation state, and location [6 ]. However, the origins and the genetic events determining the development of specific DC subsets from hematopoietic precursors have not been fully elucidated. Studies in gene-disrupted mice revealed the importance of IRF family members as key checkpoints for the development of distinct murine DC subsets [7 8 9 10 11 12 13 ]. In particular, IRF-4 was shown to be crucial for the development of CD11b+CD8{alpha}– conventional DC [9 ].

In this study, we have characterized the expression of IRF-4 in human monocyte-derived macrophages (MDM) and DC (MDDC), and in blood DC, reporting a clear-cut up-regulation of IRF-4 expression strictly associated with the induction of myeloid DC differentiation. Moreover, we show that IRF-4 up-regulation is blocked by 1{alpha},25-dihydroxyvitamin D3 [1,25(OH)2D3], a potent inhibitor of myeloid DC differentiation [14 ].

We have first analyzed the expression of IRF-4 mRNA and protein in MDM and MDDC, generated by two cytokine cocktails, granulocyte macrophage-colony stimulating factor (GM-CSF)/interleukin (IL-4-DC) and GM-CSF/IFN-ß (IFN-DC). Although IRF-4 mRNA was not detectable in MDM, it was clearly expressed in IL-4-DC and IFN-DC (Fig. 1A ). Similarly, IRF-4 protein was barely or not detectable in ex vivo monocytes and MDM, whereas it was strongly up-regulated in both MDDC types (Fig. 1B) . A time-course analysis of IRF-4 expression (Fig. 1C) showed that maximum protein level was achieved within 16–24 h of cytokine exposure. IRF-4 expression was further up-regulated upon LPS treatment of both DC types (Fig. 1D) . Monocytes cultured in the absence of cytokines or with GM-CSF alone exhibited barely detectable levels of IRF-4 but also responded to LPS stimulation by up-regulating its expression (Fig. 1D) .



View larger version (41K):
[in this window]
[in a new window]
  		Figure 1. Monocyte differentiation into DC correlates with IRF-4 up-regulation. Human peripheral blood monocytes were isolated as described elsewhere [15 ]. MDM were obtained by culture in Iscove’s modified Dulbecco’s medium (Gibco-BRL, Grand Island, NY), 15% fetal bovine serum (FBS), without exogenous cytokines. DC were obtained by culture in RPMI 1640 (Gibco-BRL), 10% FBS, supplemented with 50 ng/ml GM-CSF and 500 U/ml IL-4 (IL-4-DC) or with 50 ng/ml GM-CSF and 1000 IU/ml IFN-ß (IFN-DC). (A) IRF-4 mRNA expression. Total RNA, extracted from MDM and IL-4 DC at day 7 of culture and from IFN-DC at day 5, was subjected to reverse transcriptase-polymerase chain reaction (RT-PCR) with primers specific for IRF-4 (forward, CCAGTCGACGCAAGCTCTTTGACACAC; reverse, CCAGCGGCCGCCTTTTCATTCTTGAATAG) and as an internal control, for the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH; forward, CCATGGAGAAGGCTGGGG; reverse, CAAAG-TTGTCATGGATGACC). (B–D) IRF-4 protein expression. Cells were lysed in radio immunoprecipitation assay buffer [150 mM NaCl, 50 mM Tris-Cl, pH 7.5, 1% Nonidet P-40, 0.5% sodium deoxicholate, 0.1% sodium dodecyl sulfate (SDS)] containing the complete protease inhibitor cocktail (Roche Molecular Biochemicals, Indianapolis, IN). Lysate (15–20 µg) was fractionated on 10% SDS-polyacrylamide gel electrophoresis, electroblotted to nitrocellulose filters, and probed with a goat anti-human IRF-4 antibody (M-17, Santa Cruz Biotechnology, CA). Blots were then stripped and reprobed with a mouse monoclonal anti-actin antibody (Ab-1, Oncogene, Cambridge, MA) to ensure equal protein loading. Within each single panel, the different cell types were derived from the same donor. (B) Cell extracts were prepared from monocytes ex vivo or after in vitro culture for 5 days (IFN-DC) or 7 days (MDM and IL-4-DC). (C) Cell extracts were prepared at the indicated time-points from monocytes ex vivo or cultured in the absence or presence of the indicated cytokines. (D) Cells, cultured in the presence of the indicated cytokines, were left untreated or lipopolysaccharide (LPS)-stimulated (100 ng/ml, 48 h) and analyzed at day 5.

 
Previous studies on mouse DC [16 ] and human MDDC, generated in the presence of IL-4 [17 , 18 ] or type I IFN [15 ], demonstrated that 1,25(OH)2D3 inhibits their differentiation. It is interesting that when differentiation of monocytes into DC, driven by GM-CSF/IFN-ß or GM-CSF/IL-4, was inhibited by adding 1,25(OH)2D3 at the time of cell-seeding ( Fig. 2A and 2B , lanes 2 and 5), no up-modulation of IRF-4 mRNA (Fig. 2A) or protein (Fig. 2B) was observed. In contrast, addition of 1,25(OH)2D3 to differentiated DC (Fig. 2 , A and B, lanes 3 and 6) did not change or slightly down-modulated IRF-4 expression.



View larger version (41K):
[in this window]
[in a new window]
  		Figure 2. Inhibition of DC differentiation by 1,25(OH)2D3 abolishes IRF-4 up-regulation. (A) IRF-4 mRNA expression. RT-PCR was performed as described in the legend to Figure 1 . 1,25(OH)2D3(10 nm), absent in control cultures, was added at cell-seeding (D3) or at day 3 (IFN-DC) or day 5 (IL-4-DC) for 8 h (D3, 8h). (B) IRF-4 protein expression. Western blot analysis was performed as described in the legend to Figure 1 . 1,25(OH)2D3, absent in control cultures, was added at seeding (D3) or at day 3 (IFN-DC) or day 5 (IL-4-DC) and maintained for 48 h (D3, 48h). Within each single panel, the different cell types were derived from the same donor.

 
Finally, we analyzed the expression of IRF-4 in blood plasmacytoid DC (P-DC) and myeloid DC (M-DC), freshly isolated or upon culture in the presence or absence of 1,25(OH)2D3 (Fig. 3 ). IRF-4 protein was expressed at comparable levels in both DC subsets, and it remained substantially unmodified in P-DC upon culture, with or without 1,25(OH)2D3. Conversely, IRF-4 expression was up-regulated significantly in cultured M-DC, and this up-regulation was inhibited by 1,25(OH)2D3.



View larger version (45K):
[in this window]
[in a new window]
  		Figure 3. IRF-4 expression is differentially modulated in blood DC subsets upon culture and 1,25(OH)2D3 exposure. Blood DC, sorted from peripheral blood mononuclear cells with blood DC antigen-1 (BDCA-1; M-DC) or BDCA-2 (P-DC) isolation kits (Miltenyi Biotec, Auburn, CA), were analyzed soon after their isolation (ex-vivo) or after 48 h of culture in RPMI 5% FBS plus 10 ng/ml IL-3 (P-DC) or 50 ng/ml GM-CSF and 500 IU/ml IL-4 (M-DC) in the presence or absence of 10 nM 1,25(OH)2D3. IRF-4 expression was analyzed by Western blot, as described in the legend to Figure 1 .

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 DISCUSSION
REFERENCES
 
Previous studies had shown that IRF-4 mRNA and/or protein can be detected in human monocytes/macrophages, MDDC, and DC subsets [4 , 19 , 20 ]. Despite these scattered observations, the expression of IRF-4 had never been correlated with monocyte differentiation toward DC. It is of interest that both the GM-CSF/IFN-ß and GM-CSF/IL-4 cocktails were effective in up-regulating IRF-4 expression, while GM-CSF alone was ineffective. It is notable that IRF-4 has been reported to be up-regulated by IFN-{alpha} [21 ] and IL-4 [3 ] in lymphocytes. Furthermore, IRF-4 expression in lymphocytes is regulated by pathways known to drive their activation [3 ], and we detected a LPS-induced up-regulation of IRF-4 in all cell types tested, including MDM. All this suggests that the pathways of activation/repression of IRF-4 in the human myeloid lineage resemble those occurring in the lymphoid compartment. In addition, previous studies carried out in murine and human B and T cells have demonstrated that IRF-4 activates or represses the transcription of some lineage-specific genes, which include the immunoglobulin light chain, CD20, and IL-2, depending on the target sequence in the promoter and/or specific interaction with other transcriptional regulators [2 , 3 ]. Studies are in progress to address the mechanistic aspects of IRF-4 activity on DC differentiation.

We also report for the first time that IRF-4 expression can be inhibited by 1,25(OH)2D3. The observation that a well-known inhibitor of DC differentiation and maturation, such as 1,25(OH)2D3, is a potent inhibitor of IRF-4 expression further highlights the important role this factor may play in human myeloid DC differentiation. Of note, some of the inhibitory effects of 1,25(OH)2D3 on DC have been associated with its capacity to impair nuclear factor (NF)-{kappa}B activation [22 ]. It is interesting that IRF-4 mRNA is not induced in lymphocytes isolated from c-rel–/– mice, and two {kappa}B elements within the IRF-4 promoter are necessary and sufficient for Rel-dependent IRF-4 transcription [23 ]. IRF-4 expression is also controlled by regulatory elements interacting with NF of activated T cells (NF-AT) and specificity protein-1 [24 ], and 1,25(OH)2D3 can impair NF-AT complex formation [14 ]. Thus, the inhibitory effect of 1,25(OH)2D3 on IRF-4 expression could be related to its capacity to interfere with activation of these transcription factors. Once induced during DC differentiation, IRF-4 expression was quite stable over the culture period examined, without being reduced significantly by 1,25(OH)2D3, suggesting that different mechanisms could be involved in the control of IRF-4 expression in distinct cell types. It is notable that IRF-4 is similarly expressed in blood P-DC and M-DC, but its expression is inhibited by 1,25(OH)2D3 only in M-DC, showing that MDDC and blood M-DC exhibit a qualitatively similar pattern of IRF-4 expression and regulation.

In the lymphoid lineage, IRF-4 may serve as an integrator of lymphocyte responses rather than as a master regulator of specific differentiation programs [3 ]. Based on our results, it is tempting to speculate that IRF-4 may play a similar role in human M-DC.


   ACKNOWLEDGEMENTS
 
We thank Schering-Plough (Dardilly, France) for the generous gift of human recombinant GM-CSF and IL-4 and Serono (Ardea, Italy) for the generous gift of human recombinant IFN-ß. Dr. M. Uskokovic (BioXell Inc., Nutley, NJ) kindly provided 1,25(OH)2D3.

Received February 14, 2005; revised March 15, 2005; accepted March 18, 2005.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 DISCUSSION
 REFERENCES
 

  1. Taniguchi, T., Ogasawara, K., Takaoka, A., Tanaka, N. (2001) IRF family of transcription factors as regulators of host defense Annu. Rev. Immunol. 19,623-655[CrossRef][Medline]
  2. Marecki, S., Fenton, M. J. (2002) The role of IRF-4 in transcriptional regulation J. Interferon Cytokine Res. 22,121-133[CrossRef][Medline]
  3. Pernis, A. B. (2002) The role of IRF-4 in B and T cell activation and differentiation J. Interferon Cytokine Res. 22,111-120[CrossRef][Medline]
  4. Marecki, S., Atchison, M. L., Fenton, M. J. (1999) Differential expression and distinct functions of IFN regulatory factor 4 and IFN consensus sequence binding protein in macrophages J. Immunol. 163,2713-2722[Abstract/Free Full Text]
  5. Steinman, R. M. (2003) Some interfaces of dendritic cell biology APMIS 111,675-697[CrossRef][Medline]
  6. Grabbe, S., Kämpgen, E., Schuler, G. (2000) Dendritic cells: multi-lineal and multi-functional Immunol. Today 21,431-433[CrossRef][Medline]
  7. Honda, K., Mizutani, T., Taniguchi, T. (2004) Negative regulation of IFN-{alpha}/ß signaling by IFN regulatory factor 2 for homeostatic development of dendritic cells Proc. Natl. Acad. Sci. USA 101,2416-2421[Abstract/Free Full Text]
  8. Ichikawa, E., Hida, S., Omatsu, Y., Shimoyama, S., Takahara, K., Miyagawa, S., Inaba, K., Taki, S. (2004) Defective development of splenic and epidermal CD4+ dendritic cells in mice deficient for IFN regulatory factor-2 Proc. Natl. Acad. Sci. USA 101,3909-3914[Abstract/Free Full Text]
  9. Suzuki, S., Honma, K., Matsuyama, T., Suzuki, K., Toriyama, K., Akitoyo, I., Yamamoto, K., Suematsu, T., Nakamura, M., Yui, K., Kumatori, A. (2004) Critical roles of interferon regulatory factor 4 in CD11bhigh CD8{alpha}-dendritic cell development Proc. Natl. Acad. Sci. USA 101,8981-8986[Abstract/Free Full Text]
  10. Schiavoni, G., Mattei, F., Sestili, P., Borghi, P., Venditti, M., Morse, H. C., Belardelli, F., Gabriele, L. (2002) ICSBP is essential for the development of mouse type I interferon-producing cells and for the generation and activation of CD8{alpha}+ dendritic cells J. Exp. Med. 196,1415-1425[Abstract/Free Full Text]
  11. Tsujimura, H., Tamura, T., Ozato, K. (2003) Cutting edge: IFN consensus sequence binding protein/IFN regulatory factor 8 drives the development of type 1 IFN-producing plasmacytoid dendritic cells J. Immunol. 170,1131-1135[Abstract/Free Full Text]
  12. Aliberti, J., Schulz, O., Pennington, D. J., Tsujimura, H., Reis e Sousa, C., Ozato, K., Sher, A. (2003) Essential role for ICSBP in the in vivo development of murine CD8{alpha}+ dendritic cells Blood 101,305-310[Abstract/Free Full Text]
  13. Schiavoni, G., Mattei, F., Borghi, P., Sestili, P., Venditti, M., Morse, H. C., Belardelli, F., Gabriele, L. (2004) ICSBP is critically involved in the normal development and trafficking of Langerhans cells and dermal dendritic cells Blood 103,2221-2228[Abstract/Free Full Text]
  14. Mathieu, C., Adorini, L. (2002) The coming of age of 1,25-dihydroxyvitamin D3 analogs as immunomodulatory agents Trends Mol. Med. 8,174-179[CrossRef][Medline]
  15. Gauzzi, M. C., Purificato, C., Donato, K., Jin, Y., Wang, L., Daniel, K. C., Maghazachi, A. A., Belardelli, F., Adorini, L., Gessani, S. (2005) Suppressive effect of 1{alpha},25-dihydroxyvitamin D3 on type I IFN-mediated monocyte differentiation into dendritic cells: impairment of functional activities and chemotaxis J. Immunol. 174,270-276[Abstract/Free Full Text]
  16. Griffin, M. D., Lutz, W. H., Phan, V. A., Bachaman, L. A., McKean, D. J., Kumar, R. (2000) Potent inhibition of dendritic cell differentiation and maturation by vitamin D analogs Biochem. Biophys. Res. Commun. 270,701-708[CrossRef][Medline]
  17. Penna, G., Adorini, L. (2000) 1{alpha},25-Dihydroxyvitmin D3 inhibits differentiation, maturation, activation, and survival of dendritic cells leading to impaired alloreactive T cell activation J. Immunol. 164,2405-2411[Abstract/Free Full Text]
  18. Piemonti, L., Monti, P., Sironi, M., Fraticelli, P., Leone, B. E., Dal Cin, E., Allavena, P., Di Carlo, V. (2000) Vitamin D3 affects differentation, maturation, and function of human monocyte-derived dendritic cells J. Immunol. 164,4443-4451[Abstract/Free Full Text]
  19. Izaguirre, A., Barnes, B. J., Amrute, S., Yeow, W. S., Megjugorac, N., Dai, J., Feng, D., Chung, E., Pitha, P. M., Fitzgerald-Bocarsly, P. (2003) Comparative analysis of IRF and IFN-{alpha} expression in human plasmacytoid and monocyte-derived dendritic cells J. Leukoc. Biol. 74,1125-1138[Abstract/Free Full Text]
  20. Ahn, J. H., Lee, Y., Jeon, C., Lee, S. J., Lee, B. H., Choi, K. D., Bae, Y. S. (2002) Identification of the genes differentially expressed in human dendritic cell subsets by cDNA subtraction and microarray analysis Blood 100,1742-1754[Abstract/Free Full Text]
  21. Lehtonen, A., Lund, R., Lahesmaa, R., Julkunen, I., Sareneva, T., Matikainen, S. (2003) IFN-{alpha} and IL-12 activate IFN regulatory factor 1 (IRF-1), IRF-4, and IRF-8 gene expression in human NK and T cells Cytokine 24,81-90[CrossRef][Medline]
  22. Dong, X., Craig, T., Xing, N., Bachman, L. A., Paya, C. V., Weih, F., McKean, D. J., Kumar, R., Griffin, M. D. (2003) Direct transcriptional regulation of RelB by 1{alpha},25-dihydroxyvitamin D3 and its analogs: physiologic and therapeutic implications for dendritic cell function J. Biol. Chem. 278,49378-49385[Abstract/Free Full Text]
  23. Grumont, R. J., Gerondakis, S. (2000) Rel induces interferon regulatory factor 4 (IRF-4) expression in lymphocytes: modulation of interferon-regulated gene expression by rel/nuclear factor {kappa}B J. Exp. Med. 191,1281-1291[Abstract/Free Full Text]
  24. Sharma, S., Grandvaux, N., Mamane, Y., Genin, P., Azimi, N., Waldmann, T., Hiscott, J. (2002) Regulation of IFN regulatory factor 4 expression in human T cell leukemia virus-I-transformed T cells J. Immunol. 169,3120-3130[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
D. Oz-Arslan, W. Ruscher, D. Myrtek, M. Ziemer, Y. Jin, B. B. Damaj, S. Sorichter, M. Idzko, J. Norgauer, and A. A. Maghazachi
IL-6 and IL-8 release is mediated via multiple signaling pathways after stimulating dendritic cells with lysophospholipids
J. Leukoc. Biol., August 1, 2006; 80(2): 287 - 297.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Lehtonen, V. Veckman, T. Nikula, R. Lahesmaa, L. Kinnunen, S. Matikainen, and I. Julkunen
Differential Expression of IFN Regulatory Factor 4 Gene in Human Monocyte-Derived Dendritic Cells and Macrophages
J. Immunol., November 15, 2005; 175(10): 6570 - 6579.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0205090v1
77/6/944    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gauzzi, M. C.
Right arrow Articles by Gessani, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gauzzi, M. C.
Right arrow Articles by Gessani, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS