Journal of Leukocyte Biology eBioscience full spectrum cell analysis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published online as doi:10.1189/jlb.0604330 on March 9, 2005

Published online before print March 9, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0604330v1
77/6/898    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alignani, D.
Right arrow Articles by Pistoresi-Palencia, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alignani, D.
Right arrow Articles by Pistoresi-Palencia, M. C.
(Journal of Leukocyte Biology. 2005;77:898-905.)
© 2005 by Society for Leukocyte Biology

Orally administered OVA/CpG-ODN induces specific mucosal and systemic immune response in young and aged mice

Diego Alignani, Belkys Maletto, Miriam Liscovsky, Andrea Rópolo, Gabriel Morón and María C. Pistoresi-Palencia1

Departamento de Bioquímica Clínica, CIBICI (CONICET), Facultad de Ciencias Químicas, Universidad Nacional de Córdoba, Argentina

1Correspondence: Departamento de Bioquímica Clínica, CIBICI (CONICET), Facultad de Ciencias Químicas, UNC, Haya de la Torre y Medina Allende, Ciudad Universitaria, (5000) Córdoba, Argentina. E-mail: cpistore{at}bioclin.fcq.unc.edu.ar


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have previously demonstrated that subcutaneously administered ovalbumin (OVA) plus synthetic oligodeoxynucleotides containing immunostimulatory CpG motifs (CpG-ODN) as adjuvant stimulate cellular and humoral immunity and promote T helper cell type 1 differentiation in aged mice. The present study assessed the ability of CpG-ODN to induce an OVA-specific immune response after oral immunization in young (3-month-old) and aged (18-month-old) BALB/c mice. Oral OVA/CpG-ODN immunization induces a similar OVA-specific T cell-proliferative response (in mucosal and systemic tissues), immunoglobulin G (IgG) in plasma, and IgA in intestinal washes in both groups of ages. The OVA-specific humoral immune response observed in aged mice was similar to the one observed in young mice, peaking at day 7 after the last oral immunization and was present over 40 days after the last oral immunization. The pattern of cytokines released in culture supernatants in both groups of mice was similar, with specific interferon-{gamma} secretion in the absence of interleukin-5 responses. These results provide evidence that orally administered OVA/CpG-ODN induces a young-like, specific, immune response against OVA in aged mice, showing that CpG-ODN might be used as a mucosal adjuvant during aging.

Key Words: adjuvants • aging


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Several studies indicate that nearly every component of the immune system undergoes dramatic age-associated remodeling, leading to changes that include enhanced as well as diminished functions [1 ]. Consequently, the incidence of severe infections is high, and the protective effect of vaccination is low in the elderly [2 , 3 ]. Changes have been described in humoral, cell-mediated, and innate immunity [4 , 5 ]. Regarding the changes observed during aging in the T cell compartment, an increase in cells with a T helper cell type 2 (Th2) cytokine profile upon stimulation has been described [6 , 7 ]. As the aged immune system has a shift toward a Th2-dominant state, there is a deficiency in the induction of specific Th1 cells, which are required for protection against many pathogens. As a consequence, it is necessary to develop immunization strategies that allow enhancement of immune response and stimulate Th1 immunity during aging.

The vast majority of infections occurs at or emanate from mucosal surfaces. There, different types of immune-competent cells form a unique mucosal immune network, which contributes to the induction of specific and protective immunity against foreign antigens (Ag) [8 ]. In addition, the induction of immune responses through the mucosal surface has the advantage of triggering mucosal and systemic immune responses [9 ]. Thus, the mucosal immune system is an attractive target for eliciting protective immunity [10 , 11 ]. The bacterial toxins, such as cholera toxin (CT) from Vibrio cholerae, the closely related, heat-labile enterotoxin (LT) from Escherichia coli, and a number of genetically detoxified CT- and LT-derived toxins developed in recent years, are among the most commonly used mucosal adjuvants in animals models [12 13 14 ]. However, CT and LT are considered toxic.

Synthetic oligodeoxynucleotides containing immunostimulatory CpG motifs (CpG-ODN) are effective Th1 adjuvants when delivered by mucosal or systemic immunization routes in young mice [15 ]. In previous studies, we and others [16 , 17 ] have demonstrated that subcutaneously (s.c.) administered CpG-ODN stimulate the immune system in aged mice as effectively as in young mice. However, there is little or no information about the ability of CpG-ODN to stimulate the mucosal immune system in aged mice. The aim of this study was therefore to evaluate the effectiveness of ovalbumin (OVA)/CpG-ODN oral administration to induce an OVA-specific immune response in aged mice.

The present work demonstrates that CpG-ODN used as mucosal adjuvant induces a specific immune response in aged mice at mucosal and systemic sites, including specific proliferative responses, interferon-{gamma} (IFN-{gamma}) production without production of interleukin (IL)-5, and mucosal and systemic humoral immune responses. Our results show that CpG-ODN has potential as a mucosal adjuvant to be used in aged individuals.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals
Experiments were performed with 3 (young)- and 18-month-old (aged) female BALB/c mice, which were originally obtained from the Comisión Nacional de Energía Atómica (Argentina). The Institutional Care Use of Animals Committee (Authorization No. 15-01-44195) approved animal handling and experimental procedures.

ODN
The ODN used was TCCATGACGTTCCTGACGTT (1826, CpG-ODN). It was synthesized with a nuclease-resistant phosphorothioate backbone and contained no lipopolysaccharide contaminants (Operon Technologies, Alameda, CA). The CpG motifs are underlined.

Histological assay
For histological examination and immunohistochemical assay, tissue samples were fixed in 96° alcohol, processed according to the Sainte-Marie procedure [18 ], and 5 µm-thick sections were prepared. For histological examination, sections were stained with hematoxylin and eosin (H&E). To perform immunohistochemistry, gut sections were desparafinized in xylene, hydrated through a series of graded alcohol, and brought to phosphate-buffered saline (PBS). The endogenous peroxidase activity was blocked with 0.3% hydrogen peroxide in methanol. Sections were washed once in PBS and blocked with goat normal serum. Biotin-conjugated goat anti-mouse immunoglobulin A (IgA; {alpha}-chain-specific; Sigma Chemical Co., St. Louis, MO) was revealed by streptavidin peroxidase complex (BD PharMingen, San Diego, CA) and later, incubation with diaminobenzidine tetrahydrochloride (Sigma Chemical Co.) in Tris-buffered saline-HCl buffer, pH 7.2. Sections were counterstained lightly with hematoxylin, mounted, and examined by light microscopy.

Immunization of mice and sample collection
Aged and young mice were immunized orally on days 0, 7, and 14 with 1 mg OVA (Grade V, Sigma Chemical Co.) in combination with 50 µg CpG-ODN (OVA/CpG-ODN), delivered in a total volume of 250 µl in saline. As a control, a group of mice received OVA plus saline (OVA/saline). Ag and adjuvant were administered using a tuberculin syringe attached to a 20-gauge olive tip steel-feeding tube, which was passed down the oral cavity and esophagus. Samples of intestinal washes were obtained, removing the small intestine and passing through the entire intestine of 3 ml PBS containing protease inhibitors (phenylmethylsulfonyl fluoride 1 mM, EDTA 10 mM, aprotinin 1.5 µM, all from Sigma Chemical Co.). Samples of plasma were obtained by retro-orbital puncture at various time-points after immunization.

Antibody (Ab) assays
OVA-specific Ab were determined using enzyme-linked immunsorbent assay (ELISA). Briefly, 96-well, flat-bottom plates were coated by incubation overnight at 4°C with OVA (Grade V, Sigma Chemical Co.; 100 µg/well). Plates were then blocked with 0.5% gelatin-PBS for 1 h at 37°C. After washing, plates were incubated with the serially diluted plasma or intestinal wash sample. Total, specific IgG was detected with horseradish peroxidase (HRP)-conjugated anti-mouse IgG ({gamma}-chain-specific; Sigma Chemical Co.). IgG isotypes were detected with HRP-conjugated anti-IgG1 and anti-IgG2a (BD PharMingen). For IgA detection, plates were incubated with biotin-conjugated anti-mouse IgA ({alpha}-chain-specific; Sigma Chemical Co.) and HRP-streptavidin (BD PharMingen).

For potassium thiocyanate (KSCN) titration assay, coating of plates with Ag was performed as above. After washing, plasma samples were incubated for 1 h at 37°C at a dilution that gave an optical density (OD) between 1.0 and 2.0 in the standard ELISA. Plates were washed once in PBS with 0.05% Tween, and then, 200 µl increasing concentrations (0, 0.5, 1.0, 1.5, 2.0, and 2.5 M) of KSCN were added to each row of the plate for 5 min. Plates were then washed three times, and total, specific IgG was detected with HRP-conjugate anti-mouse IgG ({gamma}-chain-specific) as above. The ODs in the KSCN-treated wells were expressed as a percentage of the reference well not treated with KSCN [19 ]. Plates were read on a Bio-Rad Model 450 microplate at 490 nm after incubation with H2O2 and o-phenylenediamine (Sigma Chemical Co.).

Cell culture
Spleen or Peyer’s patches (PP) were surgically removed. Red blood cells from spleen were removed by hypotonic shock. After wash, cell suspensions were cultured with medium alone, with OVA (Grade V, Sigma Chemical Co.; 1 mg/ml), or with concanavalin A (Con A; 5 µg/ml, Sigma Chemical Co.) in a final volume of 200 µl RPMI 1640, supplemented with 10% heat-inactivated fetal bovine serum (FBS; Natocor, Córdoba, Argentina), 2 mM L-glutamine, 50 µM 2-mercaptoethanol (2-ME; Sigma Chemical Co.), and 40 µg/ml gentamicin at 37°C in a moist atmosphere of 5% CO2 in air. For proliferation assays, cells were cultured during 6 days and pulsed with 3H-thymidine (1 µCi/well; Dupont, NEN Research Products, Boston, MA) 18 h before harvest, and incorporation of label was measured using a ß-scintillation counter. For cytokine assays, culture supernatants were harvested after 72 h and were then subjected to cytokine-specific ELISA.

Cytokine-specific ELISA
The levels of IFN-{gamma}, IL-5, IL-10, and granulocyte macrophage-colony stimulating factor (GM-CSF) were measured in culture supernatants by capture ELISA, following instructions from the manufacturer (BD PharMingen). The following monoclonal antibodies (mAb) were used for coating and detection, respectively: for anti-IFN-{gamma}, R4-6A2 and XMG1.2 clone; for anti-IL-5, TRFK5 and TRFK4 clones; for anti-IL-10, JES5-2A5 and JES5-E16E3; and for anti-GM-CSF, MP1-22E9 and MP1-31G6. Concentrations of the cited cytokines are expressed by reference to a standard curve constructed by assaying serial dilutions of the respective murine standard cytokine. The cytokine-specific production in response to stimuli was calculated by subtracting concentrations measured in unstimulated cultures. The detection limits of ELISA assays were: 360 pg/ml for IFN-{gamma}, 125 pg/ml for IL-5, 250 pg/ml for IL/10, and 31 pg/ml for GM-CSF.

Fluorescein-activated cell sorter analysis
Spleen and PP cell suspensions were stained and analyzed by flow cytometry. All Ab were from BD PharMingen. Briefly, cells were pretreated with anti-CD32/CD16 mAb (clone 2.4G2) for 20 min at 4°C and subsequently stained with one of the following mAb for 30 min at 4°C: phycoerythrin (PE)-conjugated Ab, anti-mouse-CD19 (clone 1D3), anti-mouse CD4 (clone H129.19), or anti-mouse CD8{alpha} (clone 53-6.7). For intracellular cytokine staining, spleen and PP cells from aged and young mice were stimulated during 24 h in vitro in the presence of OVA (1 mg/ml) in RPMI 1640 supplemented with 10% heat-inactivated FBS (Natocor), 2 mM L-glutamine, 50 µM 2-ME (Sigma Chemical Co.), and 40 µg/ml gentamicin at 37°C in a moist atmosphere of 5% CO2 in air. Monensin (Sigma Chemical Co.) was added for the last 5 h of culture. Cells were then collected, washed twice with Hanks’ balanced salt solution (HBSS) with 1% FBS and 0.1% sodium azide, and stained with PE-anti-CD4 and peridinin chlorophyll protein-anti-CD8 (BD PharMingen). Then, cells were fixed with 4% paraformaldehyde (in PBS) for 20 min at 4°C and were permeabilized with HBSS containing 2% FBS, 0.1% sodium azide, and 0.1% saponin. For intracellular cytokine staining, cell were incubated 45 min at 4°C with fluorescein isothiocyanate-anti-IFN-{gamma} (BD PharMingen). After being washed twice with permeabilization buffer, cells were analyzed by flow cytometry. Typically, 65,000 total cells were analyzed per sample. Flow cytometry data acquisition was performed on a Cytoron absolute cytometer (Ortho Diagnostic Systems, Raritan, NJ; live/gated on the basis of forward- and side-scatter profiles). Data were analyzed using WinMDI software, Version 2.8 (Joseph Trotter©, The Scripps Research Institute, La Jolla, CA: http://facs.scripps.edu/).

Statistical analysis
Data were analyzed using the GraphPad Prism4® software (GraphPad Software, San Diego, CA). The statistical significance of the differences among groups was determined from the mean and standard deviation by Student’s two-tailed test or by ANOVA followed by Turkey’s test for three or more groups. All data were considered statistically significant if P values were <0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Studies of the immune system in nonimmunized mice
To compare the Ag-specific immune response of aged and young mice, we first characterized the immune system in nonimmunized mice. Intestinal sections were conventionally stained with H&E for histological studies. No structural differences in the intestinal sections from young and aged mice were observed (data not shown). We also performed an immunohistochemical staining to detect IgA+ cells present in the intestinal lamina propria (LP), the main site where plasma cells are encountered in small intestinal mucosa. No significant differences were observed in the number of intestinal IgA+ cells (Fig. 1A ). To determine the cytokine profile released under nonspecific stimulation, PP and spleen cells obtained from 3- and 18-month-old mice were cultured in vitro with Con A, and cell supernatants were collected 72 h after stimulation. The production of IFN-{gamma} (Th1) and IL-5 (Th2) was measured using specific capture ELISA. We found similar production of IFN-{gamma} in PP in young and aged mice, whereas in spleen from aged mice, the production of IFN-{gamma} was increased twofold (P<0.05). Nevertheless, the IL-5 production was increased fivefold in PP and increased sixfold in spleen from aged mice compared with young mice (P<0.05; Fig. 1B ). These results suggest that Th2 cytokines are preferentially induced in aged mice.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. (A) Immunohistochemical study of the IgA+ cell in LP. Thirty fields by section and between two and four sections were counted for each mouse. The results are expressed as the mean ± SD of the number of IgA+ cells per section (original magnification, 400x). (B) IFN-{gamma} and IL-5 in culture supernatants of PP and spleen cells after Con A stimulation. Cells (2.5x106 cells/ml) were cultured for 72 h with Con A (5 µg/ml). The supernatants from triplicate cultures were pooled, and cytokine content was measured by specific capture ELISA. *, P < 0.05. Results are representative of three independent experiments performed (n=3 per group and per experiment).

 
OVA-specific secretory IgA response in gut washes
We then evaluated whether an OVA-specific Ab response can be induced in intestinal washes after OVA/CpG-ODN oral immunization. Thus, young and aged mice were given oral OVA/CpG-ODN or OVA/saline on days 0, 7, and 14, and the OVA-specific IgA response in intestinal washes was examined 7 days after the last oral immunization. The results summarized in Figure 2A show that oral OVA/CpG-ODN immunization induces the anti-OVA IgA response in young and aged mice in contrast to OVA/saline administration. It is most important that the levels of specific IgA in intestinal washes from immunized 18-month-old mice were not significantly different than those produced by 3-month-old mice. In conclusion, aged mice produced similar OVA-specific IgA Ab responses in mucosal secretion than did young mice after OVA/CpG-ODN oral immunization.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. OVA-specific immune response in intestinal mucosa of old mice. Three- and 18-month-old mice were orally immunized with OVA/CpG-ODN or OVA/saline on days 0, 7, and 14. (A) An OVA-specific IgA response in intestinal washes was obtained 7 days after the last oral immunization. The results are expressed as specific titer (Log2) and represent the mean ± SEM of individual values from two separate experiments. Titers were calculated as the reciprocal of the last intestinal wash dilution that yields an absorbance at 490 nm (A490) above that of the double of the mean value of a nonimmunized intestinal wash. *, P < 0.05, regarding the OVA/saline-immunized counterpart (n=3 per group and per experiment). (B) Cells harvested from PP were stained with anti-CD19, anti-CD4, or anti-CD8 mAb and analyzed by flow cytometry. Figures represent the mean of the percentage of positive cells ± SD for two independent experiments (cells were pooled from three mice per group in each experiment). *, P < 0.05, regarding the nonimmunized counterpart. (C) Proliferative responses in PP. Seven days after the third oral immunization, PP cells from OVA/CpG-ODN or OVA/saline 3- and 18-month-old mice (n=3 per group and per experiment) were collected and plated at 2 x 105 cells/200 µl/well and cultured with 1 mg/ml OVA for 6 days. Cells were pulsed with 3H-thymidine (1 µCi/ well) 18 h before harvesting. Incorporation of label was measured using a ß-scintillation counter. Results are expressed as stimulation index [SI=mean counts per minute (cpm) of triplicate OVA containing wells/mean of cpm of triplicate wells without OVA] and are representative of three independent experiments performed.

 
Analysis of PP cell subsets after immunization
To study the changes induced by OVA/CpG-ODN immunization in the PP cellular composition, PP cells from young and aged mice were labeled with specific mAb and analyzed by flow cytometry before and after oral immunization. The number of PP was similar in small intestines obtained from 3- and 18-month-old nonimmunized mice (young: 8±1; aged: 8±1). However, the total cell number was twofold lower in PP from 18-month-old animals, and this number did not change after immunization (Table 1 ). Furthermore, we found no significant differences in CD19+, CD4+, and CD8+ percentages in PP cells from nonimmunized mice of both groups of ages (Fig. 2B) . After oral immunization with OVA/CpG-ODN, a similarly slightly increased percentage of CD19+ cells was observed in young and aged mice compared with nonimmunized mice (Fig. 2B) , and the proportion of CD4+ and CD8+ PP cells did not change significantly.


View this table:
[in this window]
[in a new window]
 
Table 1. Number of Cells Obtained from PP from Nonimmunized and Immunized Young and Aged BALB/c micea

 
OVA-specific proliferative response in PP
To study the ability of oral OVA/CpG-ODN immunization to induce an OVA-specific T cell-proliferative response in the PP, which are the main inductive sites at the small intestinal mucosa, PP cells from orally immunized OVA/saline and OVA/CpG-ODN young and aged mice were stimulated in vitro with OVA. We observed an OVA-specific proliferative response with a SI higher than 2 (considered positive) in both groups of mice immunized with OVA/CpG-ODN. Moreover, we did not observe a significant difference in the response to OVA between PP cells from young and aged mice, showing that CpG-ODN can induce a strong proliferative response in PP from aged mice (Fig. 2C) .

OVA-specific cytokine response in PP
To determine the Th pattern induced by oral immunization in PP, we measured IFN-{gamma}, IL-5, and IL-10 levels in culture supernatants of PP cells stimulated in vitro with OVA. We observed IFN-{gamma} secretion by PP cells from both groups of OVA/CpG-ODN-immunized mice (Fig. 3A ) and absence of IL-5 and IL-10 secretion (not shown), although the IFN-{gamma} levels produced in 18-month-old mice were lower than in 3-month-old mice (P<0.05). In contrast, we did not observe OVA-specific production of these cytokines in the groups receiving OVA/saline. It is generally known that GM-CSF is considered not typical from a Th1 or Th2 response. However, previous reports indicate that GM-CSF can influence in vivo IFN-{gamma} production [20 ]. Therefore, we also measured the levels of GM-CSF in culture supernatants of PP cells from OVA/CpG-ODN-immunized mice. Diminished levels of GM-CSF were observed in cell cultures from 18-month-old mice (P<0.05; Fig. 3A ). IL-12 is a cytokine secreted by Ag-presenting cells (APCs) during the induction of a Th1 response. In addition, previous studies have demonstrated that CpG-ODN stimulates dendritic cells [21 , 22 ] and monocytes/macrophages [23 ] to produce IL-12. To study whether the lower secretion of IFN-{gamma} in aged mice is associated to a lower secretion of IL-12, we measured IL-12 in culture supernatants of PP cells from nonimmunized mice of both groups of ages stimulated in vitro with CpG-ODN. We observed that CpG-ODN effectively induced IL-12 secretion in PP from both ages, without differences between aged versus young mice (Fig. 3B) .



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. Cytokine production by PP cells of old mice. (A) Three- and 18-month-old mice (n=3 per group and per experiment) were orally immunized with OVA/CpG-ODN or OVA/saline on days 0, 7, and 14. On day 7, after the last immunization, the levels of IFN-{gamma} and GM-CSF were determined in culture supernatants of PP cells (1x106 cells/200 µl/well), which were cultured with or without OVA. The levels of specific cytokine production in response to OVA were calculated by subtracting concentrations measured in cultures without OVA. *, P < 0.05. (B) Levels of IL-12 produced in culture supernatants after in vitro stimulation of PP cells from 3 (solid bars)- and 18-month-old (open bars) nonimmunized mice with CpG-ODN. Cells (2.5x106 cells/ml) were cultured for 72 h with CpG-ODN (3 µM). (C) Three- and 18-month-old mice were orally immunized with OVA/CpG-ODN or OVA/saline on days 0, 7, and 14. On day 7, after the last immunization, the frequency of OVA-specific IFN-{gamma}+ within CD4+ and CD8+ T cells was determined in PP cells restimulated in vitro with OVA. IFN-{gamma} production gated on CD4+ or CD8+ was assessed by flow cytometry.

 
To detect the contribution of the T cell subset to IFN-{gamma} secretion, we performed intracellular cytokine-staining assays in PP cells from 3- and 18-month-old mice orally immunized with OVA/CpG-ODN. CD8+/CD4 or CD8/CD4+ T cells were selected and analyzed for their production of IFN-{gamma}. Although the frequency of IFN-{gamma} within the CD4+ T cells were similar between young and aged mice, we observed a lower frequency of IFN-{gamma}+ within the CD8+ T cell population following stimulation with OVA in aged mice (Fig. 3C) .

OVA-specific Ab response in plasma
As mucosal immunization may induce an Ag-specific response in mucosal as well as in systemic sites, we sought the presence of OVA-specific Ab in plasma after the last oral OVA/CpG-ODN or OVA/saline administration. Immunization induced a significant increase in an OVA-specific IgG response in plasma from 3- and 18-month-old mice receiving OVA/CpG-ODN in comparison with mice receiving OVA/saline. The humoral immune response was analyzed 7, 20, and 40 days after the last OVA/CpG-ODN or OVA/saline oral immunization. We observed a peak in the immune response at day 7 after the last oral immunization, and then by day 20 after the last oral immunization, there was a decline in the immune response. However, robust levels of OVA-specific IgG in plasma were detected as long as 40 days after the last oral immunization in both groups of mice immunized with OVA/CpG-ODN. No significant statistical differences were observed between aged and young mice orally immunized with OVA/CpG-ODN (Fig. 4A ). We also measured anti-OVA IgG1 and IgG2a titers, which were similar in both groups of ages (Fig. 4B) . To evaluate whether the anti-OVA IgG Ab induced in immunized 18-month-old mice bound OVA with a different avidity than Ab from young mice, we performed a KSCN titration assay in plasma. The resistance to KSCN washing was similar in 3- and 18-month-old mice for all KSCN-tested concentrations (Fig. 4C) .



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. OVA-specific Ab response. Three- and 18-month-old mice (n=3 per group and per experiment) were orally immunized with OVA/CpG-ODN or OVA/saline on days 0, 7, and 14. (A) The total OVA-specific IgG response in plasma samples was collected 7, 20, and 40 days after the last oral immunization. The results are expressed as specific titer and represent the mean ± SEM for individual values. Titers were calculated as the reciprocal of the last plasma dilution that yields an A490 above that of the double mean value of preimmune plasma. *, P< 0.05, OVA/CpG-ODN-immunized 3- and 18-month-old mice versus the OVA/saline-immunized counterpart. (B) Levels of OVA-specific IgG1 and IgG2a isotype response. The results are expressed as the mean ± SEM of the OVA-specific titer (Log2) of IgG1 (solid bars) or IgG2a (open bars) isotype. Titers were calculated as the reciprocal of the last plasma dilution that yields an A490 above that of the double mean value of preimmune plasma. (C) KSCN titration for OVA-specific IgG in plasma. The OD in KSCN-treated wells was expressed as a percentage of OD in a KSCN-nontreated reference well.

 
OVA-specific cellular immune response in spleen
Finally, we evaluated the induction of a cellular immune response in systemic tissues. Spleen cells isolated from 3- and 18-month-old mice were assayed for CD19, CD4, and CD8 by flow cytometry. No significant differences were observed in the percentage of these cell populations in both groups of immunized mice respective to the nonimmunized counterpart (data not shown). We also studied the OVA-specific T cell-proliferative response induced after oral OVA/CpG-ODN administration. Spleen cells from 3- and 18-month-old mice harvested 7–40 days after the last oral immunization with OVA/CpG-ODN or OVA/saline were cultured in vitro with OVA. Seven days after the last oral immunization, the OVA-specific proliferative response induced at a systemic level was similar in OVA/CpG-ODN orally immunized, aged and young mice (Fig. 5A ), supporting the fact that oral immunization with OVA/CpG-ODN induces a similar systemic cellular immune response in young and aged mice. Forty days after the last oral immunization, the OVA-specific proliferative response was observed in aged and young mice orally immunized with OVA/CpG-ODN; aged mice showed a trend to have a lower but still positive proliferative response than young mice (Fig. 5B) .



View larger version (19K):
[in this window]
[in a new window]
 
Figure 5. OVA-specific T cell responses in spleen. Three- and 18-month-old mice (n=3 per group and per experiment) were orally immunized with OVA/CpG-ODN or OVA/saline on days 0, 7, and 14. (A) Seven or (B) 40 days after the last oral immunization, cells from OVA/CpG-ODN or OVA/saline 3- and 18-month-old mice were collected, plated at 2 x 105 cells/200 µl/well, and cultured with 1 mg/ml OVA for 6 days. Cells were pulsed with 3H-thymidine 18 h before harvested, and incorporation of label was measured using a ß-scintillation counter. Results are expressed as SI = mean cpm of triplicate OVA containing wells/mean of cpm of triplicate wells without OVA and are representative of three independent experiments. (C) Levels of IFN-{gamma} in culture supernatants of spleen cells. Splenocytes (1x106 cells/200 µl/well) from immunized 3- and 18-month-old mice were cultured with or without OVA. The levels of OVA-specific, IFN-{gamma} production in response to OVA were calculated by subtracting concentrations measured in cultures without OVA.*, P < 0.05. (D) The frequency of OVA-specific, IFN-{gamma}+ cells within CD4+ and CD8+ T cells. Seven days after the last oral immunization, spleen cells from 3- and 18-month-old mice were restimulated in vitro with OVA. IFN-{gamma} production gated on CD4+ or CD8+ was assessed by flow cytometry.

 
The pattern of cytokines in spleen was similar to those observed in PP. We found OVA-specific IFN-{gamma} (Fig. 5C) in the absence of IL-5 production (data not shown). However, the levels of IFN-{gamma} produced in aged mice were lower than those produced by young mice. Mice immunized with OVA/saline did not produce detectable levels of OVA-specific cytokines in culture supernatants. Similar to PP, we observed a trend for a diminished percentage of CD8+ IFN-{gamma}+ T cells in aged mice compared with young mice, and the percentage of CD4+ IFN-{gamma}+ T cells was similar in young and aged mice (Fig. 5D) .


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
ODN containing immunostimulatory CpG motifs has been shown to be potent adjuvants in many experimental models [24 ]. Most studies using CpG-ODN as adjuvant have used systemic delivery, but more effective protection against mucosal Ag/pathogens could be achieved with mucosal immunization. Recently, the ability of CpG-ODN as mucosal adjuvant, administered with a variety of Ag has been reported [25 ]. However, whether CpG-ODN is an effective mucosal adjuvant when it is orally administered to aged mice had not been studied. The present work assesses the use of CpG-ODN as a mucosal adjuvant for the induction of an OVA-specific, immune response in aged mice in comparison with young mice.

Our previous reports have indicated that s.c.-administered CpG-ODN is an effective adjuvant in aged mice, inducing an OVA-specific, immune response, including a significant response of IgG2a Ab as well as IFN-{gamma} production, characteristic of a Th1 response [16 ]. The studies presented here prove that orally administered CpG-ODN, similar to s.c. immunization, induces an OVA-specific, proliferative response accompanied by IFN-{gamma} production in the absence of IL-5, indicating that oral OVA/CpG-ODN induces an OVA-specific, Th1 response in aged and young mice. This property of CpG-ODN was observed, despite of the fact that our results indicate that 18-month-old mice present a Th2-biased response. A similar alteration on the cytokine profile was described previously during aging [7 , 26 ]. In addition, after stimulation in vitro with CpG-ODN, cells from nonimmunized mice of both groups of ages release similar levels of IL-12, which is required in the induction of a Th1 response. Conversely, IL-10, considered a regulatory cytokine and related to oral tolerance induction [27 ], is not secreted upon OVA stimulation, indicating that after immunization, an Ag-specific immune response was induced instead of oral tolerance, confirming the use of CpG-ODN as a mucosal adjuvant by the oral route.

However, it is clear that a dysregulation in the mucosal immune system occurs during aging, evidenced by the lower production of IFN-{gamma} in cell culture supernatants from immunized aged mice in response to OVA. This finding was correlated with a small diminution in the frequency of CD8+ IFN-{gamma}+ T cells but not with a diminution in the percentage of CD4+ IFN-{gamma}+ Th cells induced in response to OVA in aged mice. Regarding the function of CD8+ T cells in aging, it has been described as an impaired clonal expansion of CD8+ T cells related to defective APC function [28 ]. Nevertheless, the data about the function of APCs in aged mice are contradictory; consequently, further studies are necessary to evaluate the role of APC cells in the response of CD8 T cells after oral immunization using CpG-ODN in aged mice. Finally, although GM-CSF is not considered a classical Th1 or Th2 cytokine, previous reports indicate that GM-CSF can influence in vivo IFN-{gamma} production [20 ]. Similar to IFN-{gamma}, we observed lower levels of GM-CSF in immune aged mice, indicating that GM-CSF secretion could be related to the lower IFN-{gamma} secretion.

However, in spite of the fact that reduced cytokine levels were released specifically in response to OVA, similar Ab responses were observed in aged and young mice. Moreover, specific plasma Ab peaked at day 7 after the last oral immunization, similarly in young and aged mice, bound to OVA with similar avidity than those from young mice and were present in both groups of mice over a period of 40 days after the last oral immunization.

Regarding the OVA-specific, proliferative response, we observed that spleen cells from both groups of ages were equally responsive to Ag 7 days after the last oral immunization. Forty days after the last immunization, aged mice showed a trend to have a lower but still positive, proliferative response than young mice. Recent studies from Mittler and Lee [29 , 30 ] demonstrate that the aged lymphoid microenviroment permits a robust, primary immune response but fails to support a memory T cell response to secondary immunization, indicating that age-related differences in the lymphoid microenvironment could contribute to the decline in immunologic memory to foreign Ag. In our case, the OVA-specific, proliferative response was still positive 40 days after the last immunization, supporting the fact that CpG-ODN can develop a memory response in aged mice.

IgG isotypes are commonly used as an indirect means to determine Th bias. Taking in account the Ab isotype profile, we observed OVA-specific production of IgG1 and IgG2a in young as well as in aged mice orally immunized with OVA/CpG-ODN. Accordingly, with this finding, McCluskie and Davis [31 ] observed that a neutral or Th2 bias was associated with the phosphorothioate backbone in CpG-ODN, and although a predominance of IgG2a was observed, IgG1 was often present at significant levels after oral immunization with CpG-ODN.

OVA is sometimes used in experimental models to induce oral tolerance [32 , 33 ]. However, a number of reports have shown that it is possible to induce an OVA-specific, immune response after coadministration with cholera toxin as a mucosal adjuvant, promoting a Th2-biased response [12 13 14 ]. Recent studies using CT as a mucosal adjuvant had shown that oral immunization of aged mice with OVA and CT induces, in comparison with young mice, lower Ag-specific Ab responses in mucosal and systemic tissues [34 ], suggesting that orally administered CT fail to stimulate the gut-associated lymphoreticular tissue in aged mice. In contrast to CT, CpG-ODN as adjuvant promote a Th1 response and induce mucosal and systemic immune responses of similar extension in young and aged mice, suggesting that CpG-ODN could be a suitable adjuvant to be used during aging.

It has been shown that CpG-ODN could also enhance immune responses in primates and humans. However, the precise sequence (unmethylated CpG dinucleotide plus flanking regions), which is optimal for stimulating immune cells from one species (such as mice), can sometimes differ from those that are optimal for another species (such as human) [24 , 35 ]. In addition, the cell populations that can be activated by CpG-ODN differ between species. In mice, immune cells from the myeloid lineage respond to CpG stimulation (including monocytes, macrophages, and myeloid dendritic cells), whereas in humans, these cell types generally do not express Toll-like receptor 9 (the specific receptor for CpG) and cannot be activated directly by CpG-ODN [36 37 38 39 40 ]. Therefore, studies that are designed to examine the potential of CpG-ODN are typically initiated in mice and followed by studies in which CpG-ODN are evaluated in primates. Further studies need to be addressed to evaluate the efficacy of CpG-ODN as mucosal adjuvants in aged individuals.

In summary, the present study demonstrates for the first time that CpG-ODN orally administered as adjuvant can induce in aged mice a specific cellular and humoral immune response with similar characteristics to those induced in young mice. Therefore, we suggest that CpG-ODN as adjuvant may enhance the efficacy of oral immunization during aging.


    ACKNOWLEDGEMENTS
 
M. C. P-P. and G. M. are career members from Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). D. A., A. R., and M. L. are recipients of fellowships from CONICET. Grants are from CONICET PIP #02962, Agencia Córdoba Ciencia, Secretaría de Ciencia y Técnica (UNC), and Subsecretaría de Investigación y Tecnología del Ministerio de Salud de la República Argentina.

Received June 9, 2004; revised February 10, 2005; accepted February 11, 2005.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Globerson, A., Effros, R. B. (2000) Ageing of lymphocytes and lymphocytes in the aged Immunol. Today 21,515-521[CrossRef][Medline]
  2. Ginaldi, L., Loreto, M. F., Corsi, M. P., Modesti, M., De Martinis, M. (2001) Immunosenescence and infectious diseases Microbes Infect. 3,851-857[CrossRef][Medline]
  3. Grubeck-Loebenstein, B., Wick, G. (2002) The aging of the immune system Adv. Immunol. 80,243-284[Medline]
  4. Linton, P. J., Dorshkind, K. (2004) Age-related changes in lymphocyte development and function Nat. Immunol. 5,133-139[CrossRef][Medline]
  5. Plackett, T. P., Boehmer, E. D., Faunce, D. E., Kovacs, E. J. (2004) Aging and innate immune cells J. Leukoc. Biol. 76,291-299[Abstract/Free Full Text]
  6. Shearer, G. M. (1997) Th1/Th2 changes in aging Mech. Ageing Dev. 94,1-5[CrossRef]
  7. Sandmand, M., Bruunsgaard, H., Kemp, K., Andersen-Ranberg, K., Pedersen, A. N., Skinhoj, P., Pedersen, B. K. (2002) Is ageing associated with a shift in the balance between type 1 and type 2 cytokines in humans? Clin. Exp. Immunol. 127,107-114[CrossRef][Medline]
  8. Iijima, H., Takahashi, I., Kiyono, H. (2001) Mucosal immune network in the gut for the control of infectious diseases Rev. Med. Virol. 11,117-133[CrossRef][Medline]
  9. Haneberg, B., Kendall, D., Amerongen, H. M., Apter, F. M., Kraehenbuhl, J. P., Neutra, M. R. (1994) Induction of specific immunoglobulin A in the small intestine, colon-rectum, and vagina measured by a new method for collection of secretions from local mucosal surfaces Infect. Immun. 62,15-23[Abstract/Free Full Text]
  10. Ogra, P. L., Faden, H., Welliver, R. C. (2001) Vaccination strategies for mucosal immune responses Clin. Microbiol. Rev. 14,430-445[Abstract/Free Full Text]
  11. Eriksson, K., Holmgren, J. (2002) Recent advances in mucosal vaccines and adjuvants Curr. Opin. Immunol. 14,666-672[CrossRef][Medline]
  12. Xu-Amano, J., Kiyono, H., Jackson, R. J., Staats, H. F., Fujihashi, K., Burrows, P. D., Elson, C. O., Pillai, S., McGhee, J. R. (1993) Helper T cell subsets for immunoglobulin A responses: oral immunization with tetanus toxoid and cholera toxin as adjuvant selectively induces Th2 cells in mucosa-associated tissues J. Exp. Med. 178,1309-1320[Abstract/Free Full Text]
  13. Yamamoto, S., Kiyono, H., Yamamoto, M., Imaoka, K., Fujihashi, K., Van Ginkel, F. W., Noda, M., Takeda, Y., McGhee, J. R. (1997) A nontoxic mutant of cholera toxin elicits Th2-type responses for enhanced mucosal immunity Proc. Natl. Acad. Sci. USA 94,5267-5272[Abstract/Free Full Text]
  14. Yamamoto, S., Takeda, Y., Yamamoto, M., Kurazono, H., Imaoka, K., Fujihashi, K., Noda, M., Kiyono, H., McGhee, J. R. (1997) Mutants in the ADP-ribosyltransferase cleft of cholera toxin lack diarrheagenicity but retain adjuvanticity J. Exp. Med. 185,1203-1210[Abstract/Free Full Text]
  15. Krieg, A. M., Davis, H. L. (2001) Enhancing vaccines with immune stimulatory CpG DNA Curr. Opin. Mol. Ther. 3,15-24[Medline]
  16. Maletto, B., Ropolo, A., Moron, V., Pistoresi-Palencia, M. C. (2002) CpG-DNA stimulates cellular and humoral immunity and promotes Th1 differentiation in aged BALB/c mice J. Leukoc. Biol. 72,447-454[Abstract/Free Full Text]
  17. Manning, B. M., Enioutina, E. Y., Visic, D. M., Knudson, A. D., Daynes, R. A. (2001) CpG DNA functions as an effective adjuvant for the induction of immune responses in aged mice Exp. Gerontol. 37,107-126[CrossRef][Medline]
  18. Sainte-Marie, G. (1962) A parafin embedding technique for studies employing immunofluorescence J. Histochem. Cytochem. 10,250-256[Abstract]
  19. Deisenhammer, F., Keir, G., Pfausler, B., Thompson, E. J. (1996) Affinity of anti-GM1 antibodies in Guillain-Barre syndrome patients J. Neuroimmunol. 66,85-93[CrossRef][Medline]
  20. Khatami, S., Brummer, E., Stevens, D. A. (2001) Effects of granulocyte-macrophage colony stimulating factor (GM-CSF) in vivo on cytokine production and proliferation by spleen cells Clin. Exp. Immunol. 125,198-201[CrossRef][Medline]
  21. Sparwasser, T., Koch, E. S., Vabulas, R. M., Heeg, K., Lipford, G. B., Ellwart, J. W., Wagner, H. (1998) Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells Eur. J. Immunol. 28,2045-2054[CrossRef][Medline]
  22. Jakob, T., Walker, P. S., Krieg, A. M., Udey, M. C., Vogel, J. C. (1998) Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA J. Immunol. 161,3042-3049[Abstract/Free Full Text]
  23. Chace, J. H., Hooker, N. A., Mildenstein, K. L., Krieg, A. M., Cowdery, J. S. (1997) Bacterial DNA-induced NK cell IFN-{gamma} production is dependent on macrophage secretion of IL-12 Clin. Immunol. Immunopathol. 84,185-193[CrossRef][Medline]
  24. Klinman, D. M. (2004) Immunotherapeutic uses of CpG oligodeoxynucleotides Nat. Rev. Immunol. 4,249-258[CrossRef][Medline]
  25. McCluskie, M. J., Weeratna, R. D., Payette, P. J., Davis, H. L. (2001) The use of CpG DNA as a mucosal vaccine adjuvant Curr. Opin. Investig. Drugs 2,35-39[Medline]
  26. Hobbs, M. V., Weigle, W. O., Noonan, D. J., Torbett, B. E., McEvilly, R. J., Koch, R. J., Cardenas, G. J., Ernst, D. N. (1993) Patterns of cytokine gene expression by CD4+ T cells from young and old mice J. Immunol. 150,3602-3614[Abstract]
  27. Mowat, A. M. (2003) Anatomical basis of tolerance and immunity to intestinal antigens Nat. Rev. Immunol. 3,331-341[CrossRef][Medline]
  28. Plowden, J., Renshaw-Hoelscher, M., Gangappa, S., Engleman, C., Katz, J. M., Sambhara, S. (2004) Impaired antigen-induced CD8+ T cell clonal expansion in aging is due to defects in antigen presenting cell function Cell. Immunol. 229,86-92[CrossRef][Medline]
  29. Mittler, J. N., Lee, W. T. (2004) Antigen-specific CD4 T cell clonal expansion and differentiation in the aged lymphoid microenvironment. II. The memory T cell response is diminished Mech. Ageing Dev. 125,59-68[CrossRef][Medline]
  30. Mittler, J. N., Lee, W. T. (2004) Antigen-specific CD4 T cell clonal expansion and differentiation in the aged lymphoid microenvironment. I. The primary T cell response is unaffected Mech. Ageing Dev. 125,47-57[CrossRef][Medline]
  31. McCluskie, M. J., Davis, H. L. (2000) Oral, intrarectal and intranasal immunizations using CpG and non-CpG oligodeoxynucleotides as adjuvants Vaccine 19,413-422[CrossRef][Medline]
  32. Fujihashi, K., Dohi, T., Rennert, P. D., Yamamoto, M., Koga, T., Kiyono, H., McGhee, J. R. (2001) Peyer’s patches are required for oral tolerance to proteins Proc. Natl. Acad. Sci. USA 98,3310-3315[Abstract/Free Full Text]
  33. Kato, H., Fujihashi, K., Kato, R., Yuki, Y., McGhee, J. R. (2001) Oral tolerance revisited: prior oral tolerization abrogates cholera toxin-induced mucosal IgA responses J. Immunol. 166,3114-3121[Abstract/Free Full Text]
  34. Koga, T., McGhee, J. R., Kato, H., Kato, R., Kiyono, H., Fujihashi, K. (2000) Evidence for early aging in the mucosal immune system J. Immunol. 165,5352-5359[Abstract/Free Full Text]
  35. Rankin, R., Pontarollo, R., Ioannou, X., Krieg, A. M., Hecker, R., Babiuk, L. A., van Drunen Littel-van den Hurk, S. (2001) CpG motif identification for veterinary and laboratory species demonstrates that sequence recognition is highly conserved Antisense Nucleic Acid Drug Dev. 11,333-340[CrossRef][Medline]
  36. Bauer, S., Kirschning, C. J., Hacker, H., Redecke, V., Hausmann, S., Akira, S., Wagner, H., Lipford, G. B. (2001) Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition Proc. Natl. Acad. Sci. USA 98,9237-9242[Abstract/Free Full Text]
  37. Hornung, V., Rothenfusser, S., Britsch, S., Krug, A., Jahrsdorfer, B., Giese, T., Endres, S., Hartmann, G. (2002) Quantitative expression of Toll-like receptor 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides J. Immunol. 168,4531-4537[Abstract/Free Full Text]
  38. Kadowaki, N., Ho, S., Antonenko, S., Malefyt, R. W., Kastelein, R. A., Bazan, F., Liu, Y. J. (2001) Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens J. Exp. Med. 194,863-869[Abstract/Free Full Text]
  39. Krug, A., Towarowski, A., Britsch, S., Rothenfusser, S., Hornung, V., Bals, R., Giese, T., Engelmann, H., Endres, S., Krieg, A. M., Hartmann, G. (2001) Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12 Eur. J. Immunol. 31,3026-3037[CrossRef][Medline]
  40. Bauer, M., Redecke, V., Ellwart, J. W., Scherer, B., Kremer, J. P., Wagner, H., Lipford, G. B. (2001) Bacterial CpG-DNA triggers activation and maturation of human CD11c–, CD123+ dendritic cells J. Immunol. 166,5000-5007[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
A. Rynda, M. Maddaloni, D. Mierzejewska, J. Ochoa-Reparaz, T. Maslanka, K. Crist, C. Riccardi, B. Barszczewska, K. Fujihashi, J. R. McGhee, et al.
Low-Dose Tolerance Is Mediated by the Microfold Cell Ligand, Reovirus Protein {sigma}1
J. Immunol., April 15, 2008; 180(8): 5187 - 5200.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Sharma, A. L. Dominguez, and J. Lustgarten
High Accumulation of T Regulatory Cells Prevents the Activation of Immune Responses in Aged Animals
J. Immunol., December 15, 2006; 177(12): 8348 - 8355.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. A. Maletto, A. S. Ropolo, D. O. Alignani, M. V. Liscovsky, R. P. Ranocchia, V. G. Moron, and M. C. Pistoresi-Palencia
Presence of neutrophil-bearing antigen in lymphoid organs of immune mice
Blood, November 1, 2006; 108(9): 3094 - 3102.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. P. A. Ivory, K. Keller, and K. Chadee
CpG-Oligodeoxynucleotide Is a Potent Adjuvant with an Entamoeba histolytica Gal-Inhibitable Lectin Vaccine against Amoebic Liver Abscess in Gerbils
Infect. Immun., January 1, 2006; 74(1): 528 - 536.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0604330v1
77/6/898    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alignani, D.
Right arrow Articles by Pistoresi-Palencia, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alignani, D.
Right arrow Articles by Pistoresi-Palencia, M. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS