| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Published online before print February 4, 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1
* Department of Cell and Molecular Biology, University of Rhode Island, Kingston; and
Shock-Trauma Research Laboratories in the Division of Surgical Research, Department of Surgery, Rhode Island Hospital and Brown University School of Medicine, Providence
1Correspondence: Division of Surgical Research, Aldrich 227, Rhode Island Hospital, 593 Eddy Street, Providence, RI 02903. E-mail: AAYALA{at}LIFESPAN.org
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
compared with vehicle. These data support not only our hypothesis that local pulmonary chemokine production of MIP-2, to a greater extent than KC, contributes to the pathogenesis of PMN-associated ALI following Hem but also the use of siRNA as a potential therapeutic.
Key Words: neutrophils • keratinocyte-derived chemokine • macrophage inflammatory protein-2 • mouse
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The clinical pathology of ALI includes increased microvascular permeability, inflammation, pulmonary edema, and the accumulation of activated neutrophils in lung tissue and bronchoalveolar lavage fluid [4, 14–16 ]. The finding of significant numbers of activated/sequestered neutrophils in the lungs of patients with ALI has focused our research on the contribution of neutrophils and their mediators in the pathogenesis of this syndrome [5 , 7 , 8 , 10 , 17 18 19 20 21 ]. The targeting of neutrophils to the lungs is thought to be, in part, mediated by local chemokine production [4, 12 , 17 , 18 , 22 ]. We have previously reported a significant increase in lung tissue levels of keratinocyte derived-chemokine (KC) and macrophage inflammatory protein-2 (MIP-2), murine neutrophil chemoattractants, in our mouse model of hemorrhage priming for ALI [19 , 23 ]. Subsequent antibody neutralization of MIP-2 or KC immediately following hemorrhage significantly reduced lung tissue levels of these chemokines and neutrophil influx to the lung following a secondary/triggering insult, sepsis. In addition, preliminary studies by our laboratory examining neutrophil migration in macrophage-deficient mice (B6C3Fe-a/a-CsF1op) found local production of chemokines to be critical to the targeting of neutrophils to the lungs of mice subjected to hemorrhage followed by septic challenge [24 ]. Based on these data, we sought to investigate the effects of silencing the local synthesis KC and MIP-2 by resident pulmonary cells. To assess the contribution of resident pulmonary cells to the production of these chemokines and the consequent influx of neutrophils to the lung, organ-specific suppression was produced by in vivo administration of small interfering RNA (siRNA) against KC or MIP-2. Gene silencing via RNA interference is an evolutionary, conserved mechanism involving cleavage of the post-transcriptional product, mRNA, by siRNA/RNA-induced silencing complexes complementary to the target mRNA. RNA interference has been identified in numerous species including plants, worms, and mammals [25 ]. To document the capacity of siRNA to inhibit local gene expression, in initial experiments, we exposed green fluorescent protein (GFP)-overexpressing, transgenic mice to intratracheal (i.t.) instillation of GFP siRNA. We observed marked suppression of pulmonary GFP expression but no change in liver GFP levels in our treatment group. Additionally, no increase in systemic or lung tissue interleukin (IL)-6 was detected in these mice or GFP background control mice that received GFP siRNA as compared with mice that received vehicle alone. Having found that chemokines derived from local tissue affect the recruitment of neutrophils to the lung, we hypothesized that a protocol that silenced local signaling for neutrophil recruitment would reduce hemorrhage-induced, neutrophil-mediated septic ALI. In addition, we hypothesized that local pulmonary gene-specific (KC or MIP-2) silencing would further elucidate the divergent roles played by these two chemokines in the pathogenesis of ALI.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Reagents
KC and MIP-2 monoclonal capture antibody and secondary detection antibody for enzyme-linked immunosorbent assay (ELISA) were purchased from R&D Systems (Minneapolis, MN). Mouse IL-6 and IL-10 ELISA kits were purchased from BD PharMingen (San Diego, CA). Trimeric mixtures of custom-designed siRNA duplexes for KC and MIP-2 were synthesized by Dharmacon Research (Lafayette, CO). All other chemicals were analytical reagent grade and purchased from Sigma Chemical Co. (St. Louis, MO).
Mouse hemorrhage/sepsis model for ALI
Hemorrhage
The hemorrhage model we have used for these experiments has been described previously [5
]. In brief, mice were anesthetized with methoxyflurane and restrained in supine position, and catheters were inserted into both femoral arteries. Anesthesia was discontinued, and blood pressure was continuously monitored through one catheter attached to a blood pressure analyzer (BPA, MicroMed, Louisville, KY). When fully awake, as determined by a mean blood pressure of 
95 mmHg, the mice were bled over a 5- to 10-min period to a mean blood pressure of 30 mmHg (±5 mmHg) and kept stable for 90 min. Immediately following hemorrhage, mice were resuscitated intravenously with Ringers lactate at 4x drawn blood volume. Following resuscitation, arteries were ligated, catheters removed, and catheter sites sutured closed. Sham hemorrhage was performed as a control, and these mice were anesthetized, restrained, and their femoral arteries ligated, but no blood was drawn.
Polymicrobial sepsis
Twenty-four hours post-hemorrhage (or sham hemorrhage), sepsis was induced as a secondary challenge via cecal ligation and puncture (CLP) as described previously [5
]. To summarize, mice were anesthetized with methoxyflurane and restrained in supine position. A 1-cm midline incision was made; the cecum was ligated with 5-0 silk thread and punctured twice with a 21-gauge needle. The cecum was then replaced, and the incision was sutured and lidocane applied, abdominal layer, then skin. Mice were resuscitated with 1 ml lactated Ringers solution subcutaneously and returned to their cages.
siRNA delivery was performed 2 h post-hemorrhage and was based on a protocol described by Kim et al. [27 ]. Mice were lightly anesthetized with methoxyflurane and suspended on a board in supine position at a 45° angle. A string anchored above their head in the inclined board was looped around their front teeth, and their body weight was supported by taping the base of their tail to the inclined board. Upon opening the jaw of the mouse, the tongue was gently drawn outward, opening the trachea. siRNA, specific for KC (duplex #1 AAAACGCUGGCUUCUGACAAC, duplex #2 AACAACCACUGUGCUAGUAGA), MIP-2 (duplex #1 AACGAUUCGCUAAUUCACUGU, duplex #2 AAGCAGUCGGAUGGCUUUCAU), or GFP (GGCTACGTCCAGGAGCGCACC; 75 ug/mouse), was pipetted in vehicle, 100 ul saline, directly into the throat, momentarily blocking the mouse’s airway. Inspiration by the mouse carried the siRNA and vehicle into the lung. The accuracy of siRNA delivery into the lung was confirmed by the infusion of Evan’s Blue dye in the lungs of a control mouse.
Sample collection
Twenty-four hours post-CLP, mice were killed with an overdose of methoxyflurane.
Blood was collected via cardiac puncture into heparinized syringes. Blood samples were centrifuged, and plasma was collected and stored at –70°C for later cytokine analysis.
Lung tissue was harvested for assessment of cytokine levels, myeloperoxidase (MPO), reverse transcriptase-polymerase chain reaction (RT-PCR), neutrophil influx (esterase+ cells), and tissue architecture. Samples for ELISAs, MPO, and RT-PCR were collected in potassium buffer or TriPure reagent for processing. For histological assessment, the trachea was cannulated, and lungs were inflated to 25 cm pressure with formalin. Lungs were excised and snap-frozen in liquid nitrogen in embedding molds with optical cutting temperature compound media (TissueTek, Elkhart, IL) for later processing of frozen sections.
Methods of assessment
Cytokine and chemokine ELISAs for IL-6, IL-10, KC, MIP-2, and tumor necrosis factor (TNF-) were performed as per the manufacturer’s protocol on lung tissue homogenates collected from experimental mice.
Lung MPO activity, as an assessment of neutrophil influx, was measured according to established protocols [19 ]. Briefly, lung tissue was homogenized in 0.5 ml 50 mM potassium phosphate buffer, pH 7.4, and centrifuged at 40,000 g at 4°C for 30 min. The supernatant was reserved for cytokine analysis. The remaining pellet was resuspended in 0.5 ml 50 mM potassium buffer, pH 6.0, with 0.5% hexadecyltrimethylammonium bromide, sonicated on ice, and then centrifuged at 12,000 g at 4°C for 10 min. Supernatants were then assayed at a 1:20 dilution in reaction buffer (530 nmol/L o-dianisidine, 150 nmol/L H2O2 in 50 mM potassium phosphate buffer) and read at 490 nm.
RNA extraction and cDNA synthesis were performed on lung tissue sections harvest from sample groups. For detection of KC and MIP-2, total RNA was isolated using TriPure reagent and isolation protocol from Boehringer Mannheim (Gaithersburg, MD). Briefly, lung tissue was homogenized in 1.0 ml TriPure reagent, 0.2 ml chloroform was added to each sample, and samples were then shaken, incubated for 2–5 min at room temperature, and centrifuged for 15 min at 12,000 g and 4°C. Following centrifugation, the colorless upper aqueous phase was transferred to a new 2.0-ml centrifuge tube, and RNA was precipitated by adding 0.5 ml isopropanol, incubating sample 5–10 min at room temperature, and centrifuging 10 min at 12,000 g and 4°C. RNA pellet was washed twice in 75% ethanol, air-dried, and resuspended in RNase-free water (0.05 ml) for calculation of RNA concentration. IScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA) was for reverse transcription of RNA to generate cDNA. PCR was performed (30 cycles, 2 ul cDNA per sample) using custom primers (Integrated DNA Technologies, Coralville, IA) for KC (5'-AGAAGACAGACTGCTCTGATGGCA-3' forward and 5'-AATGTCCAAGGGAAGCGTCAACAC-3' reverse) and MIP-2 (5'-TGCCTGAAGACCCTGCCAAGG-3' forward and 5'-GTTAGCCTTGCCTTTGTTCAG-3' reverse).
Immunohistochemical staining for assessment of neutrophil influx and tissue architecture
Staining for leukocyte-specific esterase, Naphthol AS-D chloroacetate esterase (Sigma Diagnostics, St. Louis, MO) was performed on frozen tissue sections and fixed in citrate-acetone-formaldehyde. Slides were incubated in a solution of sodium nitrate, Fast Red Violet BL base solution, TRIZMAL 6.3 buffer, and Naphthol AS-D chloroacetate solution in deionized water for 15 min at 37°C. Following rinsing, slides were counterstained with Gills hemotoxylin solution and cover-slipped. Stained lung sections were examined microscopically for morphology and positively stained cells. To establish the total number (%) of cells (per field) that were neutrophils (esterase +) present in the sample, tissue sections were randomly screened (seven to eight fields/slide) at 400x (25 µm2/field).
Statistical analysis
Data were expressed as mean ± SEM of five mice examined in each group. Statistical error was determined using One-Way ANOVA, and the post-hoc test was Tukey’s. Calculations were performed using SigmaStat for Windows, Version 2.03. P values <0.05 were considered significant.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
|
|
Tissue levels show suppressed chemokine levels for respective treatment groups
Lung tissue levels of KC and MIP-2 are significantly elevated following hemorrhage and sepsis. Local suppression, via siRNA treatment, reduced levels of KC and MIP-2 in the lungs of mice receiving these treatments (Fig. 4A
and 4B
).
|
|
levels not reduced by local silencing of KC or MIP-2 were assessed. In the lung tissue, local suppression of MIP-2 produced an increase in TNF- as compared with the saline Hem/CLP group; the KC suppression group levels did not differ from saline Hem/CLP (Fig. 6A
). In contrast, neither local silencing of KC nor MIP-2 produced a change significant to the saline Hem/CLP group levels (Fig. 6B)
.
|
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In this study, we used a mouse model of hemorrhagic shock followed by infectious challenge to assess the effects of using a post-shock/sepsis local pulmonary siRNA silencing of KC and MIP-2 on the development of ALI. We hypothesized that the neutrophil-mediated lung injury observed following hemorrhage and subsequent septic challenge would be attenuated as a result of a disruption of neutrophil targeting to the lung via chemokine gradient originating from local pulmonary cells. In addition, we hypothesized that local pulmonary gene-specific silencing of KC or MIP-2, chemokines that share a common CXC chemokine receptor 2 (CXCR2) affinity [27 ] and have been suggested to be redundant [28 , 29 ], would clarify their contribution to the pathogenesis of ALI.
Local silencing was assessed using siRNA against GFP in GFP-transgenic, overexpressing mice. The treatment dose of 75 ug/mouse/i.t. was derived from the lowest concentration observed to produce detectable suppression in fluorescence in lung tissue from GFP mice. In addition, the tissue specificity for i.t. siRNA delivery was confirmed in liver tissue sections from GFP siRNA-treated mice. No suppression of GFP fluorescence was observed in the liver sections from mice that received local administration of GFP siRNA. Mice given GFP siRNA were assessed for extraneous inflammatory response to the siRNA by comparison of IL-6 levels among treated mice, mice given saline vehicle i.t., and GFP-transgenic background mice given siRNA against GFP. Lung tissue IL-6 levels were not significantly different among the treatment groups (data not shown). To assess the capacity of in vivo administration of siRNA to induce an interferon (IFN) response, our laboratory [30
] and others [31
] have measured IFN- in the plasma of mice given up to 2.5 mg/kg (10%) body weight, siRNA via hydrodynamic tail vein injection. Levels of IFN- were found to be similar to untreated/naïve animals.
Lung tissue-specific gene silencing via siRNA against KC and MIP-2 produced similar and divergent effects in the inflammatory response of the hemorrhaged/septic mice. Lung tissue IL-6, although reduced following local siRNA silencing of both chemokines, was reduced two times as much in the KC-silenced group. This finding is different from antibody neutralization studies previously reported by our laboratory, where neutralization of MIP-2 produced a similar or marginally greater suppression of lung tissue IL-6 compared with KC [19 ]. One explanation could be the local delivery/targeting and specificity of treatment using siRNA. Local gene silencing via siRNA targets the synthesis of the specific chemokine by resident pulmonary cells, where systemic antibody neutralization blocks existing chemokines in the blood. In our shock/sepsis model, the induction of sepsis creates an inflammatory focus within the peritoneum from which inflammatory mediators are released into the circulation [5 , 18 ]. These mediators further stimulate an immune system previously sensitized by hemorrhagic shock. The specific cell population(s) in the lung targeted by the i.t. delivery of siRNA are not known at this time. Pulmonary macrophages are believed to be a primary source of local MIP-2 in the lung [24 , 32 ], and fibroblasts [33 ] and eosinophils [34 ] have been associated with KC synthesis. A reduction in lung tissue proinflammatory cytokine, IL-6, along with reduced neutrophil influx could potentially translate into a general reduction as a result of a reduced lung inflammatory response of systemic IL-6. Although systemic IL-6 levels showed a significant decrease in the MIP-2-silenced group, no change was observed in the KC group compared with saline Hem/CLP.
As anticipated, lung tissue levels of KC and MIP-2 were reduced in mice that were given siRNA to silence local expression of those chemokines by resident pulmonary cells. Similar results were not observed in the plasma. In KC and MIP-2 treatment groups, a reduction of plasma KC was observed, and neither KC nor MIP-2 local silencing produced a reduction in plasma MIP-2. These findings suggest that circulating/plasma levels of MIP-2 are more likely to be associated with the inflammatory environment of the peritoneal cavity as a result of CLP than a release into circulation from the lung. A reduction in systemic levels of KC via siRNA silencing points to a selective transport of chemokines into the circulation in response to inflammatory stimuli, as reported by Quinton et al. [35 ], who found through 125-I-labeling of i.t. administered recombinant cytokine-induced neutrophil chemoattractant (rCINC) that a rat neutrophil chemokine corresponding to murine KC, which labeled CINC in circulating blood, rose to 200 times above base levels within 1 h following instillation. However, a similar elevation of circulating/plasma MIP-2 levels was not found when 125-I labeled rMIP-2 was administered i.t. [35 ]. Additionally and relative to circulating chemokine concentrations, although KC and MIP-2 share a common receptor on mouse neutrophils (CXCR2), and receptor desensitization has been observed when ligand concentrations are at saturating levels, the fact that KC has a significantly lower receptor affinity than MIP-2 suggests that elevated MIP-2 levels, as opposed to KC plasma levels, would serve to desensitize the CXCR2 and subsequently suppress neutrophil migration into the lung. Consistent with Quinton and co-workers’ data [35 ], decreased levels of systemic KC following local silencing were observed in our study, and systemic MIP-2 was not effected.
TNF- is an early mediator of the inflammatory response, upstream of the chemokines, KC, and MIP-2. Levels of TNF- in lung tissue and plasma were measured in siRNA-treatment groups as a control for comparison of inflammatory signaling. As would be anticipated, no significant changes in TNF- were observed.
A clear divergence in the effects of silencing local chemokine expression was observed in the significant reduction of MPO activity in lung tissue from mice that received siRNA to silence local expression of MIP-2. These findings are consistent with our previous studies, where antibody neutralization of MIP-2 reduced MPO to Sham/Hem levels [19 ]. Supporting these MPO data is lung tissue histology, showing a decrease in cellular infiltrate, interstitial edema, and disruption of lung tissue architecture.
The scientific/research community is just beginning to understand the complexity of RNA interference and recognize its potential as an in vivo therapeutic tool. Song et al. [36 ] have shown that Fas siRNA silencing can be protective in preventing murine hepatocytes from apoptosis, and Tompkins et al. [37 ] have protected mice from lethal challenge with influenza virus. Still, questions involving siRNA design, efficacy of delivery, long-term toxicity, mutagenesis in cells that take-up the siRNA, and the specific cells targeted by siRNA remain for future investigation.
This current study as well as studies from other laboratories suggest that local production of MIP-2 by resident pulmonary cells constitutes an integral regulator of neutrophil influx [8 , 33 , 38 , 39 ]. Having said this, we have also presented data here that suggest that the local/pulmonary production of MIP-2 as well KC contribute to the systemic, inflammatory cytokine environment in our model of hemorrhage-induced neutrophil priming for ALI.
Our data suggest that i.t. delivery of siRNA produces 40% suppression in local chemokine expression in lung tissue. Future experiments will need to be performed to first identify the target cells for siRNA gene silencing and second, to further elucidate the nature of all the changes in proinflammation, neutrophil targeting, and lung injury, which we have observed in our hemorrhage/sepsis model of murine ALI at higher concentrations of siRNA. However, based on our current study, it is our belief that like KC and MIP-2, other genes involved in such pulmonary pathology may be amenable to this type of siRNA approach, thus offering a potential therapeutic strategy for the treatment of ALI.
|
ACKNOWLEDGEMENTS |
|---|
Received October 26, 2004; revised January 3, 2005; accepted January 4, 2005.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-induced extravasation of neutrophils in vivo Eur. J. Pharmacol. 427,277-283[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  G. Matute-Bello, C. W. Frevert, and T. R. Martin Animal models of acute lung injury Am J Physiol Lung Cell Mol Physiol, September 1, 2008; 295(3): L379 - L399. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Nomellini, D. E. Faunce, C. R. Gomez, and E. J. Kovacs An age-associated increase in pulmonary inflammation after burn injury is abrogated by CXCR2 inhibition J. Leukoc. Biol., June 1, 2008; 83(6): 1493 - 1501. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, R. A. Barke, R. Charboneau, R. Schwendener, and S. Roy Morphine Induces Defects in Early Response of Alveolar Macrophages to Streptococcus pneumoniae by Modulating TLR9-NF-{kappa}B Signaling J. Immunol., March 1, 2008; 180(5): 3594 - 3600. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Perl, C.-S. Chung, U. Perl, J. Lomas-Neira, M. de Paepe, W. G. Cioffi, and A. Ayala Fas-induced Pulmonary Apoptosis and Inflammation during Indirect Acute Lung Injury Am. J. Respir. Crit. Care Med., September 15, 2007; 176(6): 591 - 601. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Glasgow, S. Ramachandran, T. S. Blackwell, T. Mohanakumar, and W. C. Chapman Interleukin-1beta is the primary initiator of pulmonary inflammation following liver injury in mice Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L491 - L496. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Speshock, N. Doyon-Reale, R. Rabah, M. N. Neely, and P. C. Roberts Filamentous Influenza A Virus Infection Predisposes Mice to Fatal Septicemia following Superinfection with Streptococcus pneumoniae Serotype 3 Infect. Immun., June 1, 2007; 75(6): 3102 - 3111. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-C. Hsieh, M. Frink, C.-H. Hsieh, M. A. Choudhry, M. G. Schwacha, K. I. Bland, and I. H. Chaudry Downregulation of migration inhibitory factor is critical for estrogen-mediated attenuation of lung tissue damage following trauma-hemorrhage Am J Physiol Lung Cell Mol Physiol, May 1, 2007; 292(5): L1227 - L1232. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Frink, A. Lu, B. M. Thobe, Y.-C. Hsieh, M. A. Choudhry, M. G. Schwacha, S. L. Kunkel, and I. H. Chaudry Monocyte chemoattractant protein-1 influences trauma-hemorrhage-induced distal organ damage via regulation of keratinocyte-derived chemokine production Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2007; 292(3): R1110 - R1116. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Frink, B. M. Thobe, Y.-C. Hsieh, M. A. Choudhry, M. G. Schwacha, K. I. Bland, and I. H. Chaudry 17beta-Estradiol inhibits keratinocyte-derived chemokine production following trauma-hemorrhage Am J Physiol Lung Cell Mol Physiol, February 1, 2007; 292(2): L585 - L591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Li and H. G. Folkesson RNA interference for {alpha}-ENaC inhibits rat lung fluid absorption in vivo Am J Physiol Lung Cell Mol Physiol, April 1, 2006; 290(4): L649 - L660. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. B. Joosten, M. G. Netea, S.-H. Kim, D.-Y. Yoon, B. Oppers-Walgreen, T. R. D. Radstake, P. Barrera, F. A. J. van de Loo, C. A. Dinarello, and W. B. van den Berg IL-32, a proinflammatory cytokine in rheumatoid arthritis PNAS, February 28, 2006; 103(9): 3298 - 3303. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Perl, C.-S. Chung, J. Lomas-Neira, T.-M. Rachel, W. L. Biffl, W. G. Cioffi, and A. Ayala Silencing of Fas, but Not Caspase-8, in Lung Epithelial Cells Ameliorates Pulmonary Apoptosis, Inflammation, and Neutrophil Influx after Hemorrhagic Shock and Sepsis Am. J. Pathol., December 1, 2005; 167(6): 1545 - 1559. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
