Originally published online as doi:10.1189/jlb.1204733 on February 9, 2005
Published online before print February 9, 2005
(Journal of Leukocyte Biology. 2005;77:777-786.)
© 2005
by Society for Leukocyte Biology
Distribution and kinetics of SR-PSOX/CXCL16 and CXCR6 expression on human dendritic cell subsets and CD4+ T cells
Sumie Tabata*,
Norimitsu Kadowaki*,1,
Toshio Kitawaki*,
Takeshi Shimaoka
,
Shin Yonehara
,
Osamu Yoshie
and
Takashi Uchiyama*
* Department of Hematology and Oncology, Graduate School of Medicine, and
Graduate School of Biostudies and Institute for Virus Research, Kyoto University, Japan; and
Department of Microbiology, Kinki University School of Medicine, Osaka-Sayama, Osaka, Japan
1 Correspondence: Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin Kawara-cho, Sakyo-ku, Kyoto 606-8507, Japan. E-mail: kadowaki{at}kuhp.kyoto-u.ac.jp
 |
ABSTRACT
|
|---|
Dendritic cells (DCs) coordinate T cell responses by producing T cell-attracting chemokines and by inducing the expression of chemokine receptors on T cells. Scavenger receptor for phosphatidylserine and oxidized lipoprotein (SR-PSOX)/CXC chemokine ligand 16 (CXCL16) is a unique chemokine that also functions as an endocytic receptor and an adhesion molecule in its membrane-bound form. SR-PSOX/CXCL16 is the only known ligand of CXC chemokine receptor 6 (CXCR6) that is expressed on activated T cells and thus, may play an important role in enhancing effector functions of T cells. Here, we investigated the expression of SR-PSOX/CXCL16 on human DC subsets and that of CXCR6 on T cell subpopulations to elucidate the dynamics of CXCL16/CXCR6 interaction in DC/T cell responses. Membrane-bound SR-PSOX/CXCL16 was expressed on macrophages, monocyte-derived DCs, and blood myeloid DCs, and the expression increased after DC maturation. Myeloid antigen-presenting cells constitutively secreted SR-PSOX/CXCL16 for an extended period, suggesting the involvement of CXCL16 in peripheral and lymphoid tissues. Plasmacytoid DCs hardly expressed SR-PSOX/CXCL16 on their surfaces but secreted significant amounts of SR-PSOX/CXCL16. A subset of CD4+ effector memory T (TEM) cells constitutively expressed CXCR6, whereas central memory T cells (TCM) and naïve T cells did not. Upon stimulation with mature DCs, however, the expression of CXCR6 on TCM cells was markedly up-regulated, whereas the expression on naïve T cells was induced only weakly. These results suggest that the interaction between SR-PSOX/CXCL16 and CXCR6 plays an important role in enhancing TCM cell responses by mature DCs in lymphoid tissues and in augmenting TEM cell responses by macrophages in peripheral inflamed tissues.
Key Words: antigen-presenting cells chemokine chemokine receptor
 |
INTRODUCTION
|
|---|
The interaction between dendritic cells (DCs) and T cells determines the strength and quality of adaptive immune responses [1
]. During the interaction between mature DCs and naïve T (TN) cells in lymphoid tissues, DCs induce TN cells to become activated and to express chemokine receptors [2
, 3
]. Subsequently, the activated T cells are attracted by other antigen-presenting cells (APCs) in the lymphoid tissues for further activation [4
, 5
] or migrate to inflamed tissues and function as effector memory T (TEM) cells [6
]. A subpopulation of TN cells differentiates into central memory T (TCM) cells that produce only interleukin (IL)-2 and constitute a pool that develops into TEM cells [7
]. Thus, DCs coordinate T cell responses by inducing the expression of chemokine receptors on T cells and by secreting chemokines that attract T cells.
DCs are composed of distinct subsets: myeloid DCs (mDCs), which include monocyte-derived DCs (MoDCs) and CD11c+ mDCs in blood (here, designated as blood mDCs), and plasmacytoid DCs (pDCs) [8
]. In humans, MoDCs [9
] and blood mDCs [10
], activated by microbial pathogens or interferon-
(IFN-
), secrete IL-12p70 and preferentially induce T helper cell type 1 (Th1) responses. pDCs secrete vast amounts of type I IFNs in responses to viruses during innate immune responses [11
, 12
]. Subsequently, mDCs and pDCs are capable of inducing different types of Th cell responses depending on environmental signals [13
, 14
]. Thus, the two types of DCs may induce different types of innate and adaptive immune responses appropriate to eliminate given pathogens.
DCs secrete different chemokines, depending on maturation stages [15
] and subsets [16
]. MoDCs produce several inflammatory chemokines upon induction of maturation [15
]. CC chemokine ligand 3 [CCL3; macrophage-inflammatory protein-1
(MIP-1
)] and CCL4 (MIP-1ß) are rapidly induced and down-regulated, whereas CCL5 (regulated on activation, normal T expressed and secreted) and CXC chemokine ligand 10 (CXCL10; IFN-inducible protein 10) are produced in a sustained manner. Such different kinetics of production of chemokines by maturing DCs may reflect the site where the DCs attract other cells; the chemokines that are rapidly and transiently produced may function in peripheral inflamed tissues, whereas those continuously produced may mainly function in the lymphoid organs after DC migration.
It has been shown that mDCs and pDCs secrete different sets of chemokines [16
]. Blood mDCs mainly secrete the CC chemokine receptor 4 (CCR4) ligands CCL22 (monocyte-derived chemokine) and CCL17 (thymus and activation-regulated chemokine), suggesting that blood mDCs may preferentially attract CCR4-expressing Th2 cells and regulatory T cells to inflamed tissues. In contrast, pDCs secrete inflammatory chemokines CCL3, CCL4, CCL5, and CXCL10, which attract CCR5- and CXC chemokine receptor 3 (CXCR3)-expressing Th0/Th1 cells [16
, 17
]. As blood mDCs are capable of inducing Th1 responses [10
], mDCs should also be able to secrete chemokines that attract Th1 cells. However, the secretion of Th1-attracting chemokines by blood mDCs remains to be demonstrated.
Scavenger receptor for phosphatidylserine and oxidized lipoprotein (SR-PSOX)/CXCL16 is a recently characterized, unique chemokine, in that it functions as an endocytic receptor and an adhesion molecule in its membrane-bound form and as a chemokine in its soluble form [18
]. In mice, CXCL16 is expressed on DCs in the T cell zones of lymphoid organs and cells in splenic red pulp [19
]. In humans, SR-PSOX/CXCL16 is weakly expressed on B cells and monocytes [20
]. We have shown that MoDCs express a moderate level of SR-PSOX/CXCL16 [18
]. However, it remains to be investigated which DC subsets express SR-PSOX/CXCL16 on their surfaces and secrete its soluble form. In addition, it is not known whether DCs produce different amounts of SR-PSOX/CXCL16 depending on their maturation status. This could be important to infer, where SR-PSOX/CXCL16, secreted by DCs, mainly functions, namely, in peripheral inflamed tissues or lymphoid organs.
Several studies have shown that CXCR6, the only known receptor of SR-PSOX/CXCL16, is expressed on activated/effector T cells [19
20
21
], preferentially Th1 and T cytotoxic (Tc)1 cells [22
], in peripheral blood and inflamed tissues. The expression of chemokine receptors on T cells undergoes dynamic changes after stimulation [2
, 3
, 23
]. Thus, it is important to clarify the types of stimulation (APC subsets) that induces CXCR6 and the T cell developmental stages (TN, TCM, and TEM cells) at which the expression of CXCR6 is preferentially induced. In this context, it has been shown that MoDCs [3
] and blood mDCs [2
] hardly induce CXCR6 expression on CD4+ TN cells, whereas pDCs [2
] strongly induce CXCR6 expression in these cells. However, as the interaction between CXCL16 and CXCR6 appears to play a role in memory/effector steps of T cell responses, it is important to examine the induction and up-regulation of CXCR6, not only on TN cells but also on TCM and TEM cells.
Here, we investigated the expression of SR-PSOX/CXCL16 on human different DC subsets during their maturation process and the kinetics of CXCR6 induction on CD4+ TN, TCM, and TEM cells stimulated with MoDCs to delineate at which steps the interaction between SR-PSOX/CXCL16 and CXCR6 plays a role in the activation of T cells by DCs. We show that macrophages and mature mDCs, as well as pDCs to a lesser extent, express and secrete SR-PSOX/CXCL16 and that CD4+ TEM cells and activated TCM cells express CXCR6, whereas CD4+ TN cells are relatively resistant to the induction of CXCR6, even after an extended period of activation with mature MoDCs. These data suggest that SR-PSOX/CXCL16 from mature DCs may contribute to enhancing preactivated T cell responses by attracting CXCR6+-activated TCM cells and possibly TEM cells in lymphoid organs. Conversely, SR-PSOX/CXCL16 from macrophages may attract and maintain TEM cells in peripheral inflamed tissues.
 |
MATERIALS AND METHODS
|
|---|
Media and reagents
The culture medium used throughout was RPMI 1640 (Sigma Chemical Co., St. Louis, MO), supplemented with 10% fetal calf serum (ThermoTrace, Melbourne, Australia), 2 mM L-glutamine, penicillin G, streptomycin (Gibco-BRL, Carlsbad, CA), and 10 mM HEPES (Nacalai Tesque, Kyoto, Japan). Ficoll-Hypaque was purchased from Amersham Bioscience (Uppsala, Sweden). Human granulocyte macrophage-colony stimulating factor (GM-CSF) is a gift from Schering-Plough (Kenilworth, NJ). Recombinant human IL-4, tumor necrosis factor
(TNF-
), IL-1ß, IL-6, IL-3, and CXCL16 were purchased from PeproTech (London, UK). Prostaglandin E2 (PGE2) and lipopolysaccharide (LPS; Escherichia coli 055:B5) were purchased from Sigma Chemical Co. CD40L-transfected L cells [24
] are from DNAX Research Institute (Palo Alto, CA). The following oligodeoxynucleotides (ODNs) containing immunostimulatory CpG motifs were purchased from Hokkaido System Science (Sapporo, Japan): 2216, ggGGGACGATCGTCgggggG [25
] (sequences are shown 5'3'; small letters, phosphorothioate linkage; capital letters, phosphodiester linkage 3' of the base; bold, CpG-dinucleotides); 2006, tcgtcgttttgtcgttttgtcgtt [26
]. Mouse anti-human SR-PSOX/CXCL16 monoclonal antibodies (mAb) 22-19-12 and 25-15 were generated as described previously [18
]. MACS® magnetic microbeads conjugated with anti-CD14, anti-CD19, anti-CD45RA, anti-blood DC antigen 4 (BDCA-4), or anti-fluorescein isothiocyanate (anti-FITC), FITC-conjugated anti-BDCA-1, and CD4+ T Cell Isolation Kit II were purchased from Miltenyi Biotec (Bergisch Gladbach, Germany). The following Ab were used for flow cytometric analysis: FITC-conjugated mouse anti-human CCR7 mAb (R&D Systems, Minneapolis, MN), FITC-conjugated mouse anti-human CD45RO mAb (Immunotech, Marseille, France), phycoerythrin (PE)-conjugated mouse anti-human CD45RA mAb (Immunotech), PC5-conjugated mouse anti-human CD4 mAb (Immunotech), mouse anti-human CXCR6 mAb (clone 56811.111, R&D Systems), biotinylated rat anti-mouse immunoglobulin G2b (IgG2b; BD PharMingen, San Jose, CA), PE-conjugated streptavidin (Biosource International, Camarillo, CA), and PE-conjugated F(ab')2 goat anti-mouse IgG Ab (Biosource).
Isolation and culture of DCs and macrophages
Peripheral blood mononuclear cells (PBMCs) were obtained from a buffy coat of healthy donors (kindly provided by Kyoto Red Cross Blood Center, Japan) through Ficoll-Hypaque centrifugation. Monocytes were isolated from PBMCs using anti-CD14-conjugated MACS® magnetic microbeads and were cultured in the presence of 50 ng/ml GM-CSF and 200 U/ml IL-4 for 6 days at 5 x 105/ml. A half amount of medium was exchanged on day 3. The resulting immature DCs were washed and cultured for 24 h in the presence of 100 ng/ml LPS, 10 ng/ml TNF-
+ 10 ng/ml IL-1ß + 10 ng/ml IL-6 + 1 µg/ml PGE2, or human CD40L-transfected L cells [24
] (irradiated with 5500 rads) at 1 L cell for five DCs, together with GM-CSF and IL-4. Monocytes were cultured in the presence of 50 ng/ml GM-CSF for 7 days to induce macrophages.
To isolate CD11c+ blood mDCs and CD11c pDC precursors, PBMCs were depleted of lymphocytes and monocytes with a mixture of anti-CD3, anti-CD56, anti-CD14, and anti-CD16 mAb and with magnetic beads coated with goat anti-mouse IgG (Dynabeads M-450; Dynal, Great Neck, NY) [13
]. B cells were depleted using anti-CD19-conjugated MACS® beads. pDCs were isolated with anti-BDCA-4-conjugated MACS® beads. Subsequently, mDCs were isolated as BDCA4BDCA1+ cells with FITC-conjugated anti-BDCA1 mAb and anti-FITC-conjugated MACS® beads. The purity of pDCs and mDCs was
90%. mDCs were cultured with 10 ng/ml GM-CSF, with or without CD40L-L cells for 3 days. pDCs were cultured with 10 ng/ml IL-3, with or without CD40L-L cells, or 1 µM (6 µg/ml) ODN2216 or ODN2006 for 3 days. Both DCs were cultured at 2 x 104 cells per 200 µl in round-bottomed, 96-well culture plates.
Isolation and culture of T cells
CD4+ TN cells were isolated from umbilical cord blood obtained with written, informed consent, using the CD4+ T Cell Isolation Kit II. Purity was 9095%. CD4+ T cell were isolated from adult PBMCs using CD4+ T Cell Isolation Kit II, and CD4+ TN, TCM, and TEM cells were isolated as CD4+CCR7+CD45RA+ cells, CD4+CCR7+CD45RA cells, and CD4+CCR7CD45RA cells, respectively, using FACSAriaTM cell sorter (BD Biosciences, San Jose, CA). Purity was more than 99% (see Fig. 7a
). Allogeneic T cells (5x104) were cocultured with 104 MoDCs, blood mDCs, or pDCs for 6 days in round-bottomed, 96-well culture plates.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 7. Kinetics of CXCR6 expression by CD4+ TN, TCM, and TEM cells stimulated with mature MoDCs. (a) Expression patterns of CCR7 and CD45RA and purity of the three T cell populations isolated from PBMCs by cell sorting. (b) Kinetics of CXCR6 induction on CD4+ TN, TCM, and TEM cells stimulated with CD40L-stimulated, mature MoDCs. Shaded lines represent cells stained with isotype-matched, control mAb. The numbers shown with each histogram represent (MFI of SR-PSOX)/(MFI of isotype-matched control). The data shown are representative of three experiments. (c) Kinetics of CXCR6 induction on CD4+ TN, TCM, and TEM cells stimulated with CD40L-stimulated, mature MoDCs, as shown with percentages of CXCR6+ cells among each T cell population. The data shown are representative of three experiments.
|
|
Flow cytometric analysis
To detect surface SR-PSOX/CXCL16, APCs were stained with mouse anti-human SR-PSOX/CXCL16 mAb 22-19-12 and PE-conjugated goat anti-mouse IgG Ab, along with propidium iodide to eliminate dead cells. To detect CXCR6, T cells were stained with mouse anti-human CXCR6 mAb, biotinylated rat anti-mouse IgG2b, and PE-conjugated streptavidin. Peripheral blood leukocytes were obtained by treating whole blood with red blood cell (RBC) lysis buffer and stained with PC5-conjugated mouse anti-human CD4 mAb, FITC-conjugated mouse anti-human CD45RO mAb, and the above three-step reagents for CXCR6. The cells were analyzed using FACSCaliburTM (BD Biosciences).
Enzyme-linked immunosorbent assay (ELISA)
Soluble CXCL16 in culture supernatants was detected using a human CXCL16 ELISA development kit (PeproTech).
Chemotaxis assay
Chemotactic migration assays were performed using Transwell® (6.5 mm diameter and 5 µm pore size, #3421; Costar, Corning, NY). L1.2 mouse B cell line transfected with CXCR6 coding or empty vector (L1.2-CXCR6 and L1.2-control, respectively) [18
] was washed with the assay medium (RPMI 1640 without phenol red, containing 0.5% bovine serum albumin, 20 mM HEPES). L1.2 cells (4x105/100 µl) were placed in the upper chambers of Transwell inserts. The lower compartments contained 600 µl culture medium, with or without CXCL16 or DC culture supernatants. The volume of DC supernatants was determined based on the final concentrations of CXCL16. In some conditions, CXCL16 or DC supernatants were pretreated for 30 min at 37ºC with 20 µg/ml mouse IgG or mouse anti-human SR-PSOX/CXCL16 mAb 25-15, which has neutralizing activity for CXCL16. The Transwell was incubated at 37ºC for 3 h, inserts were removed, and relative cell counts were determined on FACSCaliburTM for 50 s under a constant sheath pressure with an appropriate gate based on forward- and side-scatter profiles. Migrated cell numbers were expressed as percent of input cells.
 |
RESULTS
|
|---|
Expression and secretion of SR-PSOX/CXCL16 by different subsets of DCs and monocytes/macrophages
SR-PSOX/CXCL16 is a unique chemokine in that it takes two forms: the membrane-bound and soluble forms [19
]. Previously, we have shown that SR-PSOX/CXCL16 is expressed on macrophages and MoDCs [18
]. However, it has not been shown which primary DC subsets in human blood and which maturation stage of DCs express SR-PSOX/CXCL16. Thus, we first examined the expression of SR-PSOX/CXCL16 on different types of APCs including monocytes/macrophages, MoDCs, blood mDCs, and pDCs at different maturation stages. As shown in Figure 1a
, monocytes and macrophages expressed moderate levels of SR-PSOX/CXCL16. Immature MoDCs expressed a lower level of SR-PSOX/CXCL16 than monocytes and macrophages, and the expression level increased after DC maturation with LPS, a mixture of TNF-
, IL-1ß, IL-6, and PGE2, or CD40L. Fresh blood mDCs expressed a low level of SR-PSOX/CXCL16, and the expression level increased after stimulation with GM-CSF and after further maturation with GM-CSF and CD40L (Fig. 1b)
. In contrast, fresh plasmacytoid pre-DCs or pDCs stimulated with CpG ODN 2006 or 2216 did not express SR-PSOX/CXCL16, and pDCs stimulated with IL-3 or IL-3 plus CD40L expressed low levels of SR-PSOX/CXCL16. These data indicate that myeloid APCs, i.e., macrophages, MoDCs, and blood mDCs, rather than pDCs, express SR-PSOX/CXCL16 on their surfaces. During maturation, the expression of SR-PSOX/CXCL16 on MoDCs and blood mDCs is up-regulated.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 1. Myeloid APCs rather than pDCs express surface SR-PSOX/CXCL16. (a) Expression of surface SR-PSOX/CXCL16 on monocytes, macrophages, and MoDCs. Macrophages were induced by culturing monocytes for 7 days in the presence of GM-CSF. Immature MoDCs were induced by culturing monocytes for 7 days in the presence of GM-CSF and IL-4. Mature MoDCs were induced by culturing monocytes for 7 days in the presence of GM-CSF and IL-4 and with the indicated maturation-inducing factors added during the last 24 h. (b) Expression of surface SR-PSOX/CXCL16 on blood mDCs and pDCs, which were isolated from peripheral blood using magnetic beads based on the expression of BDCA-1 (CD1c) and BDCA-4, respectively. Freshly isolated cells were analyzed, or the cells were cultured for 3 days in the presence of the indicated factors before analysis. Shaded lines represent cells stained with isotype-matched, control mAb. The numbers shown with each histogram represent (mean fluorescence intensity [MFI] of SR-PSOX)/(MFI of isotype-matched control). The data shown are representative of eight experiments.
|
|
Next, we examined secretion of the soluble form of SR-PSOX/CXCL16 from different DCs and macrophages. As shown in Figure 2a
, macrophages secrete a large amount of SR-PSOX/CXCL16, and immature MoDCs secreted less, in accordance with the lower expression of SR-PSOX/CXCL16 on immature MoDCs than macrophages (Fig. 1a)
. Maturation stimuli, particularly a mixture of TNF-
, IL-1ß, IL-6, and PGE2, induced secretion of larger amounts of SR-PSOX/CXCL16 compared with unstimulated, immature MoDCs (Fig. 2a)
. Blood mDCs stimulated with GM-CSF secreted a moderate amount of SR-PSOX/CXCL16, and maturation with GM-CSF plus CD40L increased the secretion (Fig. 2b)
, in accordance with the up-regulation of surface SR-PSOX/CXCL16 after CD40L stimulation (Fig. 1b)
. IL-3-stimulated pDCs secreted a comparable amount of SR-PSOX/CXCL16 with that from GM-CSF-stimulated mDCs (Fig. 2b)
, although the surface expression level was lower on the pDCs (Fig. 1b)
. CD40L stimulation together with IL-3 decreased the secretion of SR-PSOX/CXCL16 from pDCs (Fig. 2b)
, which when stimulated with IFN-
-noninducing ODN2006 or IFN-
-inducing ODN2216, secreted small amounts of SR-PSOX/CXCL16 (Fig. 2b)
, although the surface expression on these pDCs was undetectable (Fig. 1b)
. Taken together, macrophages and mDCs (MoDCs and blood mDCs) secrete significant amounts of SR-PSOX/CXCL16, and the secretion increases after DC maturation. pDCs also secreted small amounts of SR-PSOX/CXCL16, although the surface expressions were at very low levels or undetectable.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 2. Myeloid APCs and pDCs secrete soluble SR-PSOX/CXCL16. (a) Secretion of soluble SR-PSOX/CXCL16 by monocytes, macrophages, and MoDCs. Cells were washed on day 6, resuspended at 5 x 105/ml, and replated. The supernatants were harvested after 24 h. (b) Secretion of soluble SR-PSOX/CXCL16 by blood mDCs and pDCs. Cells were cultured at 2 x 105/ml, and the supernatants were harvested after 3 days. The concentrations of SR-PSOX/CXCL16 were measured by ELISA. Error bars indicate SD. (a and b) The supernatants were obtained from the same cultures as those for Figure 1a
and 1b
, respectively. The data shown are representative of five experiments.
|
|
Kinetics of SR-PSOX/CXCL16 secretion by MoDCs
MoDCs produce different chemokines with distinct patterns of kinetics [15
]. For example, immature MoDCs secrete little amounts of inflammatory chemokines CCL3, CCL4, and CCL5. Upon maturation stimuli, MoDCs rapidly and only transiently secrete large amounts of CCL3 and CCL4, whereas they secrete CCL5 in a sustained manner after maturation stimuli. Rapid and transient secretion of inflammatory chemokines by immature DCs upon maturation stimuli may promote migration of other effector cell types to peripheral inflamed tissues, whereas sustained secretion of inflammatory chemokines after DC maturation may be instrumental in recruiting inflammatory cell types to lymphoid tissues and in enhancing immune responses there. Thus, we examined the kinetics of SR-PSOX/CXCL16 secretion by immature and maturing MoDCs. As shown in Figure 3
, macrophages constantly secreted SR-PSOX/CXCL16 until 48 h during culture. Immature MoDCs also secreted SR-PSOX/CXCL16 in a sustained manner, although at much lower levels. Maturing MoDCs, stimulated with CD40L (Fig. 3)
, LPS, or a mixture of TNF-
, IL-1ß, IL-6, and PGE2 (data not shown), secreted a larger amount of SR-PSOX/CXCL16 than immature MoDCs in a sustained manner, similarly to macrophages. The sustained secretion of SR-PSOX/CXCL16 by macrophages and mature MoDCs, as well as immature MoDCs at a smaller amount, suggests that SR-PSOX/CXCL16 is capable of playing a role in peripheral inflamed tissues and in draining lymphoid organs during inflammation.

View larger version (12K):
[in this window]
[in a new window]
|
Figure 3. Macrophages and MoDCs secreted SR-PSOX/CXCL16 in a sustained manner. Cells were cultured at 5 x 105/ml, and the supernatants were harvested at the indicated time-points. DC maturation was induced with CD40L. The concentrations of SR-PSOX/CXCL16 were measured by ELISA. The data shown are representative of three experiments.
|
|
Chemotactic activity of SR-PSOX/CXCL16 secreted by macrophages and MoDCs
To ascertain that SR-PSOX/CXCL16 secreted by MoDCs was functional, the culture supernatants were tested for their capacity to induce migration of CXCR6-transfected L1.2 cells. As shown in Figure 4
, recombinant CXCL16 induced chemotaxis of the CXCR6 transfectants in a dose-dependent manner, and the chemotaxis was completely blocked by adding anti-SR-PSOX/CXCL16 mAb but not isotype control mAb. L1.2 cells transfected with empty vectors did not migrate to CXCR6 (data not shown). The supernatants of CD40L-stimulated, mature MoDCs induced chemotaxis of the CXCR6 transfectants in a dose-dependent manner, and the chemotaxis was completely blocked by adding anti-SR-PSOX/CXCL16 mAb similarly to the observation with recombinant CXCL16. The supernatants obtained from macrophages, immature MoDCs, mature MoDCs stimulated with LPS, or a mixture of TNF-
, IL-1ß, IL-6, and PGE2 showed similar results (data not shown). The ranges of CXCL16 concentrations that induced the migration were similar to the concentrations obtained from myeloid APCs shown in Figure 2
. Thus, the SR-PSOX/CXCL16 secreted by MoDCs or macrophages is functional.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 4. Chemotactic activity of SR-PSOX/CXCL16 secreted by MoDCs. DC supernatants (DC sup) or CXCL16 were added in the lower compartments, together with neutralizing anti-CXCL16 mAb or control IgG. Numbers of L1.2-CXCR6 cells that migrated across transwell were measured by flow cytometry, and the results were shown by percentages of migrated cells among total input cells. Error bars indicate SD. The data shown are representative of three experiments.
|
|
Distribution and induction of CXCR6 on T cells
Next, we examined the distribution of CXCR6 among T cell subpopulations and the induction of CXCR6 on CD4+ TN cells stimulated with primary DC subsets, blood mDCs, and pDCs to understand the possible situations where SR-PSOX/CXCL16 from APCs works. As shown in Figure 5
, among T cells, CXCR6 was preferentially expressed on CD45RO+ cells, particularly CD8+CD45RO+ T cells, although the frequency of positive cells was variable among donors. CD8+CD45RO T cells hardly expressed CXCR6, and CD4+CD45RO T cells lacked the expression of CXCR6. These data confirm the previous reports that CXCR6 functions in recruiting memory/effector CD4+ and CD8+ T cells [21
, 22
].

View larger version (12K):
[in this window]
[in a new window]
|
Figure 5. Memory T cells, particularly those expressing CD8, preferentially express CXCR6 among T cell subsets in peripheral blood. Whole blood was treated with RBC lysis buffer, and the percentages of CXCR6+ cells among each population were determined by flow cytometric analysis. The bars represent medians of data obtained from seven donors.
|
|
These data suggest that CD4+ T cells are more resistant to induction of CXCR6 than CD8+ T cells. However, appropriate stimuli, specifically pDCs, as shown previously [2
], may strongly induce CXCR6 on CD4+ TN cells. Alternatively, memory/effector CD4+ T cells are more prone to express CXCR6 after stimulation than naïve T cells. Thus, we first examined the induction of CXCR6 on CD4+ TN cells after stimulation with blood mDCs or pDCs (Fig. 6
). Allogeneic GM-CSF-stimulated mDCs induced CXCR6 on a small fraction of CD4+ TN cells, and GM-CSF- and CD40L-stimulated, mature mDCs induced slightly more CXCR6+ cells. Among pDCs, IL-3-stimulated ones induced more CXCR6+ T cells than IL-3- and CD40L-stimulated pDCs, although the percentages were variable depending on donors. Stimulation of pDCs with ODN2006 or ODN2216 slightly increased the induction of CXCR6 compared with IL-3- and CD40L-stimulated pDCs. Thus, mDCs and pDCs are capable of inducing the expression of CXCR6 on a small fraction of CD4+ TN cells.

View larger version (11K):
[in this window]
[in a new window]
|
Figure 6. Induction of CXCR6 on CD4+ TN cells by blood mDCs and pDCs. CD4+ TN cells isolated from cord blood were cultured with blood mDCs or pDCs that had been stimulated with the indicated factors. Percentages of CXCR6+ cells were determined by flow cytometric analysis. Data obtained from three donors are shown.
|
|
Kinetics of CXCR6 induction on CD4+ TN, TCM, and TEM cells by mature MoDCs
The increase in SR-PSOX/CXCL16 secretion after maturation of MoDCs and blood mDCs suggests that SR-PSOX/CXCL16 participates in the migration and activation of T cells in the T cell areas of lymphoid organs, where priming of naïve T cells by mature DCs occurs. However, naïve T cells do not express CXCR6, indicating that SR-PSOX/CXCL16 secreted from mature DCs does not play a role in the recruitment of naïve T cells. Thus, to delineate the target T cells of SR-PSOX/CXCL16 from mature DCs in lymphoid organs, we examined the kinetics of CXCR6 expression on CD4+ TN, TCM, and TEM T cells stimulated with mature DCs. To obtain sufficient numbers of mature DCs to follow the multiple time-points during coculture with T cells, we used MoDCs instead of blood mDCs or pDCs. We purified CD4+ TN, TCM, and TEM cells based on CD45RA and CCR7 expression by cell sorting (Fig. 7a
) and stimulated them with CD40L-activated, mature MoDCs for 6 days. Before culture, TN cells did not express CXCR6, and only a small number of TCM cells expressed low levels of CXCR6, whereas a significant number of TEM cells expressed CXCR6 (Fig. 7b
and 7c) . During 6-day stimulation, only 10% of TN cells gained the expression of CXCR6 (Fig. 7b
and 7c)
. TEM cells moderately increased the expression of CXCR6. In sharp contrast to TN cells, the expression of CXCR6 on TCM cells constantly and greatly increased during 6 days and reached equivalent levels to TEM cells in terms of percentages (Fig. 7c)
and higher levels than TEM cells in terms of intensity (Fig. 7b)
. We observed similar kinetics of CXCR6 expression using MoDCs stimulated with LPS or the PGE2-containing mixture (data not shown). These data suggest that activated TCM cells (and possibly TEM cells migrated from peripheral inflamed tissues), rather than TN cells, are the main target of SR-PSOX/CXCL16 secreted from mature DCs in the lymphoid organs.
 |
DISCUSSION
|
|---|
DCs and T cells are composed of several subsets that have different functional properties: mDCs and pDCs for DCs, and TN, TCM, and TEM cells for T cells. Migration and interaction of these DCs and T cells are governed by various combinations of chemokines and chemokine receptors. Here, we focused on SR-PSOX/CXCL16 and CXCR6, which have been implicated in the recruitment of effector T cells to inflamed tissues [22
]. The major findings are that SR-PSOX/CXCL16 is produced by macrophages and mature mDCs and also to a lesser extent, pDCs and that CXCR6 is expressed on CD4+ TEM cells and activated TCM cells, whereas TN cells are relatively resistant to the induction of CXCR6 by DC stimulation. These results suggest that SR-PSOX/CXCL16 on myeloid APCs and possibly on pDCs is involved in re-priming and "boosting" already primed memory T cell responses.
DCs produce different homeostatic and inflammatory chemokines, depending on their maturation stages [15
] and subsets [16
]. During maturation, MoDCs produce several inflammatory chemokines in a transient or sustained manner [15
]. Chemokines transiently secreted by immature DCs upon maturation stimuli may recruit various effector cells to peripheral inflamed tissues, while the DCs are still located there. Chemokines continuously secreted during DC maturation may mainly recruit T cells for priming after DCs have reached the lymphoid organs. The sustained manner of CXCL16 secretion by maturing MoDCs suggests that CXCL16 from DCs is mainly involved in the recruitment and stimulation of T cells in the lymphoid organs in certain conditions. Conversely, CXCL16 continuously secreted by macrophages may play a role in recruiting and retaining effector T cells in peripheral inflamed tissues.
Previous studies have shown that after activation, blood mDCs mainly secrete Th2 cell-attracting chemokines CCL22 and CCL17, whereas pDCs secrete Th1 cell-attracting chemokines CCL4, CCL5, and CXCL10 [16
, 17
]. Here, we showed that blood mDCs express and secrete CXCL16, which is capable of attracting Th1/Tc1 cells [22
]. Thus, blood mDCs appear to be involved in Th1 and Th2 responses from the aspect of chemokine secretion. This is consistent with the ability of mDCs to induce Th1 as well as Th2 responses depending on conditions [10
, 27
].
The secretion of soluble SR-PSOX/CXCL16 by myeloid APCs corresponds to the surface expression on these cells. Conversely, although pDCs expressed very low levels, if any, of SR-PSOX/CXCL16 on their surfaces, they secreted significant amounts of soluble SR-PSOX/CXCL16. This suggests that SR-PSOX/CXCL16 produced by pDCs may be so actively cleaved by metalloproteinases [28
29
30
] as to lose almost all of SR-PSOX/CXCL16 on their surfaces.
Several studies have shown that CXCR6 is expressed on activated T cells and natural killer T cells [19
20
21
22
, 31
]. Among activated T cells, CXCR6 is preferentially expressed on blood Th1/Tc1 cells and on T cells in inflamed tissues [22
]. Consistent with these findings, we showed that CXCR6 is expressed on memory CD4+CD45RO+ T cells and CD8+CD45RO+ T cells in blood, preferentially on the latter. Although CD4+CD45RO TN cells did not express CXCR6, stimulation with primary DCs, i.e., blood mDCs and pDCs, induced CXCR6 on a minor fraction of CD4+ TN cells. We could not demonstrate a marked difference in the induction of CXCR6 upon stimulation with mDCs or pDCs, as shown in the previous study [2
], without obvious reasons. Thus, after appropriate stimuli with mDCs or pDCs, CXCR6 can be expressed on a small but significant fraction of CD4+ TN cells.
Low levels of CXCR6 induction on CD4+ TN cells prompted us to examine whether memory T cell subsets exhibit more prominent up-regulation of CXCR6 upon activation by mature MoDCs. CD4+ TN cells were slow to gain the expression of CXCR6, and it was expressed on only 10% of cells even after 6 days, consistent with a previous finding [3
]. In marked contrast, TCM cells, which hardly expressed CXCR6 on day 0, similarly to TN cells, constantly and dramatically up-regulated CXCR6 expression during a 6-day culture. A significant fraction of TEM cells already expressed CXCR6 on day 0, and the expression gradually increased during a 6-day culture. These data suggest that in the T cell areas of lymphoid organs, CXCL16/CXCR6 may be mainly involved in the interaction between mature DCs and recently activated TCM cells. A small fraction of recently activated TN cells may also be attracted by CXCL16 if they were stimulated in appropriate conditions.
It has been shown that CCR7, a key chemokine receptor for the migration of naïve T cells to the T cell areas of lymphoid tissues, is also expressed on most Th1 and Th2 effector cells in blood [32
] and is rapidly and transiently induced on CD4+ TEM cell lines upon stimulation [2
]. In addition, in vitro-generated Th1 cells have been shown to express CCR7 and migrate well into the T cell areas of the spleen [33
]. These findings suggest that TEM cells in peripheral inflammatory tissues may be capable of being redirected to orthotopic or organized ectopic lymphoid tissues. This may be another situation where CXCL16 from mature DCs functions, i.e., attracting CCR7+ TEM cells to the lymphoid tissues.
It has been shown that the expression pattern of chemokine receptors on memory/effector T cells is modulated in a flexible manner [23
]. In particular, the expression of receptors for many inflammatory chemokines is down-regulated upon T cell receptor stimulation. In this respect, the constant and even enhanced expression of CXCR6 on TEM cells after stimulation is remarkable and suggests a significant role of CXCR6 in retaining TEM cells by CXCL16-secreting macrophages within chronic inflammatory tissues.
Recently, we analyzed the role of murine SR-PSOX/CXCL16 in the pathogenesis of experimental autoimmune encephalitis (EAE) [34
]. Decreases in disease activity were observed by administering anti-SR-PSOX mAb around the time of primary immunization or around the time of transferring encephalitogenic T cells, suggesting that SR-PSOX/CXCL16 plays an important role in two phases of pathogenesis of EAE: the induction of autoreactive T cells and their recruitment into the central nervous system. As TN cells hardly express CXCR6, SR-PSOX/CXCL16 may play a role in augmenting the activation of recently primed TN cells, which started to express CXCR6 during the induction phase of EAE and multiple sclerosis (MS). During the effector phase, SR-PSOX/CXCL16 produced by macrophages and interstitial cells [19
, 30
] in inflamed tissues may recruit and retain TEM cells. In addition, as CXCR6 expression is strongly up-regulated on CD4+ TCM cells upon activation, as shown in this study, the interaction between mature DCs and TCM cells through CXCL16 and CXCR6 may play a role in the relapse of EAE and MS.
SR-PSOX/CXCL16 on myeloid APCs is likely to have three functions: first, an endocytic receptor for microbial antigens [18
]; second, an adhesion molecule with CXCR6+ T cells [28
]; and third, a T cell-attracting chemokine in its soluble form, as suggested in this study. SR-PSOX/CXCL16 secreted by pDCs may also function in attracting activated T cells. The apparent involvement of the CXCL16/CXCR6 interaction in activating already primed TCM and TEM cells by myeloid APCs and pDCs indicates an "adjuvant" role of SR-PSOX/CXCL16 as an enhancer of immune responses. Blocking the CXCL16/CXCR6 interaction may be instrumental in alleviating ongoing pathological, inflammatory processes.
 |
ACKNOWLEDGEMENTS
|
|---|
We thank Keiko Fukunaga for her excellent technical assistance.
Received December 18, 2004;
accepted January 14, 2005.
 |
REFERENCES
|
|---|
- Banchereau, J., Briere, F., Caux, C., Davoust, J., Lebecque, S., Liu, Y. J., Pulendran, B., Palucka, K. (2000) Immunobiology of dendritic cells Annu. Rev. Immunol. 18,767-811[CrossRef][Medline]
- Langenkamp, A., Nagata, K., Murphy, K., Wu, L., Lanzavecchia, A., Sallusto, F. (2003) Kinetics and expression patterns of chemokine receptors in human CD4+ T lymphocytes primed by myeloid or plasmacytoid dendritic cells Eur. J. Immunol. 33,474-482[CrossRef][Medline]
- Kim, C. H., Nagata, K., Butcher, E. C. (2003) Dendritic cells support sequential reprogramming of chemoattractant receptor profiles during naive to effector T cell differentiation J. Immunol. 171,152-158[Abstract/Free Full Text]
- Tang, H. L., Cyster, J. G. (1999) Chemokine up-regulation and activated T cell attraction by maturing dendritic cells Science 284,819-822[Abstract/Free Full Text]
- Wu, M., Fang, H., Hwang, S. T. (2001) Cutting edge: CCR4 mediates antigen-primed T cell binding to activated dendritic cells J. Immunol. 167,4791-4795[Abstract/Free Full Text]
- Sallusto, F., Lanzavecchia, A. (2000) Understanding dendritic cell and T-lymphocyte traffic through the analysis of chemokine receptor expression Immunol. Rev. 177,134-140[CrossRef][Medline]
- Sallusto, F., Lenig, D., Forster, R., Lipp, M., Lanzavecchia, A. (1999) Two subsets of memory T lymphocytes with distinct homing potentials and effector functions Nature 401,708-712[CrossRef][Medline]
- Liu, Y. J., Kanzler, H., Soumelis, V., Gilliet, M. (2001) Dendritic cell lineage, plasticity and cross-regulation Nat. Immunol. 2,585-589[CrossRef][Medline]
- Hilkens, C. M., Kalinski, P., de Boer, M., Kapsenberg, M. L. (1997) Human dendritic cells require exogenous interleukin-12-inducing factors to direct the development of naive T-helper cells toward the Th1 phenotype Blood 90,1920-1926[Abstract/Free Full Text]
- Ito, T., Amakawa, R., Inaba, M., Ikehara, S., Inaba, K., Fukuhara, S. (2001) Differential regulation of human blood dendritic cell subsets by IFNs J. Immunol. 166,2961-2969[Abstract/Free Full Text]
- Siegal, F. P., Kadowaki, N., Shodell, M., Fitzgerald-Bocarsly, P. A., Shah, K., Ho, S., Antonenko, S., Liu, Y. J. (1999) The nature of the principal type 1 interferon-producing cells in human blood Science 284,1835-1837[Abstract/Free Full Text]
- Cella, M., Jarrossay, D., Facchetti, F., Alebardi, O., Nakajima, H., Lanzavecchia, A., Colonna, M. (1999) Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon Nat. Med. 5,919-923[CrossRef][Medline]
- Kadowaki, N., Antonenko, S., Lau, J. Y., Liu, Y. J. (2000) Natural interferon
/ß-producing cells link innate and adaptive immunity J. Exp. Med. 192,219-226[Abstract/Free Full Text]
- Kalinski, P., Hilkens, C. M., Wierenga, E. A., Kapsenberg, M. L. (1999) T-cell priming by type-1 and type-2 polarized dendritic cells: the concept of a third signal Immunol. Today 20,561-567[CrossRef][Medline]
- Sallusto, F., Palermo, B., Lenig, D., Miettinen, M., Matikainen, S., Julkunen, I., Forster, R., Burgstahler, R., Lipp, M., Lanzavecchia, A. (1999) Distinct patterns and kinetics of chemokine production regulate dendritic cell function Eur. J. Immunol. 29,1617-1625[CrossRef][Medline]
- Penna, G., Vulcano, M., Roncari, A., Facchetti, F., Sozzani, S., Adorini, L. (2002) Cutting edge: differential chemokine production by myeloid and plasmacytoid dendritic cells J. Immunol. 169,6673-6676[Abstract/Free Full Text]
- Megjugorac, N. J., Young, H. A., Amrute, S. B., Olshalsky, S. L., Fitzgerald-Bocarsly, P. (2004) Virally stimulated plasmacytoid dendritic cells produce chemokines and induce migration of T and NK cells J. Leukoc. Biol. 75,504-514[Abstract/Free Full Text]
- Shimaoka, T., Nakayama, T., Kume, N., Takahashi, S., Yamaguchi, J., Minami, M., Hayashida, K., Kita, T., Ohsumi, J., Yoshie, O., Yonehara, S. (2003) Cutting edge: SR-PSOX/CXC chemokine ligand 16 mediates bacterial phagocytosis by APCs through its chemokine domain J. Immunol. 171,1647-1651[Abstract/Free Full Text]
- Matloubian, M., David, A., Engel, S., Ryan, J. E., Cyster, J. G. (2000) A transmembrane CXC chemokine is a ligand for HIV-coreceptor Bonzo Nat. Immunol. 1,298-304[CrossRef][Medline]
- Wilbanks, A., Zondlo, S. C., Murphy, K., Mak, S., Soler, D., Langdon, P., Andrew, D. P., Wu, L., Briskin, M. (2001) Expression cloning of the STRL33/BONZO/TYMSTR ligand reveals elements of CC, CXC, and CX3C chemokines J. Immunol. 166,5145-5154[Abstract/Free Full Text]
- Unutmaz, D., Xiang, W., Sunshine, M. J., Campbell, J., Butcher, E., Littman, D. R. (2000) The primate lentiviral receptor Bonzo/STRL33 is coordinately regulated with CCR5, and its expression pattern is conserved between human and mouse J. Immunol. 165,3284-3292[Abstract/Free Full Text]
- Kim, C. H., Kunkel, E. J., Boisvert, J., Johnston, B., Campbell, J. J., Genovese, M. C., Greenberg, H. B., Butcher, E. C. (2001) Bonzo/CXCR6 expression defines type 1-polarized T-cell subsets with extralymphoid tissue homing potential J. Clin. Invest. 107,595-601[Medline]
- Sallusto, F., Kremmer, E., Palermo, B., Hoy, A., Ponath, P., Qin, S., Forster, R., Lipp, M., Lanzavecchia, A. (1999) Switch in chemokine receptor expression upon TCR stimulation reveals novel homing potential for recently activated T cells Eur. J. Immunol. 29,2037-2045[CrossRef][Medline]
- Kadowaki, N., Antonenko, S., Ho, S., Rissoan, M. C., Soumelis, V., Porcelli, S. A., Lanier, L. L., Liu, Y. J. (2001) Distinct cytokine profiles of neonatal natural killer T cells after expansion with subsets of dendritic cells J. Exp. Med. 193,1221-1226[Abstract/Free Full Text]
- Krug, A., Rothenfusser, S., Hornung, V., Jahrsdorfer, B., Blackwell, S., Ballas, Z. K., Endres, S., Krieg, A. M., Hartmann, G. (2001) Identification of CpG oligonucleotide sequences with high induction of IFN-
/ß in plasmacytoid dendritic cells Eur. J. Immunol. 31,2154-2163[CrossRef][Medline]
- Hartmann, G., Krieg, A. M. (2000) Mechanism and function of a newly identified CpG DNA motif in human primary B cells J. Immunol. 164,944-953[Abstract/Free Full Text]
- Soumelis, V., Reche, P. A., Kanzler, H., Yuan, W., Edward, G., Homey, B., Gilliet, M., Ho, S., Antonenko, S., Lauerma, A., Smith, K., Gorman, D., Zurawski, S., Abrams, J., Menon, S., McClanahan, T., de Waal-Malefyt Rd, R., Bazan, F., Kastelein, R. A., Liu, Y. J. (2002) Human epithelial cells trigger dendritic cell-mediated allergic inflammation by producing TSLP Nat. Immunol. 3,673-680[Medline]
- Shimaoka, T., Nakayama, T., Fukumoto, N., Kume, N., Takahashi, S., Yamaguchi, J., Minami, M., Hayashida, K., Kita, T., Ohsumi, J., Yoshie, O., Yonehara, S. (2004) Cell surface-anchored SR-PSOX/CXC chemokine ligand 16 mediates firm adhesion of CXC chemokine receptor 6-expressing cells J. Leukoc. Biol. 75,267-274[Abstract/Free Full Text]
- Gough, P. J., Garton, K. J., Wille, P. T., Rychlewski, M., Dempsey, P. J., Raines, E. W. (2004) A disintegrin and metalloproteinase 10-mediated cleavage and shedding regulates the cell surface expression of CXC chemokine ligand 16 J. Immunol. 172,3678-3685[Abstract/Free Full Text]
- Abel, S., Hundhausen, C., Mentlein, R., Schulte, A., Berkhout, T. A., Broadway, N., Hartmann, D., Sedlacek, R., Dietrich, S., Muetze, B., Schuster, B., Kallen, K. J., Saftig, P., Rose-John, S., Ludwig, A. (2004) The transmembrane CXC-chemokine ligand 16 is induced by IFN-{
} and TNF-{
} and shed by the activity of the disintegrin-like metalloproteinase ADAM10 J. Immunol. 172,6362-6372[Abstract/Free Full Text]
- Thomas, S. Y., Hou, R., Boyson, J. E., Means, T. K., Hess, C., Olson, D. P., Strominger, J. L., Brenner, M. B., Gumperz, J. E., Wilson, S. B., Luster, A. D. (2003) CD1d-restricted NKT cells express a chemokine receptor profile indicative of Th1-type inflammatory homing cells J. Immunol. 171,2571-2580[Abstract/Free Full Text]
- Kim, C. H., Rott, L., Kunkel, E. J., Genovese, M. C., Andrew, D. P., Wu, L., Butcher, E. C. (2001) Rules of chemokine receptor association with T cell polarization in vivo J. Clin. Invest. 108,1331-1339[CrossRef][Medline]
- Randolph, D. A., Huang, G., Carruthers, C. J., Bromley, L. E., Chaplin, D. D. (1999) The role of CCR7 in TH1 and TH2 cell localization and delivery of B cell help in vivo Science 286,2159-2162[Abstract/Free Full Text]
- Fukumoto, N., Shimaoka, T., Fujimura, H., Sakoda, S., Tanaka, M., Kita, T., Yonehara, S. (2004) Critical roles of CXC chemokine ligand 16/scavenger receptor that binds phosphatidylserine and oxidized lipoprotein in the pathogenesis of both acute and adoptive transfer experimental autoimmune encephalomyelitis J. Immunol. 173,1620-1627[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
T. Shimaoka, K.-i. Seino, N. Kume, M. Minami, C. Nishime, M. Suematsu, T. Kita, M. Taniguchi, K. Matsushima, and S. Yonehara
Critical Role for CXC Chemokine Ligand 16 (SR-PSOX) in Th1 Response Mediated by NKT Cells
J. Immunol.,
December 15, 2007;
179(12):
8172 - 8179.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. W T van Lieshout, J. Fransen, M. Flendrie, A. M M Eijsbouts, F. H J van den Hoogen, P. L C M van Riel, and T. R D J Radstake
Circulating levels of the chemokine CCL18 but not CXCL16 are elevated and correlate with disease activity in rheumatoid arthritis
Ann Rheum Dis,
October 1, 2007;
66(10):
1334 - 1338.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Tohyama, K. Sayama, H. Komatsuzawa, Y. Hanakawa, Y. Shirakata, X. Dai, L. Yang, S. Tokumaru, H. Nagai, S. Hirakawa, et al.
CXCL16 is a novel mediator of the innate immunity of epidermal keratinocytes
Int. Immunol.,
September 1, 2007;
19(9):
1095 - 1102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Gursel, I. Gursel, H. S. Mostowski, and D. M. Klinman
CXCL16 Influences the Nature and Specificity of CpG-Induced Immune Activation
J. Immunol.,
August 1, 2006;
177(3):
1575 - 1580.
[Abstract]
[Full Text]
[PDF]
|
 |
|