Published online before print February 9, 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* Department of Hematology and Oncology, Graduate School of Medicine, and
Graduate School of Biostudies and Institute for Virus Research, Kyoto University, Japan; and
Department of Microbiology, Kinki University School of Medicine, Osaka-Sayama, Osaka, Japan
1 Correspondence: Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin Kawara-cho, Sakyo-ku, Kyoto 606-8507, Japan. E-mail: kadowaki{at}kuhp.kyoto-u.ac.jp
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: antigen-presenting cells • chemokine • chemokine receptor
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
DCs are composed of distinct subsets: myeloid DCs (mDCs), which include monocyte-derived DCs (MoDCs) and CD11c+ mDCs in blood (here, designated as blood mDCs), and plasmacytoid DCs (pDCs) [8
]. In humans, MoDCs [9
] and blood mDCs [10
], activated by microbial pathogens or interferon-
(IFN-), secrete IL-12p70 and preferentially induce T helper cell type 1 (Th1) responses. pDCs secrete vast amounts of type I IFNs in responses to viruses during innate immune responses [11
, 12
]. Subsequently, mDCs and pDCs are capable of inducing different types of Th cell responses depending on environmental signals [13
, 14
]. Thus, the two types of DCs may induce different types of innate and adaptive immune responses appropriate to eliminate given pathogens.
DCs secrete different chemokines, depending on maturation stages [15
] and subsets [16
]. MoDCs produce several inflammatory chemokines upon induction of maturation [15
]. CC chemokine ligand 3 [CCL3; macrophage-inflammatory protein-1
(MIP-1)] and CCL4 (MIP-1ß) are rapidly induced and down-regulated, whereas CCL5 (regulated on activation, normal T expressed and secreted) and CXC chemokine ligand 10 (CXCL10; IFN-inducible protein 10) are produced in a sustained manner. Such different kinetics of production of chemokines by maturing DCs may reflect the site where the DCs attract other cells; the chemokines that are rapidly and transiently produced may function in peripheral inflamed tissues, whereas those continuously produced may mainly function in the lymphoid organs after DC migration.
It has been shown that mDCs and pDCs secrete different sets of chemokines [16 ]. Blood mDCs mainly secrete the CC chemokine receptor 4 (CCR4) ligands CCL22 (monocyte-derived chemokine) and CCL17 (thymus and activation-regulated chemokine), suggesting that blood mDCs may preferentially attract CCR4-expressing Th2 cells and regulatory T cells to inflamed tissues. In contrast, pDCs secrete inflammatory chemokines CCL3, CCL4, CCL5, and CXCL10, which attract CCR5- and CXC chemokine receptor 3 (CXCR3)-expressing Th0/Th1 cells [16 , 17 ]. As blood mDCs are capable of inducing Th1 responses [10 ], mDCs should also be able to secrete chemokines that attract Th1 cells. However, the secretion of Th1-attracting chemokines by blood mDCs remains to be demonstrated.
Scavenger receptor for phosphatidylserine and oxidized lipoprotein (SR-PSOX)/CXCL16 is a recently characterized, unique chemokine, in that it functions as an endocytic receptor and an adhesion molecule in its membrane-bound form and as a chemokine in its soluble form [18 ]. In mice, CXCL16 is expressed on DCs in the T cell zones of lymphoid organs and cells in splenic red pulp [19 ]. In humans, SR-PSOX/CXCL16 is weakly expressed on B cells and monocytes [20 ]. We have shown that MoDCs express a moderate level of SR-PSOX/CXCL16 [18 ]. However, it remains to be investigated which DC subsets express SR-PSOX/CXCL16 on their surfaces and secrete its soluble form. In addition, it is not known whether DCs produce different amounts of SR-PSOX/CXCL16 depending on their maturation status. This could be important to infer, where SR-PSOX/CXCL16, secreted by DCs, mainly functions, namely, in peripheral inflamed tissues or lymphoid organs.
Several studies have shown that CXCR6, the only known receptor of SR-PSOX/CXCL16, is expressed on activated/effector T cells [19 20 21 ], preferentially Th1 and T cytotoxic (Tc)1 cells [22 ], in peripheral blood and inflamed tissues. The expression of chemokine receptors on T cells undergoes dynamic changes after stimulation [2 , 3 , 23 ]. Thus, it is important to clarify the types of stimulation (APC subsets) that induces CXCR6 and the T cell developmental stages (TN, TCM, and TEM cells) at which the expression of CXCR6 is preferentially induced. In this context, it has been shown that MoDCs [3 ] and blood mDCs [2 ] hardly induce CXCR6 expression on CD4+ TN cells, whereas pDCs [2 ] strongly induce CXCR6 expression in these cells. However, as the interaction between CXCL16 and CXCR6 appears to play a role in memory/effector steps of T cell responses, it is important to examine the induction and up-regulation of CXCR6, not only on TN cells but also on TCM and TEM cells.
Here, we investigated the expression of SR-PSOX/CXCL16 on human different DC subsets during their maturation process and the kinetics of CXCR6 induction on CD4+ TN, TCM, and TEM cells stimulated with MoDCs to delineate at which steps the interaction between SR-PSOX/CXCL16 and CXCR6 plays a role in the activation of T cells by DCs. We show that macrophages and mature mDCs, as well as pDCs to a lesser extent, express and secrete SR-PSOX/CXCL16 and that CD4+ TEM cells and activated TCM cells express CXCR6, whereas CD4+ TN cells are relatively resistant to the induction of CXCR6, even after an extended period of activation with mature MoDCs. These data suggest that SR-PSOX/CXCL16 from mature DCs may contribute to enhancing preactivated T cell responses by attracting CXCR6+-activated TCM cells and possibly TEM cells in lymphoid organs. Conversely, SR-PSOX/CXCL16 from macrophages may attract and maintain TEM cells in peripheral inflamed tissues.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
(TNF-), IL-1ß, IL-6, IL-3, and CXCL16 were purchased from PeproTech (London, UK). Prostaglandin E2 (PGE2) and lipopolysaccharide (LPS; Escherichia coli 055:B5) were purchased from Sigma Chemical Co. CD40L-transfected L cells [24
] are from DNAX Research Institute (Palo Alto, CA). The following oligodeoxynucleotides (ODNs) containing immunostimulatory CpG motifs were purchased from Hokkaido System Science (Sapporo, Japan): 2216, ggGGGACGATCGTCgggggG [25
] (sequences are shown 5'–3'; small letters, phosphorothioate linkage; capital letters, phosphodiester linkage 3' of the base; bold, CpG-dinucleotides); 2006, tcgtcgttttgtcgttttgtcgtt [26
]. Mouse anti-human SR-PSOX/CXCL16 monoclonal antibodies (mAb) 22-19-12 and 25-15 were generated as described previously [18
]. MACS® magnetic microbeads conjugated with anti-CD14, anti-CD19, anti-CD45RA, anti-blood DC antigen 4 (BDCA-4), or anti-fluorescein isothiocyanate (anti-FITC), FITC-conjugated anti-BDCA-1, and CD4+ T Cell Isolation Kit II were purchased from Miltenyi Biotec (Bergisch Gladbach, Germany). The following Ab were used for flow cytometric analysis: FITC-conjugated mouse anti-human CCR7 mAb (R&D Systems, Minneapolis, MN), FITC-conjugated mouse anti-human CD45RO mAb (Immunotech, Marseille, France), phycoerythrin (PE)-conjugated mouse anti-human CD45RA mAb (Immunotech), PC5-conjugated mouse anti-human CD4 mAb (Immunotech), mouse anti-human CXCR6 mAb (clone 56811.111, R&D Systems), biotinylated rat anti-mouse immunoglobulin G2b (IgG2b; BD PharMingen, San Jose, CA), PE-conjugated streptavidin (Biosource International, Camarillo, CA), and PE-conjugated F(ab')2 goat anti-mouse IgG Ab (Biosource).
Isolation and culture of DCs and macrophages
Peripheral blood mononuclear cells (PBMCs) were obtained from a buffy coat of healthy donors (kindly provided by Kyoto Red Cross Blood Center, Japan) through Ficoll-Hypaque centrifugation. Monocytes were isolated from PBMCs using anti-CD14-conjugated MACS® magnetic microbeads and were cultured in the presence of 50 ng/ml GM-CSF and 200 U/ml IL-4 for 6 days at 5 x 105/ml. A half amount of medium was exchanged on day 3. The resulting immature DCs were washed and cultured for 24 h in the presence of 100 ng/ml LPS, 10 ng/ml TNF- + 10 ng/ml IL-1ß + 10 ng/ml IL-6 + 1 µg/ml PGE2, or human CD40L-transfected L cells [24
] (irradiated with 5500 rads) at 1 L cell for five DCs, together with GM-CSF and IL-4. Monocytes were cultured in the presence of 50 ng/ml GM-CSF for 7 days to induce macrophages.
To isolate CD11c+ blood mDCs and CD11c– pDC precursors, PBMCs were depleted of lymphocytes and monocytes with a mixture of anti-CD3, anti-CD56, anti-CD14, and anti-CD16 mAb and with magnetic beads coated with goat anti-mouse IgG (Dynabeads M-450; Dynal, Great Neck, NY) [13
]. B cells were depleted using anti-CD19-conjugated MACS® beads. pDCs were isolated with anti-BDCA-4-conjugated MACS® beads. Subsequently, mDCs were isolated as BDCA4–BDCA1+ cells with FITC-conjugated anti-BDCA1 mAb and anti-FITC-conjugated MACS® beads. The purity of pDCs and mDCs was 
90%. mDCs were cultured with 10 ng/ml GM-CSF, with or without CD40L-L cells for 3 days. pDCs were cultured with 10 ng/ml IL-3, with or without CD40L-L cells, or 1 µM (6 µg/ml) ODN2216 or ODN2006 for 3 days. Both DCs were cultured at 2 x 104 cells per 200 µl in round-bottomed, 96-well culture plates.
Isolation and culture of T cells
CD4+ TN cells were isolated from umbilical cord blood obtained with written, informed consent, using the CD4+ T Cell Isolation Kit II. Purity was 90–95%. CD4+ T cell were isolated from adult PBMCs using CD4+ T Cell Isolation Kit II, and CD4+ TN, TCM, and TEM cells were isolated as CD4+CCR7+CD45RA+ cells, CD4+CCR7+CD45RA– cells, and CD4+CCR7–CD45RA– cells, respectively, using FACSAriaTM cell sorter (BD Biosciences, San Jose, CA). Purity was more than 99% (see Fig. 7a
). Allogeneic T cells (5x104) were cocultured with 104 MoDCs, blood mDCs, or pDCs for 6 days in round-bottomed, 96-well culture plates.
 View larger version (24K): [in a new window] |
Figure 7. Kinetics of CXCR6 expression by CD4+ TN, TCM, and TEM cells stimulated with mature MoDCs. (a) Expression patterns of CCR7 and CD45RA and purity of the three T cell populations isolated from PBMCs by cell sorting. (b) Kinetics of CXCR6 induction on CD4+ TN, TCM, and TEM cells stimulated with CD40L-stimulated, mature MoDCs. Shaded lines represent cells stained with isotype-matched, control mAb. The numbers shown with each histogram represent (MFI of SR-PSOX)/(MFI of isotype-matched control). The data shown are representative of three experiments. (c) Kinetics of CXCR6 induction on CD4+ TN, TCM, and TEM cells stimulated with CD40L-stimulated, mature MoDCs, as shown with percentages of CXCR6+ cells among each T cell population. The data shown are representative of three experiments.
|
Enzyme-linked immunosorbent assay (ELISA)
Soluble CXCL16 in culture supernatants was detected using a human CXCL16 ELISA development kit (PeproTech).
Chemotaxis assay
Chemotactic migration assays were performed using Transwell® (6.5 mm diameter and 5 µm pore size, #3421; Costar, Corning, NY). L1.2 mouse B cell line transfected with CXCR6 coding or empty vector (L1.2-CXCR6 and L1.2-control, respectively) [18
] was washed with the assay medium (RPMI 1640 without phenol red, containing 0.5% bovine serum albumin, 20 mM HEPES). L1.2 cells (4x105/100 µl) were placed in the upper chambers of Transwell inserts. The lower compartments contained 600 µl culture medium, with or without CXCL16 or DC culture supernatants. The volume of DC supernatants was determined based on the final concentrations of CXCL16. In some conditions, CXCL16 or DC supernatants were pretreated for 30 min at 37ºC with 20 µg/ml mouse IgG or mouse anti-human SR-PSOX/CXCL16 mAb 25-15, which has neutralizing activity for CXCL16. The Transwell was incubated at 37ºC for 3 h, inserts were removed, and relative cell counts were determined on FACSCaliburTM for 50 s under a constant sheath pressure with an appropriate gate based on forward- and side-scatter profiles. Migrated cell numbers were expressed as percent of input cells.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, IL-1ß, IL-6, and PGE2, or CD40L. Fresh blood mDCs expressed a low level of SR-PSOX/CXCL16, and the expression level increased after stimulation with GM-CSF and after further maturation with GM-CSF and CD40L (Fig. 1b)
. In contrast, fresh plasmacytoid pre-DCs or pDCs stimulated with CpG ODN 2006 or 2216 did not express SR-PSOX/CXCL16, and pDCs stimulated with IL-3 or IL-3 plus CD40L expressed low levels of SR-PSOX/CXCL16. These data indicate that myeloid APCs, i.e., macrophages, MoDCs, and blood mDCs, rather than pDCs, express SR-PSOX/CXCL16 on their surfaces. During maturation, the expression of SR-PSOX/CXCL16 on MoDCs and blood mDCs is up-regulated.
 View larger version (30K): [in a new window] |
Figure 1. Myeloid APCs rather than pDCs express surface SR-PSOX/CXCL16. (a) Expression of surface SR-PSOX/CXCL16 on monocytes, macrophages, and MoDCs. Macrophages were induced by culturing monocytes for 7 days in the presence of GM-CSF. Immature MoDCs were induced by culturing monocytes for 7 days in the presence of GM-CSF and IL-4. Mature MoDCs were induced by culturing monocytes for 7 days in the presence of GM-CSF and IL-4 and with the indicated maturation-inducing factors added during the last 24 h. (b) Expression of surface SR-PSOX/CXCL16 on blood mDCs and pDCs, which were isolated from peripheral blood using magnetic beads based on the expression of BDCA-1 (CD1c) and BDCA-4, respectively. Freshly isolated cells were analyzed, or the cells were cultured for 3 days in the presence of the indicated factors before analysis. Shaded lines represent cells stained with isotype-matched, control mAb. The numbers shown with each histogram represent (mean fluorescence intensity [MFI] of SR-PSOX)/(MFI of isotype-matched control). The data shown are representative of eight experiments.
|
, IL-1ß, IL-6, and PGE2, induced secretion of larger amounts of SR-PSOX/CXCL16 compared with unstimulated, immature MoDCs (Fig. 2a)
. Blood mDCs stimulated with GM-CSF secreted a moderate amount of SR-PSOX/CXCL16, and maturation with GM-CSF plus CD40L increased the secretion (Fig. 2b)
, in accordance with the up-regulation of surface SR-PSOX/CXCL16 after CD40L stimulation (Fig. 1b)
. IL-3-stimulated pDCs secreted a comparable amount of SR-PSOX/CXCL16 with that from GM-CSF-stimulated mDCs (Fig. 2b)
, although the surface expression level was lower on the pDCs (Fig. 1b)
. CD40L stimulation together with IL-3 decreased the secretion of SR-PSOX/CXCL16 from pDCs (Fig. 2b)
, which when stimulated with IFN--noninducing ODN2006 or IFN--inducing ODN2216, secreted small amounts of SR-PSOX/CXCL16 (Fig. 2b)
, although the surface expression on these pDCs was undetectable (Fig. 1b)
. Taken together, macrophages and mDCs (MoDCs and blood mDCs) secrete significant amounts of SR-PSOX/CXCL16, and the secretion increases after DC maturation. pDCs also secreted small amounts of SR-PSOX/CXCL16, although the surface expressions were at very low levels or undetectable.
 View larger version (18K): [in a new window] |
Figure 2. Myeloid APCs and pDCs secrete soluble SR-PSOX/CXCL16. (a) Secretion of soluble SR-PSOX/CXCL16 by monocytes, macrophages, and MoDCs. Cells were washed on day 6, resuspended at 5 x 105/ml, and replated. The supernatants were harvested after 24 h. (b) Secretion of soluble SR-PSOX/CXCL16 by blood mDCs and pDCs. Cells were cultured at 2 x 105/ml, and the supernatants were harvested after 3 days. The concentrations of SR-PSOX/CXCL16 were measured by ELISA. Error bars indicate SD. (a and b) The supernatants were obtained from the same cultures as those for Figure 1a
and 1b
, respectively. The data shown are representative of five experiments.
|
, IL-1ß, IL-6, and PGE2 (data not shown), secreted a larger amount of SR-PSOX/CXCL16 than immature MoDCs in a sustained manner, similarly to macrophages. The sustained secretion of SR-PSOX/CXCL16 by macrophages and mature MoDCs, as well as immature MoDCs at a smaller amount, suggests that SR-PSOX/CXCL16 is capable of playing a role in peripheral inflamed tissues and in draining lymphoid organs during inflammation.
 View larger version (12K): [in a new window] |
Figure 3. Macrophages and MoDCs secreted SR-PSOX/CXCL16 in a sustained manner. Cells were cultured at 5 x 105/ml, and the supernatants were harvested at the indicated time-points. DC maturation was induced with CD40L. The concentrations of SR-PSOX/CXCL16 were measured by ELISA. The data shown are representative of three experiments.
|
, IL-1ß, IL-6, and PGE2 showed similar results (data not shown). The ranges of CXCL16 concentrations that induced the migration were similar to the concentrations obtained from myeloid APCs shown in Figure 2
. Thus, the SR-PSOX/CXCL16 secreted by MoDCs or macrophages is functional.
 View larger version (13K): [in a new window] |
Figure 4. Chemotactic activity of SR-PSOX/CXCL16 secreted by MoDCs. DC supernatants (DC sup) or CXCL16 were added in the lower compartments, together with neutralizing anti-CXCL16 mAb or control IgG. Numbers of L1.2-CXCR6 cells that migrated across transwell were measured by flow cytometry, and the results were shown by percentages of migrated cells among total input cells. Error bars indicate SD. The data shown are representative of three experiments.
|
 View larger version (12K): [in a new window] |
Figure 5. Memory T cells, particularly those expressing CD8, preferentially express CXCR6 among T cell subsets in peripheral blood. Whole blood was treated with RBC lysis buffer, and the percentages of CXCR6+ cells among each population were determined by flow cytometric analysis. The bars represent medians of data obtained from seven donors.
|
 View larger version (11K): [in a new window] |
Figure 6. Induction of CXCR6 on CD4+ TN cells by blood mDCs and pDCs. CD4+ TN cells isolated from cord blood were cultured with blood mDCs or pDCs that had been stimulated with the indicated factors. Percentages of CXCR6+ cells were determined by flow cytometric analysis. Data obtained from three donors are shown.
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
DCs produce different homeostatic and inflammatory chemokines, depending on their maturation stages [15 ] and subsets [16 ]. During maturation, MoDCs produce several inflammatory chemokines in a transient or sustained manner [15 ]. Chemokines transiently secreted by immature DCs upon maturation stimuli may recruit various effector cells to peripheral inflamed tissues, while the DCs are still located there. Chemokines continuously secreted during DC maturation may mainly recruit T cells for priming after DCs have reached the lymphoid organs. The sustained manner of CXCL16 secretion by maturing MoDCs suggests that CXCL16 from DCs is mainly involved in the recruitment and stimulation of T cells in the lymphoid organs in certain conditions. Conversely, CXCL16 continuously secreted by macrophages may play a role in recruiting and retaining effector T cells in peripheral inflamed tissues.
Previous studies have shown that after activation, blood mDCs mainly secrete Th2 cell-attracting chemokines CCL22 and CCL17, whereas pDCs secrete Th1 cell-attracting chemokines CCL4, CCL5, and CXCL10 [16 , 17 ]. Here, we showed that blood mDCs express and secrete CXCL16, which is capable of attracting Th1/Tc1 cells [22 ]. Thus, blood mDCs appear to be involved in Th1 and Th2 responses from the aspect of chemokine secretion. This is consistent with the ability of mDCs to induce Th1 as well as Th2 responses depending on conditions [10 , 27 ].
The secretion of soluble SR-PSOX/CXCL16 by myeloid APCs corresponds to the surface expression on these cells. Conversely, although pDCs expressed very low levels, if any, of SR-PSOX/CXCL16 on their surfaces, they secreted significant amounts of soluble SR-PSOX/CXCL16. This suggests that SR-PSOX/CXCL16 produced by pDCs may be so actively cleaved by metalloproteinases [28 29 30 ] as to lose almost all of SR-PSOX/CXCL16 on their surfaces.
Several studies have shown that CXCR6 is expressed on activated T cells and natural killer T cells [19 20 21 22 , 31 ]. Among activated T cells, CXCR6 is preferentially expressed on blood Th1/Tc1 cells and on T cells in inflamed tissues [22 ]. Consistent with these findings, we showed that CXCR6 is expressed on memory CD4+CD45RO+ T cells and CD8+CD45RO+ T cells in blood, preferentially on the latter. Although CD4+CD45RO– TN cells did not express CXCR6, stimulation with primary DCs, i.e., blood mDCs and pDCs, induced CXCR6 on a minor fraction of CD4+ TN cells. We could not demonstrate a marked difference in the induction of CXCR6 upon stimulation with mDCs or pDCs, as shown in the previous study [2 ], without obvious reasons. Thus, after appropriate stimuli with mDCs or pDCs, CXCR6 can be expressed on a small but significant fraction of CD4+ TN cells.
Low levels of CXCR6 induction on CD4+ TN cells prompted us to examine whether memory T cell subsets exhibit more prominent up-regulation of CXCR6 upon activation by mature MoDCs. CD4+ TN cells were slow to gain the expression of CXCR6, and it was expressed on only 10% of cells even after 6 days, consistent with a previous finding [3 ]. In marked contrast, TCM cells, which hardly expressed CXCR6 on day 0, similarly to TN cells, constantly and dramatically up-regulated CXCR6 expression during a 6-day culture. A significant fraction of TEM cells already expressed CXCR6 on day 0, and the expression gradually increased during a 6-day culture. These data suggest that in the T cell areas of lymphoid organs, CXCL16/CXCR6 may be mainly involved in the interaction between mature DCs and recently activated TCM cells. A small fraction of recently activated TN cells may also be attracted by CXCL16 if they were stimulated in appropriate conditions.
It has been shown that CCR7, a key chemokine receptor for the migration of naïve T cells to the T cell areas of lymphoid tissues, is also expressed on most Th1 and Th2 effector cells in blood [32 ] and is rapidly and transiently induced on CD4+ TEM cell lines upon stimulation [2 ]. In addition, in vitro-generated Th1 cells have been shown to express CCR7 and migrate well into the T cell areas of the spleen [33 ]. These findings suggest that TEM cells in peripheral inflammatory tissues may be capable of being redirected to orthotopic or organized ectopic lymphoid tissues. This may be another situation where CXCL16 from mature DCs functions, i.e., attracting CCR7+ TEM cells to the lymphoid tissues.
It has been shown that the expression pattern of chemokine receptors on memory/effector T cells is modulated in a flexible manner [23 ]. In particular, the expression of receptors for many inflammatory chemokines is down-regulated upon T cell receptor stimulation. In this respect, the constant and even enhanced expression of CXCR6 on TEM cells after stimulation is remarkable and suggests a significant role of CXCR6 in retaining TEM cells by CXCL16-secreting macrophages within chronic inflammatory tissues.
Recently, we analyzed the role of murine SR-PSOX/CXCL16 in the pathogenesis of experimental autoimmune encephalitis (EAE) [34 ]. Decreases in disease activity were observed by administering anti-SR-PSOX mAb around the time of primary immunization or around the time of transferring encephalitogenic T cells, suggesting that SR-PSOX/CXCL16 plays an important role in two phases of pathogenesis of EAE: the induction of autoreactive T cells and their recruitment into the central nervous system. As TN cells hardly express CXCR6, SR-PSOX/CXCL16 may play a role in augmenting the activation of recently primed TN cells, which started to express CXCR6 during the induction phase of EAE and multiple sclerosis (MS). During the effector phase, SR-PSOX/CXCL16 produced by macrophages and interstitial cells [19 , 30 ] in inflamed tissues may recruit and retain TEM cells. In addition, as CXCR6 expression is strongly up-regulated on CD4+ TCM cells upon activation, as shown in this study, the interaction between mature DCs and TCM cells through CXCL16 and CXCR6 may play a role in the relapse of EAE and MS.
SR-PSOX/CXCL16 on myeloid APCs is likely to have three functions: first, an endocytic receptor for microbial antigens [18 ]; second, an adhesion molecule with CXCR6+ T cells [28 ]; and third, a T cell-attracting chemokine in its soluble form, as suggested in this study. SR-PSOX/CXCL16 secreted by pDCs may also function in attracting activated T cells. The apparent involvement of the CXCL16/CXCR6 interaction in activating already primed TCM and TEM cells by myeloid APCs and pDCs indicates an "adjuvant" role of SR-PSOX/CXCL16 as an enhancer of immune responses. Blocking the CXCL16/CXCR6 interaction may be instrumental in alleviating ongoing pathological, inflammatory processes.
Received December 18, 2004; accepted January 14, 2005.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
/ß-producing cells link innate and adaptive immunity J. Exp. Med. 192,219-226/ß in plasmacytoid dendritic cells Eur. J. Immunol. 31,2154-2163[CrossRef][Medline]} and TNF-{} and shed by the activity of the disintegrin-like metalloproteinase ADAM10 J. Immunol. 172,6362-6372This article has been cited by other articles:
 |
|
 |
|
  J. Barlic, W. Zhu, and P. M. Murphy Atherogenic Lipids Induce High-Density Lipoprotein Uptake and Cholesterol Efflux in Human Macrophages by Up-Regulating Transmembrane Chemokine CXCL16 without Engaging CXCL16-Dependent Cell Adhesion J. Immunol., June 15, 2009; 182(12): 7928 - 7936. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Gutwein, M. S. Abdel-Bakky, A. Schramme, K. Doberstein, N. Kampfer-Kolb, K. Amann, I. A. Hauser, N. Obermuller, C. Bartel, A.-A. H. Abdel-Aziz, et al. CXCL16 Is Expressed in Podocytes and Acts as a Scavenger Receptor for Oxidized Low-Density Lipoprotein Am. J. Pathol., June 1, 2009; 174(6): 2061 - 2072. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A W T van Lieshout, R van der Voort, L W J Toonen, S F G van Helden, C G Figdor, P L C M van Riel, T R D J Radstake, and G J Adema Regulation of CXCL16 expression and secretion by myeloid cells is not altered in rheumatoid arthritis Ann Rheum Dis, June 1, 2009; 68(6): 1036 - 1043. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, Y. Lu, J. Wang, A. E. Koch, J. Zhang, and R. S. Taichman CXCR6 Induces Prostate Cancer Progression by the AKT/Mammalian Target of Rapamycin Signaling Pathway Cancer Res., December 15, 2008; 68(24): 10367 - 10377. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Shimaoka, K.-i. Seino, N. Kume, M. Minami, C. Nishime, M. Suematsu, T. Kita, M. Taniguchi, K. Matsushima, and S. Yonehara Critical Role for CXC Chemokine Ligand 16 (SR-PSOX) in Th1 Response Mediated by NKT Cells J. Immunol., December 15, 2007; 179(12): 8172 - 8179. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. W T van Lieshout, J. Fransen, M. Flendrie, A. M M Eijsbouts, F. H J van den Hoogen, P. L C M van Riel, and T. R D J Radstake Circulating levels of the chemokine CCL18 but not CXCL16 are elevated and correlate with disease activity in rheumatoid arthritis Ann Rheum Dis, October 1, 2007; 66(10): 1334 - 1338. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Tohyama, K. Sayama, H. Komatsuzawa, Y. Hanakawa, Y. Shirakata, X. Dai, L. Yang, S. Tokumaru, H. Nagai, S. Hirakawa, et al. CXCL16 is a novel mediator of the innate immunity of epidermal keratinocytes Int. Immunol., September 1, 2007; 19(9): 1095 - 1102. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Gursel, I. Gursel, H. S. Mostowski, and D. M. Klinman CXCL16 Influences the Nature and Specificity of CpG-Induced Immune Activation J. Immunol., August 1, 2006; 177(3): 1575 - 1580. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
