Journal of Leukocyte Biology eBioscience full spectrum cell analysis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0504284 on December 9, 2004

Published online before print December 9, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0504284v1
77/3/414    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, X.
Right arrow Articles by Cathcart, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, X.
Right arrow Articles by Cathcart, M. K.
(Journal of Leukocyte Biology. 2005;77:414-420.)
© 2005 by Society for Leukocyte Biology

Protein kinase C{delta} regulates p67phox phosphorylation in human monocytes

Xiaoxian Zhao*, Bo Xu*, Ashish Bhattacharjee*, Claudine M. Oldfield*, Frans B. Wientjes{dagger}, Gerald M. Feldman{ddagger} and Martha K. Cathcart*,1

* Department of Cell Biology, Lerner Research Institute, Cleveland Clinic Foundation, Ohio;
{dagger} Department of Medicine, University College London, United Kingdom; and
{ddagger} Division of Monoclonal Antibodies, Office of Therapeutics, Research and Review, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland

1 Correspondence: Department of Cell Biology, Lerner Research Institute, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195. E-mail: cathcam{at}ccf.org


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Phosphorylation of the reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase components p67phox and p47phox accompanies the assembly and activation of this enzyme complex. We have previously reported that activation of human monocytes with opsonized zymosan (ZOP), a potent stimulator of NADPH oxidase activity, results in the phosphorylation of p67phox and p47phox. In this study, we investigated the regulation of p67phox phosphorylation. Although protein kinase C (PKC){alpha} has previously been shown to regulate NADPH oxidase activity, we found that inhibition of PKC{alpha} had no effect on p67phox phosphorylation. Our studies demonstrate that pretreatment of monocytes with antisense oligodeoxyribonucleotides specific for PKC{delta} or rottlerin, a selective inhibitor for PKC{delta}, inhibited the phosphorylation of p67phox in monocytes, and Go6976, a specific inhibitor for conventional PKCs, PKC{alpha} and PKCß, had no such inhibitory effect. Additional studies indicate that ZOP stimulation of monocytes induces PKC{delta} and p67phox to form a complex. We also demonstrate that lysates from activated monocytes as well as PKC{delta} immunoprecipitates from activated monocytes can phosphorylate p67phox in vitro and that pretreatment of monocytes with rottlerin blocked the phosphorylation in each case. We further show that recombinant PKC{delta} can phosphorylate p67phox in vitro. Finally, we show that PKC{delta}-deficient monocytes produce significantly less superoxide anion in response to ZOP stimulation, thus emphasizing the functional significance of the PKC{delta} regulation of p67phox phosphorylation. Taken together, this is the first report to describe the requirement of PKC{delta} in regulating the phosphorylation of p67phox and the related NADPH oxidase activity in primary human monocytes.

Key Words: PKC{delta} • NADPH oxidase • superoxide anion • inflammation


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase is a multicomponent enzyme, which catalyzes the production of superoxide anion by phagocytes. Our understanding of the function of this enzyme complex is mostly derived from studies of neutrophils from patients lacking NADPH oxidase activity, a syndrome called chronic granulomatous disease [1 2 3 ]. Phagocytes use the superoxide anion, generated by this enzyme, to kill invading microorganisms. Unregulated formation of superoxide anion could cause damage to nearby tissues; therefore, its production is tightly regulated. Neutrophils and monocytes are among the predominant phagocytic cells. One pathogenic process mediated by monocytes is the oxidation of low-density lipoprotein (LDL) by a superoxide anion and NADPH oxidase-dependent process [4 , 5 ]. Oxidized LDL is believed to contribute to the pathogenesis of atherosclerosis [6 , 7 ]. Thus, the regulation of monocyte NADPH oxidase plays a role in controlling this potentially pathogenic process.

Components of NADPH oxidase include the cytosolic p67phox, p47phox, p40phox, and a small guanosine 5'-triphosphate-binding protein Rac, in addition to a transmembrane flavocytochrome b558. A number of studies have demonstrated that the activation of NADPH oxidase involves the phosphorylation of p67phox and p47phox [2 , 8 ]; however, the phosphorylation-dependent mechanisms, particularly the upstream signals and kinases governing the phosphorylation and formation of the activated NADPH oxidase complex, remain to be identified. Protein kinase C (PKC)-dependent and -independent pathways have been reported to regulate the phosphorylation of p67phox in human neutrophils by using activators and inhibitors of PKC [9 ]. In vitro studies indicated that recombinant p67phox could be phosphorylated by a p21cdc42Hs/Rac-activated kinase [10 ]; however, the relevant kinase(s) responsible for controlling the phosphorylation status of p67phox in intact neutrophils and monocytes have not been identified.

Our previous studies showed that human monocytes, like many other cell types, express several PKC isoforms from all three classes of PKC ({alpha}, ßI, ßII, {delta}, {varepsilon}, {zeta}). We have reported that PKC{alpha} expression and activity are required for NADPH oxidase activity in opsonized zymosan (ZOP)-activated human monocytes [11 ]. Recently, we reported that phosphorylation of p67phox is induced in ZOP-activated human monocytes [12 ]. In this study, we investigate the role of PKC{delta} in regulating the phosphorylation of p67phox in ZOP-activated human monocytes.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Materials
Rottlerin, Go6976, sodium okadate, sodium vanadate, and histone H1 were obtained from Calbiochem (San Diego, CA). Zymosan, which was from ICN Biochemicals (Cleveland, OH), was opsonized [13 ] and used at a concentration of 2 mg/ml. Protease inhibitor cocktail, phosphatase inhibitor cocktail, protein A sepharose, and lysozyme were obtained from Sigma Chemical Co. (St. Louis, MO). [32P]-Orthophosphate was from PerkinElmer Life Science (Boston, MA). Goat polyclonal antibodies specific for p67phox and rabbit polyclonal antibodies specific for PKC{delta} were from Santa Cruz Biotechnology (CA). Rabbit polyclonal antibodies for p67phox were described previously [14 ]. Monoclonal antibodies (mAb) for p67phox were from BD Transduction Laboratories (San Jose, CA). Donkey anti-rabbit and anti-mouse, preabsorbed secondary antibodies were from Affinity Bioreagents Inc. (Golden, CO). Recombinant PKC{delta} and its substrate peptide were from Upstate Biotechnology (Lake Placid, NY). MicroSpinTM glutathione S-transferase (GST) purification modules were from Amersham Biosciences (Piscataway, NJ).

Isolation of human monocytes
The process for human monocyte isolation and [32P]-orthophosphate radiolabeling for phosphorylation studies was described previously [12 ]. Briefly, monocytes were isolated and purified by centrifugation of heparinized whole blood over a Ficoll-Paque density solution, platelets were removed by several washes through serum, and mononuclear cells were incubated in serum-coated, cell-culture flasks for 2–4 h. Adherent monocytes were released with 5 mM EDTA and rested for 2 h in Dulbecco’s modified Eagle’s medium with 10% bovine calf serum before use in experiments. In some of the experiments, monocytes were isolated from human peripheral blood using the countercurrent centrifugal elutriation method [15 , 16 ]. Monocyte preparations purified by this procedure are consistently >95% CD14+. We obtained similar results using monocytes isolated by these two different protocols.

Treatment of monocytes with antisense oligodeoxyribonucleotides (AS-ODN) or inhibitors, labeling with 32P-orthophosphate, and monocyte activation with ZOP
An equimolar mixture of two PKC{delta} AS-ODN was used to inhibit PKC{delta} protein expression as previously published [17 ]. The PKC{delta} AS-ODN sequences were 5'GAAGGCGATGCGCAGGAA3' and 5'AGGAACGGCGCCATGGTGGG3'. Controls were the complementary PKC{delta} sense ODN (S-ODN) sequences. The former AS-ODN sequence was selected based on prior literature [18 ], and the latter was designed using our recently described protocol for identifying optimal mRNA regions for AS-ODN binding [19 ]. The AS-ODN did not inhibit the expression of PKC{alpha} (data not shown). Freshly isolated human monocytes were treated with ODN (5 µM each, totaling 10 µM) for 72 h with a re-feed once at 48 h. Cells were then labeled with [32P]-orthophosphate (100 µCi/ml) for 4 h before adding ZOP to the cell culture. For treatment of cells with PKC inhibitors, the final concentrations of rottlerin and Go6976 were 5 µM and 10 nM, respectively. Monocytes were labeled with [32P]-orthophosphate and pretreated with the drugs for 30 min before ZOP activation of cells for 1 h.

Preparation of cellular lysates and immunoprecipitation/Western blotting analysis
The protocol for preparation of cellular lysates, with lysis buffers including numerous phosphatase and protease inhibitors, was described previously [12 ], except the centrifugation after cell lysis was at 500 g for 5 min at 4°C. For immunoprecipitation/Western blotting experiments, lysates from untreated or ZOP-treated monocytes were immunoprecipitated with antibodies specific for PKC{delta} or p67phox and Western blotted with antibodies against p67phox or PKC{delta}, respectively. The polyvinylidene difluoride (PVDF) membranes were then reprobed with PKC{delta} or p67phox, respectively.

Preparation and purification of GST-p67phox
Plasmids, which harbor cDNA for GST or GST-p67phox, were described previously [20 ]. Fusion protein production was induced with isopropylthiogalactoside (0.5 mM) at 22°C. Collected bacteria were washed and resuspended in ice-cold phosphate-buffered saline containing protease inhibitors (500 µM phenylmethylsulfonyl fluoride and 1:100 dilution of the protease inhibitor cocktail). Cells were then treated with lysozyme in the presence of DNaseI (Amersham Biosciences) followed by five cycles of freezing/thawing. After removing cell debris by centrifugation, GST-p67phox or GST was purified using a MicroSpinTM GST purification module. Purified proteins were checked for purity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

PKC{delta} kinase assay
The immune complex PKC{delta} kinase assay was performed as described previously [17 , 21 22 23 24 ]. Histone H1 (10 µg) or GST-p67phox (5 µg) was used as a substrate. The phosphorylated forms of histone H1 or p67phox were detected by analysis using a phosphorimager. The blots were also subjected to Western blot analysis to examine the amounts of PKC{delta} in the immunecomplex.

In vitro phosphorylation of recombinant GST-p67phox by PKC{delta}
The GST-p67phox fusion protein or GST alone (20 pmoles) was phosphorylated with 2 pmoles recombinant human PKC{delta} protein in a 20-µl final reaction volume containing 20 mM Tris, pH 7.5, 0.5 mM EDTA, 0.5 mM EGTA, 400 µM MgCl2, 10 µM CaCl2, lipid activator (consisting of 10 µM phorbol 12-myristate 13-acetate and 0.28 mg/ml phosphatidylserine in a 0.3% Triton X-100 mixed micelle suspension), 1 µM adenosine 5'-triphospahte (ATP), 0.00025% Triton X-100, 1:100 protease inhibitor cocktail, 1:10 phosphatase inhibitors, and 1 µCi [{gamma}32P]-ATP for 30 min at 37°C. The kinase reaction was stopped by adding 5x sample buffer and boiling for 5 min. Controls using no substrate or 20 pmoles PKC{varepsilon} substrate peptide (ERMRPRKRQGSVRRRV) were treated similarly. The phosphorylation signals of in vitro reactions were assessed by phosphorimage analysis.

Superoxide anion assay
The amount of superoxide anion produced by human monocytes was measured by the cytochrome c reduction assay [25 ]. Triplicate samples of cells were plated at a concentration of 1 x 106/ml and allowed to adhere for 2 h before the addition of ODN. Cells were then treated with 5 µM each of two different PKC{delta} AS- or S-ODN for 48 h (with a re-feed at 24 h) or 72 h (with a re-feed at 48 h). Thus, the final ODN concentration was 10 µM. The AS-ODN were prescreened for effective inhibition of PKC{delta} expression. The media was changed to phenol red-free RPMI 1640 before the addition of cytochrome c (160 µM) with or without 300 µM superoxide dismutase and 2 mg/ml ZOP. The plate was incubated at 37°C for 1 h before collecting the supernatant, which was spun for 5 min at 1200 rpm to pellet the ZOP. The absorbance was read at 550 nm, and the nanomoles of superoxide anion produced were calculated for each group.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
ZOP-induced phosphorylation of p67phox is linked to PKC{delta} activation in human monocytes
Activation of human monocytes with ZOP induces multiple phosphorylation events. The phosphorimage in Figure 1A is a typical result, indicating that ZOP stimulates significant phosphorylation of p67phox. The mean increase was three- to fourfold as compared with untreated cells (P<0.05). This result suggests that ZOP induces the activation of the protein kinase(s) responsible for p67phox phosphorylation. We have previously reported that PKC{alpha} activity and expression are required for NADPH oxidase activity [11 , 26 ]. When we examined the effects of Go6976, an inhibitor of the cPKC class of PKC isoenzymes including PKC{alpha} and PKCß, on ZOP-induced p67phox phosphorylation, we observed no inhibition (Fig. 1B) . PKC{delta} is a member of another class of PKC isoenzymes. We also investigated whether rottlerin, a selective PKC{delta} inhibitor, affected p67phox phosphorylation. In monocytes pretreated with rottlerin, ZOP-induced phosphorylation of p67phox was inhibited by greater than 60%, and Go6976 had no inhibitory effect. We then examined the degree of PKC{delta} activation in ZOP-activated monocytes and found that ZOP dramatically stimulated PKC{delta} activity by ~24-fold (Fig. 1C) , which occurs at the same time as p67phox phosphorylation. As the expression levels of p67phox and PKC{delta} do not change upon monocyte activation, the immunoprecipitation results in Fig. 3A serve as immunoprecipitation controls for Figure 1A . (See Fig. 3B , which serves as an immunoprecipitation control for Fig. 1C ). Additionally, we detected no PKC{alpha} in the PKC{delta} immunoprecipitates (data not shown). Therefore, these data suggest that PKC{delta} may regulate p67phox phosphorylation in ZOP-activated monocytes.



View larger version (31K):
[in this window]
[in a new window]
  		Figure 1. p67phox phosphorylation is induced upon ZOP activation of human monocytes. (A) Cell lysates derived from 5 million untreated or ZOP-activated monocytes prelabeled with [32P]-orthophosphate were immunoprecipitated with goat polyclonal antibody for p67phox. The immunecomplexes were then subjected to SDS-PAGE. The top panel shows a representative result of the phosphorimage analysis from three experiments. The middle panel is the Western blot using p67phox antibodies to probe the same membrane to confirm that equal amounts of p67phox are present in the immunecomplexes. The bottom panel represents the normalized, relative fold induction of p67phox phosphorylation based on phosphorimage analysis and Western blotting results (mean±SEM, n=3). (B) Monocytes (5x106/well) were radiolabeled with [32P]-orthophosphate and pretreated with Go6976 or rottlerin for 30 min before ZOP activation of cells for 1 h. p67phox immunoprecipitates were separated by SDS-PAGE followed by transfer to PVDF and phosphorimage analysis. The top panel is a representative phosphorimage result from three similar experiments. The middle and bottom panels show the results of a reprobe of the membrane with p67phox antibodies and the normalized, relative fold induction of p67phox phosphorylation (mean±SEM, n=3). (C) Histone H1 was phosphorylated in vitro by PKC{delta} immunecomplexes derived from untreated or 1 h ZOP-activated monocyte lysates as described in Materials and Methods. The upper panel shows a representative phosphorimage result, and the lower panel is the corresponding Western blot using PKC{delta} antibodies with the same membrane. These data are representative of four experiments giving similar results.

 


View larger version (30K):
[in this window]
[in a new window]
  		Figure 3. p67phox associates with PKC{delta} in ZOP-treated human monocytes. Cell lysates from untreated or 1 h ZOP-treated monocytes were immunoprecipitated (IP) with rabbit polyclonal antibodies against PKC{delta} (A) or goat polyclonal antibodies for p67phox (B). Immunecomplexes were subjected to 8% SDS-PAGE and then transferred to PVDF membranes. PKC{delta} immunecomplexes were first immunoblotted with rabbit polyclonal antibodies for p67phox and then reprobed with rabbit polyclonal PKC{delta} antibodies (lower panel, A). p67phox immunecomplexes were first immunoblotted with rabbit polyclonal antibodies for PKC{delta} and then reprobed with mAb for p67phox (lower panel). Preabsorbed, secondary antibodies were used for experiments shown in B. IgG, Immunoglobulin G; WB, Western blot.

 
ZOP-induced phosphorylation of p67phox was blocked by pretreatment of monocytes with AS-ODN specific to PKC{delta}
To further investigate whether PKC{delta} was involved in ZOP-induced p67phox phosphorylation in human monocytes, we used AS-ODN to inhibit PKC{delta} expression and then evaluated p67phox phosphorylation. The effect of PKC{delta} AS-ODN on the expression of PKC{delta} protein levels is shown in Figure 2A (upper panel). Treatment with PKC{delta} AS-ODN selectively inhibited PKC{delta} protein expression without inhibiting the expression of ß-tubulin (lower panel). When normalized for sample loading, as determined by the ß-tubulin blots, the AS-ODN caused ~22% and 52% inhibition of PKC{delta} protein expression at 5 and 10 µM, respectively (P<0.01). Treatment with PKC{delta} S-ODN had no inhibitory effect on PKC{delta} expression (upper panel). Other experiments showed that PKC{alpha} expression was not inhibited by treatment with PKC{delta} AS-ODN (data not shown).



View larger version (22K):
[in this window]
[in a new window]
  		Figure 2. PKC{delta} regulates the ZOP-induced phosphorylation of p67phox in human monocytes. (A) PKC{delta} AS-ODN inhibits PKC{delta} protein expression. Monocytes (5x106/well) were treated with PKC{delta} AS- or S-ODN for 72 h as described in Materials and Methods. The cells were then lysed, and 20 µg lysate was loaded/lane on 8% SDS-PAGE gels and analyzed by Western blot analysis. PKC{delta} protein was detected using a rabbit polyclonal PKC{delta} antibody. The same blot was then stripped and reprobed with ß-tubulin antibody to assess equal loading. (B) Freshly isolated human monocytes were treated with or without AS- or S-ODN specific for PKC{delta} (10 µM) and then labeled with [32P]-orthophosphate for 4 h, followed by activation of the cells with ZOP for 1 h. Phosphorylation of p67phox in each sample was analyzed as described in Figure 1A . The top panel shows a representative result of the phosphorimage analysis of p67phox. The middle panel displays the immunoblot using rabbit polyclonal p67phox antibodies on the same membrane. The normalized, average fold increase in phosphorylation from two similar experiments is shown in the bottom panel. The data represent the mean ± data range from two identical experiments.

 
Next, we investigated the effect of ODN treatment on p67phox phosphorylation. For these studies, we pretreated monocytes with AS-ODN specific for PKC{delta} and then radiolabeled the monocytes with [32P]-orthophosphate. p67 phox was immunoprecipitated, and phosphorylated p67phox was then detected. Figure 2B (top panel) shows the result of phosphorimage analysis with each indicated condition. Figure 2B (middle panel) shows the Western blot of the same membrane using p67phox-specific antibodies to assess the loading amount of each sample. The normalized, average fold increases in phosphorylation from two similar experiments are graphed in Figure 2B (bottom panel). These data indicate that pretreatment of monocytes with AS-ODN specific for PKC{delta} inhibited ZOP-induced p67phox phosphorylation by ~60%, and S-ODN for PKC{delta} had little effect. Taken together with the results presented in Figure 1B , these results suggest that PKC{delta} regulates the phosphorylation of p67phox in ZOP-activated human monocytes, and conventional PKC isoforms do not appear to contribute to this phosphorylation event.

Association of p67phox and PKC{delta} in ZOP-activated human monocytes
As PKC{delta} is involved in regulating the phosphorylation of p67phox in ZOP-activated monocytes, we then asked whether p67phox and PKC{delta} were present in a complex. We performed immunoprecipitation/Western-blotting experiments to address this question. We found that the immunecomplexes, derived from precipitation with antibodies specific for PKC{delta}, contained p67phox only in the ZOP-treated monocyte lysates (Fig. 3A ). The lower panel of Figure 3A is the reprobe result from the same membrane with PKC{delta}-specific antibodies to confirm the quality of the immunoprecipitation. In the reverse experiment, PKC{delta} was detected in immunecomplexes that were precipitated using p67phox-specific antibodies for the immunoprecipitation of ZOP-activated monocyte lysates, and PKC{delta} was not detected in a similar immunoprecipitate from inactivated cell lysates (Fig. 3B) . The lower panel of Figure 3B shows the results from a reprobe of the same membrane with p67phox-specific antibodies. These data demonstrate that monocyte activation induces the association of PKC{delta} and p67phox in the same complex.

PKC{delta} phosphorylates p67phox in vitro
The association of PKC{delta} with p67phox (Fig. 3) and the involvement of PKC{delta} in regulating the phosphorylation of p67phox (Fig. 2) in ZOP-activated human monocyte prompted us to examine whether PKC{delta} could directly phosphorylate p67phox in vitro. We used purified recombinant GST-p67phox for this study, as digestion of GST-p67phox to remove GST caused degradation of p67phox. First, we used monocyte lysates to check whether they could phosphorylate GST-p67phox or GST in vitro. Figure 4A shows that lysates of ZOP-activated monocytes cause the phosphorylation of GST-p67phox. The phosphorimage signal of GST-p67phox, when using lysates from ZOP-activated monocytes, was ~2.5-fold higher than that obtained with unactivated monocyte lysates. There is no detectable signal from the GST control. We next prepared cell lysates from monocytes pretreated with rottlerin or Go6976. We found that similar to results with intact cells as shown in Figure 1 , pretreatment of monocytes with rottlerin blocked the in vitro, ZOP-activated, lysate-mediated phosphorylation of GST-p67phox by over 50% (P<0.05 for rottlerin vs. ZOP), and Go6976 had no inhibitory effect (Fig. 4B) . We also used recombinant PKC{delta} in this in vitro study. As shown in Figure 4C , in addition to the autophosphorylation of PKC{delta} under these reaction conditions, recombinant PKC{delta} phosphorylated its standard substrate peptide (left panel). Recombinant PKC{delta} also phosphorylated GST-p67phox, whereas there is no detectable phosphorylation signal from GST alone (right panel). Finally, we immunoprecipitated PKC{delta} from ZOP-activated monocytes and examined whether cell-derived PKC{delta} could mediate p67phox phosphorylation (Fig. 4D) . PKC{delta} from ZOP-activated monocytes phosphorylated GST-p67phox to a greater level than that from unactivated monocytes (mean=2.41±0.53, P<0.05). Although this blot shows the lowest level of ZOP-induced activation observed in three experiments (1.5-fold), it was the most evenly loaded and was chosen for presentation. PKC{delta} from monocytes, treated with rottlerin prior to ZOP activation, phosphorylated GST-p67phox to a lesser extent (mean=62% inhibition as compared with that mediated by PKC{delta} from activated monocytes). Taken together, these data demonstrate that p67phox can serve as a substrate for PKC{delta} in vitro.



View larger version (57K):
[in this window]
[in a new window]
  		Figure 4. Activated monocyte lysates, recombinant PKC{delta}, and immunoprecipitated PKC{delta} phosphorylate GST-p67phox in vitro. (A and B) Monocyte lysates were used for in vitro phosphorylation of GST-p67phox. The phosphorylation signals were detected by phosphorimage analysis as described in Materials and Methods. The solid arrowheads indicate the position of phosphorylated GST-p67phox (93 kDa), and open arrowheads indicate the position of the GST control. The results are representative of three experiments. (B) Monocytes were untreated or pretreated with rottlerin or Go6976 prior to preparing the monocyte lysates. (C) Recombinant PKC{delta} was used to phosphorylate GST-p67phox. In vitro phosphorylation of purified GST-p67phox, GST, or PKC{delta} substrate peptide was performed as described in Materials and Methods and detected by phosphorimage analysis. The positions for phosphorylated GST-p67phox, GST, autophosphorylated PKC{delta}, and phospho-PKC{delta} substrate peptide are indicated. The same molarity of GST was used as a control in A and C. The results are representative of three experiments. (D) Immunoprecipitated (IP) PKC{delta} was used to phosphorylate GST-p67phox. Monocytes were pretreated with or without rottlerin for 30 min and then activated with ZOP (1 h). PKC{delta} was then immunoprecipitated from cell lysates and used for in vitro phosphorylation of GST-p67phox as described in Materials and Methods. The upper panel is the result of phosphorimage analysis, and the lower panel is the Western blot using PKC{delta} antibodies to probe the same membrane to confirm an equal amount of PKC{delta} in the immunecomplexes. The blot is from one of several similar experiments (see Results).

 
PKC{delta} regulates superoxide anion production by human monocytes
Our results suggest that PKC{delta} regulates the phosphorylation of p67phox in human monocytes. To further evaluate whether PKC{delta} influences NADPH oxidase activity, we measured superoxide anion production with monocytes pretreated with PKC{delta} AS- or S-ODN. As shown in Figure 5 , the ZOP-triggered production of superoxide anion was significantly reduced by 50% by 10 µM PKC{delta} AS-ODN treatment as compared with the untreated or sense-treated controls (n=4, P<0.004, and P<0.007, respectively), and S-ODN had little effect. This level of inhibition by AS-ODN treatment is consistent with that observed with rottlerin.



View larger version (19K):
[in this window]
[in a new window]
  		Figure 5. PKC{delta} antisense inhibits NADPH oxidase activity. Human monocytes at a concentration of 1 x 106/ml were treated with 10 µM PKC{delta} AS- or S-ODN for 48 (n=2) or 72 h (n=2) as described in Materials and Methods. PKC{delta} was inhibited by ODN treatment at both time-points [24 ]. After stimulation with ZOP for 1 h, the nanomoles of superoxide anion (O2–) were measured using the cytochrome c reduction assay. Data are presented as the mean ± SEM of the compiled data from four separate experiments.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, our data clearly demonstrate that PKC{delta} is activated in ZOP-treated human monocytes and regulates the phosphorylation of p67phox. PKC{delta} and p67phox form a complex with each other in ZOP-activated monocytes. The down-regulation of PKC{delta} protein expression by AS-ODN specific to PKC{delta} or by pretreatment of monocytes with rottlerin, a selective inhibitor for PKC{delta}, inhibited ZOP-induced phosphorylation of p67phox. The AS-ODN experiments are important, as rottlerin, although a selective PKC{delta} inhibitor, has also been shown to inhibit several other kinases [17 , 24 , 27 , 28 ]. AS-ODN, specific for PKC{delta}, also inhibited ZOP-induced superoxide anion production. Together, these data support the concept that PKC{delta} expression and activity regulate p67phox phosphorylation in ZOP-activated monocytes and suggest that PKC{delta} may be the immediate upstream kinase for p67phox. Although PKC{alpha} expression and activity are required in ZOP-induced superoxide anion production of human monocytes [11 ], we found that conventional PKC isoforms did not contribute to p67phox phosphorylation. To our knowledge, this is the first report to address the role of specific PKC isoforms in the regulation and phosphorylation of p67phox in primary human monocytes.

There are limited studies related to the specific kinase(s) responsible for p67phox phosphorylation. Apart from PKCs, other kinases implicated in the activation of the NADPH oxidase include mitogen-activated protein kinases, p21-activated kinase, phosphatidylinositol-3 kinase, and several undefined kinases [29 30 31 32 33 ], suggesting that complex and diverse signaling pathways are involved in the regulation of NADPH oxidase. Although our data indicate that PKC{delta} regulates p67phox phosphorylation in ZOP-activated human monocytes, it does not exclude the possibility that other kinases may also regulate this phosphorylation event. However, it is clear that PKC{delta} plays an important role in the regulation of the phosphorylation events required for NADPH oxidase activation in human monocytes.

Two reports have analyzed the phosphorylation site(s) of p67phox in human neutrophils. One demonstrated that Thr233 is the major phosphorylation site [34 ], and another showed that p67phox was phosphorylated, solely on serine residues, detecting neither phosphothreonine nor phosphotyrosine [9 ]. No studies have explored the phosphorylation site(s) in human monocytes. Predicted PKC{delta} phosphorylation sites on p67phox, as determined by "Scansite" software, indicate three potential sites. One is Thr279, which is within one Src homology (SH)3 domain (amino acid residues 245–295) of p67phox. The others are Thr203 and Ser213, which are close to the proline-rich region (amino acid residues 224–235) of p67phox. It is documented that multiple SH3 domain interactions with proline-rich targets between components of NADPH oxidase contribute to the formation of the active oxidase complex [35 ]. Although phosphorylation of p67phox appears to be a necessary step for activation of NADPH oxidase, the contribution of this phosphorylation event to the formation of activated NADPH oxidase remains to be determined. Data presented here suggest that PKC{delta} regulates the phosphorylation of p67phox and thereby contributes to NADPH oxidase activity.

In summary, this study demonstrates that PKC{delta} is involved in regulating the phosphorylation of p67phox, whereas conventional PKC isoforms have no detectable effect on this phosphorylation event. Evidence was also presented that PKC{delta} expression is critical for p67phox phosphorylation and superoxide anion production by primary human monocytes. The fact that p67phox and PKC{delta} exist in the same complex in activated monocytes and that monocyte-derived PKC{delta} and recombinant PKC{delta} can phosphorylate p67phox suggests that PKC{delta} may be the immediate upstream kinase causing the phosphorylation of p67phox upon monocyte activation. Future investigations locating the ZOP-induced phosphorylation site(s) on p67phox by mass spectrometry and comparing them to those obtained in vitro with recombinant PKC{delta} will shed light on the direct nature of this regulation of phosphorylation. Evaluating the effects of p67phox phosphorylation on NADPH oxidase component interactions and translocation will also give us a better understanding of the events regulating the assembly and activation of the NADPH oxidase complex.


   ACKNOWLEDGEMENTS
 
These studies were supported by grants from National Institutes of Health HL51068 and HL61971 to M. K. C.

Received May 11, 2004; revised October 27, 2004; accepted October 29, 2004.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Volpp, B. D., Nauseef, W. M., Clark, R. A. (1988) Two cytosolic neutrophil oxidase components absent in autosomal chronic granulomatous disease Science 242,1295-1297[Abstract/Free Full Text]
  2. Segal, A. W., Heyworth, P. G., Cockcroft, S., Barrowman, M. M. (1985) Stimulated neutrophils from patients with autosomal recessive chronic granulomatous disease fail to phosphorylate a Mr-44,000 protein Nature 316,547-549[CrossRef][Medline]
  3. Dusi, S., Rossi, F. (1993) Activation of NADPH oxidase of human neutrophils involves the phosphorylation and the translocation of cytosolic p67phox Biochem. J. 296,367-371
  4. Bey, E. A., Cathcart, M. K. (2000) In vitro knockout of human p47phox blocks superoxide anion production and LDL oxidation by activated human monocytes J. Lipid Res. 41,489-495[Abstract/Free Full Text]
  5. Cathcart, M. K., McNally, A. K., Morel, D. W., d Chisolm, G. M. (1989) Superoxide anion participation in human monocyte-mediated oxidation of low-density lipoprotein and conversion of low-density lipoprotein to a cytotoxin J. Immunol. 142,1963-1969[Abstract]
  6. Steinberg, D. (1997) Low density lipoprotein oxidation and its pathobiological significance J. Biol. Chem. 272,20963-20966[Free Full Text]
  7. Chisolm, G. M., III, Hazen, S. L., Fox, P. L., Cathcart, M. K. (1999) The oxidation of lipoproteins by monocytes-macrophages. Biochemical and biological mechanisms J. Biol. Chem. 274,25959-25962[Free Full Text]
  8. Dusi, S., Della Bianca, V., Grzeskowiak, M., Rossi, F. (1993) Relationship between phosphorylation and translocation to the plasma membrane of p47phox and p67phox and activation of the NADPH oxidase in normal and Ca(2+)-depleted human neutrophils Biochem. J. 290,173-178
  9. Benna, J. E., Dang, P. M., Gaudry, M., Fay, M., Morel, F., Hakim, J., Gougerot-Pocidalo, M. A. (1997) Phosphorylation of the respiratory burst oxidase subunit p67(phox) during human neutrophil activation. Regulation by protein kinase C-dependent and independent pathways J. Biol. Chem. 272,17204-17208[Abstract/Free Full Text]
  10. Ahmed, S., Prigmore, E., Govind, S., Veryard, C., Kozma, R., Wientjes, F. B., Segal, A. W., Lim, L. (1998) Cryptic Rac-binding and p21(Cdc42Hs/Rac)-activated kinase phosphorylation sites of NADPH oxidase component p67(phox) J. Biol. Chem. 273,15693-15701[Abstract/Free Full Text]
  11. Li, Q., Subbulakshmi, V., Fields, A. P., Murray, N. R., Cathcart, M. K. (1999) Protein kinase C{alpha} regulates human monocyte O-2 production and low density lipoprotein lipid oxidation J. Biol. Chem. 274,3764-3771[Abstract/Free Full Text]
  12. Zhao, X., Bey, E. A., Wientjes, F. B., Cathcart, M. K. (2002) Cytosolic phospholipase A2 (cPLA2) regulation of human monocyte NADPH oxidase activity. cPLA2 affects translocation but not phosphorylation of p67(phox) and p47(phox) J. Biol. Chem. 277,25385-25392[Abstract/Free Full Text]
  13. Johnston, R. B. (1981) Methods for Studying Mononuclear Phagocytes ,489-497 Academic New York, NY.
  14. Forbes, L. V., Moss, S. J., Segal, A. W. (1999) Phosphorylation of p67phox in the neutrophil occurs in the cytosol and is independent of p47phox FEBS Lett. 449,225-229[CrossRef][Medline]
  15. Wahl, S. M., Allen, J. B., Dougherty, S., Evequoz, V., Pluznik, D. H., Wilder, R. L., Hand, A. R., Wahl, L. M. (1986) T lymphocyte-dependent evolution of bacterial cell wall-induced hepatic granulomas J. Immunol. 137,2199-2209[Abstract]
  16. Wahl, L. M., Katona, I. M., Wilder, R. L., Winter, C. C., Haraoui, B., Scher, I., Wahl, S. M. (1984) Isolation of human mononuclear cell subsets by counterflow centrifugal elutriation (CCE). I. Characterization of B-lymphocyte-, T-lymphocyte-, and monocyte-enriched fractions by flow cytometric analysis Cell. Immunol. 85,373-383[CrossRef][Medline]
  17. Xu, B., Bhattacharjee, A., Roy, B., Feldman, G. M., Cathcart, M. K. (2004) Role of protein kinase C isoforms in the regulation of interleukin-13-induced 15-lipoxygenase gene expression in human monocytes J. Biol. Chem. 279,15954-15960[Abstract/Free Full Text]
  18. Xu, J., Rockow, S., Kim, S., Xiong, W., Li, W. (1994) Interferons block protein kinase C-dependent but not -independent activation of Raf-1 and mitogen-activated protein kinases and mitogenesis in NIH 3T3 cells Mol. Cell. Biol. 14,8018-8027[Abstract/Free Full Text]
  19. Bey, E. A., Cathcart, M. K. (2002) Antisense oligodeoxyribonucleotides: a better way to inhibit monocyte superoxide anion production? Methods Enzymol. 353,421-434[Medline]
  20. Abo, A., Boyhan, A., West, I., Thrasher, A. J., Segal, A. W. (1992) Reconstitution of neutrophil NADPH oxidase activity in the cell-free system by four components: p67-phox, p47-phox, p21rac1, and cytochrome b-245 J. Biol. Chem. 267,16767-16770[Abstract/Free Full Text]
  21. Uddin, S., Sassano, A., Deb, D. K., Verma, A., Majchrzak, B., Rahman, A., Malik, A. B., Fish, E. N., Platanias, L. C. (2002) Protein kinase C-{delta} (PKC-{delta}) is activated by type I interferons and mediates phosphorylation of Stat1 on serine 727 J. Biol. Chem. 277,14408-14416[Abstract/Free Full Text]
  22. Rahman, A., Anwar, K. N., Uddin, S., Xu, N., Ye, R. D., Platanias, L. C., Malik, A. B. (2001) Protein kinase C-{delta} regulates thrombin-induced ICAM-1 gene expression in endothelial cells via activation of p38 mitogen-activated protein kinase Mol. Cell. Biol. 21,5554-5565[Abstract/Free Full Text]
  23. Jain, N., Zhang, T., Kee, W. H., Li, W., Cao, X. (1999) Protein kinase C {delta} associates with and phosphorylates Stat3 in an interleukin-6-dependent manner J. Biol. Chem. 274,24392-24400[Abstract/Free Full Text]
  24. Bey, E. A., Xu, B., Bhattacharjee, A., Oldfield, C. M., Zhao, X., Li, Q., Subbulakshmi, V., Feldman, G. M., Wientjes, F. B., Cathcart, M. K. (2004) Protein kinase C{{delta}} is required for p47phox phosphorylation and translocation in activated human monocytes J. Immunol. 173,5730-5738[Abstract/Free Full Text]
  25. Pick, E., Mizel, D. (1981) Rapid microassays for the measurement of superoxide and hydrogen peroxide production by macrophages in culture using an automatic enzyme immunoassay reader J. Immunol. Methods 46,211-226[CrossRef][Medline]
  26. Li, Q., Cathcart, M. K. (1994) Protein kinase C activity is required for lipid oxidation of low density lipoprotein by activated human monocytes J. Biol. Chem. 269,17508-17515[Abstract/Free Full Text]
  27. Davies, S. P., Reddy, H., Caivano, M., Cohen, P. (2000) Specificity and mechanism of action of some commonly used protein kinase inhibitors Biochem. J. 351,95-105[CrossRef][Medline]
  28. Gschwendt, M., Muller, H. J., Kielbassa, K., Zang, R., Kittstein, W., Rincke, G., Marks, F. (1994) Rottlerin, a novel protein kinase inhibitor Biochem. Biophys. Res. Commun. 199,93-98[CrossRef][Medline]
  29. El Benna, J., Han, J., Park, J. W., Schmid, E., Ulevitch, R. J., Babior, B. M. (1996) Activation of p38 in stimulated human neutrophils: phosphorylation of the oxidase component p47phox by p38 and ERK but not by JNK Arch. Biochem. Biophys. 334,395-400[CrossRef][Medline]
  30. Knaus, U. G., Morris, S., Dong, H. J., Chernoff, J., Bokoch, G. M. (1995) Regulation of human leukocyte p21-activated kinases through G protein-coupled receptors Science 269,221-223[Abstract/Free Full Text]
  31. Sly, L. M., Lopez, M., Nauseef, W. M., Reiner, N. E. (2001) 1{alpha},25-Dihydroxyvitamin D3-induced monocyte antimycobacterial activity is regulated by phosphatidylinositol 3-kinase and mediated by the NADPH-dependent phagocyte oxidase J. Biol. Chem. 276,35482-35493[Abstract/Free Full Text]
  32. Lal, A. S., Parker, P. J., Segal, A. W. (1999) Characterization and partial purification of a novel neutrophil membrane-associated kinase capable of phosphorylating the respiratory burst component p47phox Biochem. J. 338,359-366
  33. McPhail, L. C., Qualliotine-Mann, D., Waite, K. A. (1995) Cell-free activation of neutrophil NADPH oxidase by a phosphatidic acid-regulated protein kinase Proc. Natl. Acad. Sci. USA 92,7931-7935[Abstract/Free Full Text]
  34. Forbes, L. V., Truong, O., Wientjes, F. B., Moss, S. J., Segal, A. W. (1999) The major phosphorylation site of the NADPH oxidase component p67phox is Thr233 Biochem. J. 338,99-105
  35. Babior, B. M. (1999) NADPH oxidase: an update Blood 93,1464-1476[Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
N. J. D. McLaughlin, A. Banerjee, S. Y. Khan, J. L. Lieber, M. R. Kelher, F. Gamboni-Robertson, F. R. Sheppard, E. E. Moore, G. W. Mierau, D. J. Elzi, et al.
Platelet-Activating Factor-Mediated Endosome Formation Causes Membrane Translocation of p67phox and p40phox That Requires Recruitment and Activation of p38 MAPK, Rab5a, and Phosphatidylinositol 3-Kinase in Human Neutrophils
J. Immunol., June 15, 2008; 180(12): 8192 - 8203.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. Schwegmann, R. Guler, A. J. Cutler, B. Arendse, W. G. C. Horsnell, A. Flemming, A. H. Kottmann, G. Ryan, W. Hide, M. Leitges, et al.
Protein kinase C {delta} is essential for optimal macrophage-mediated phagosomal containment of Listeria monocytogenes
PNAS, October 9, 2007; 104(41): 16251 - 16256.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
L. T. Huang, C. J. Paredes, E. T. Papoutsakis, and W. M. Miller
Gene expression analysis illuminates the transcriptional programs underlying the functional activity of ex vivo-expanded granulocytes
Physiol Genomics, September 11, 2007; 31(1): 114 - 125.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
K. Bedard and K.-H. Krause
The NOX Family of ROS-Generating NADPH Oxidases: Physiology and Pathophysiology
Physiol Rev, January 1, 2007; 87(1): 245 - 313.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
I. Kuwahara, E. P. Lillehoj, W. Lu, I. S. Singh, Y. Isohama, T. Miyata, and K. C. Kim
Neutrophil elastase induces IL-8 gene transcription and protein release through p38/NF-{kappa}B activation via EGFR transactivation in a lung epithelial cell line
Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L407 - L416.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
V. Thakur, M. T. Pritchard, M. R. McMullen, Q. Wang, and L. E. Nagy
Chronic ethanol feeding increases activation of NADPH oxidase by lipopolysaccharide in rat Kupffer cells: role of increased reactive oxygen in LPS-stimulated ERK1/2 activation and TNF-{alpha} production
J. Leukoc. Biol., June 1, 2006; 79(6): 1348 - 1356.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
M. Oda, S. Ikari, T. Matsuno, Y. Morimune, M. Nagahama, and J. Sakurai
Signal Transduction Mechanism Involved in Clostridium perfringens Alpha-Toxin-Induced Superoxide Anion Generation in Rabbit Neutrophils.
Infect. Immun., May 1, 2006; 74(5): 2876 - 2886.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0504284v1
77/3/414    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, X.
Right arrow Articles by Cathcart, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, X.
Right arrow Articles by Cathcart, M. K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS