Published online before print November 11, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* Department of Pathology, Interdepartmental Immunobiology Center, Institute of Neuroscience, Robert H. Lurie Comprehensive Cancer Center, Feinberg School of Medicine, Northwestern University, Chicago, Illinois; and
Department of Neuroscience, Cleveland Clinic and Foundation, Ohio
1 Correspondence: Department of Pathology, Northwestern University, 303 E. Chicago Ave., W127, Chicago, IL 60611. E-mail: w-karpus{at}northwestern.edu
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Overexpression of CCL2 in the CNS resulted in decreased interleukin-12 receptor expression by antigen-specific T cells. Collectively, these results indicate that sustained, tissue-specific expression of CCL2 in vivo down-regulates the Th1 autoimmune response, culminating in milder clinical disease.
Key Words: chemokines • EAE • multiple sclerosis • MCP-1 • IL-12R
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Chemokines are pleiotropic and mediate functions beyond chemotaxis [11 ], including hematopoiesis [12 ], T cell activation [13 ] and T cell costimulation [14 ], and cytokine production [15 16 17 ]. These in vitro results were confirmed by studies of gene-targeted chemokine- and chemokine receptor-deficient mice, which demonstrated alterations in hematopoiesis [18 , 19 ], T cell activation, and cytokine production [20 21 22 ].
Murine CC chemokine ligand 2 [CCL2; monocyte chemotactic protein-1 (MCP-1)] was first described as a chemoattractant factor for monocytes [23 , 24 ], which functioned through activation of its receptor CCR2 [21 ]. CCL2 is expressed in the central nervous system (CNS) during evolution of the T cell-mediated disease, experimental autoimmune encephalomyelitis (EAE; reviewed in ref. [25 ]), and is biologically important for the relapsing phase of that disorder [26 ]. We and others demonstrated that CCL2 can regulate T helper cell type 2 (Th2) commitment [16 ] and interleukin (IL)-4 expression [17 ] as well as the down-regulation of IL-12 [27 ]. It might therefore be anticipated that overexpression of CCL2 could result in milder EAE through induction of Th2-polarized responses or inhibition of the initiation of a Th1 response to myelin antigens. It has been indicated that the major CCL2 receptor was essential for generating a Th1-biased, pathological inflammatory reaction, as mice that lacked CCR2 were resistant to EAE [28 , 29 ], and CCR2 knockout mice are also unable to resolve intracellular infection by Leishmania [30 ].
To assess the function of CCL2 as a regulator of organ-specific T cell function and cytokine expression during EAE, we used a transgenic model that constitutively expressed low concentrations of CCL2 in the CNS [31 ]. Overexpression of CCL2 in the CNS has been reported previously [32 ] to result in accumulation of monocytes in the CNS of a naïve mouse. In the current report, we describe the clinical and histological EAE phenotype of CCL2 transgenic mice.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Induction of EAE
Proteolipid protein amino acid sequence 139–151 (PLP139–151; HSLGKWLGHPDKF) was purchased from Peptides International (Louisville, KY). The amino acid composition was verified by mass spectrometry, and purity (>98%) was assessed by high-pressure liquid chromatography. For active disease, individual CCL2 transgenic and control mice were immunized subcutaneously with 100 µg PLP139–151, emulsified in complete Freund’s adjuvant (CFA), containing 4 mg/ml Mycobacterium tuberculosis (Difco, Detroit, MI). For adoptive transfer of disease, SWRXSJL.thy1a mice were immunized with 50 µg PLP139–151, emulsified in CFA containing 4 mg/ml Mycobacterium. Peripheral lymph node (PLN) cells from the primed mice were isolated after 7 days and stimulated with 50 µg/ml PLP139–151. The in vitro restimulated lymphocytes were then adoptively transferred into CCL2 transgenic or control mice and followed for EAE induction. Mice were evaluated daily for the development of clinical signs of disease using the following scale: grade 0, no abnormality; grade 1, limp tail; grade 2, limp tail and partial hind limb weakness; grade 3, partial hind limb paralysis; grade 4, complete hind limb paralysis.
Histology
Histological evaluation was performed on representative mice from each experimental group. Mice were anesthetized with methoxyflurane (Pitman-Moore Pharmaceuticals, Washington Crossing, NJ) and perfused through the left ventricle with 
60 ml phosphate-buffered saline (PBS). Spinal cords were extruded by flushing the vertebral canal with PBS. The most caudal 1 cm of the lumbar spinal cord was fixed in a phosphate-buffered, 10% formalin solution and embedded in paraffin. Twelve 10-µm sections from each animal were stained with hematoxylin and eosin (H&E) and were examined for the presence of mononuclear cell infiltration. Histological scores were determined using the following scale: 0, no mononuclear cell infiltration; 1, 1–5 perivascular lesions per section with parenchymal infiltration; 2, 5–10 perivascular lesions per section with parenchymal infiltration; and 3, >10 perivascular lesions per section with extensive parenchymal infiltration. The mean histological score ± SD was calculated for each group. Representative photomicrographs were taken using a Nikon microscope (Fryer Company, Huntley, IL) equipped with a SPOT digital camera (Diagnostic Instruments, Sterling Heights, MI). Images were created using Metamorph Meta Imaging Series 4.5 software (Universal Imaging Corp., West Chester, PA) and printed with a Fujix Pictography 3000 (Fuji Photo Film USA, Elmsford, NY).
Cell culture and cytokine analysis
Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 5% fetal bovine serum, 1 mM glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, 1 mM nonessential amino acids, and 5 x 10–5 M 2-mercaptoethanol (complete DMEM-5; all components from Sigma Chemical Co., St. Louis, MO) in a total volume of 2 ml. Antigen-specific stimulation was evaluated in a dose-response manner using 0.5, 5.0, and 50.0 µM PLP139–151 for the ex vivo restimulation of lymph node and spleen cells. Proliferation was determined by standard 3H-thymidine (Amersham, Arlington Heights, IL) incorporation as described previously [32
]. Cytokine production was assayed from culture supernatants harvested at varying time-points following stimulation and was tested for the presence of interferon- (IFN-), IL-2, and IL-4 by enzyme-linked immunosorbent assay (ELISA) mini-kits (Endogen, Cambridge, MA). Sensitivity of the cytokine ELISA kits was as follows: IFN-, 150 pg/ml; IL-2, 62.5 pg/ml; and IL-4, 15 pg/ml.
Antibodies
Fluorochrome- and biotin-conjugated monoclonal antibodies (mAb) to murine CD4 (RM4-5), CD8a (Ly-2), CD19 (1D3), and CD45 (Ly-5) were purchased from PharMingen (San Diego, CA). Fluorochrome mAb to murine F4/80 were purchased from Caltag Laboratories (Burlingame, CA). Isotype control antibodies were purchased from PharMingen. All antibodies used for flow cytometry were titered using spleen cell suspensions. Purified CD16/32 (Fc block) clone 2.4G2, anti-mouse Fc receptor for immunoglobulin G-II/III, was purchased from PharMingen.
Flow cytometry
Cells (0.5–1x106) were incubated with Fc block (CD16/32) for 15 min at 4°C in isotonic-buffered saline (IBS) (Baxter Diagnostics, McGaw Park, IL) containing 0.1% NaN3 and 2% bovine serum albumin (Sigma Chemical Co.) to block Fc-mediated binding. Cells were washed in IBS followed by incubation with biotinylated anti-CD45. Finally, cells were washed twice in IBS followed by incubation with avidin-allophycocyanin and combinations of CD4-peridinin chlorophyll protein, F4/80-fluorescein isothiocyanate, and CD8a-phycoerythrin (PE) or CD19-PE at a predetermined, optimal concentration for 15 min at 4°C in the dark. As a control, parallel populations of cells were incubated in the presence of isotype-matched control antibodies. Cells were washed in IBS and resuspended in 0.5 ml IBS. Intracellular cytokine staining was accomplished using the PharMingen kit per the manufacturer’s specifications following a 24-h restimulation of CNS-derived lymphocytes with immobilized anti-CD3 (2C11, PharMingen) and anti-CD28 (37.51, PharMingen). Data collection and analysis were performed on a FACSCalibur (Becton Dickinson, San Jose, CA) flow cytometer using Cellquest software (Becton Dickinson).
Semiquantitative amplification of mRNA expression by reverse transcriptase-polymerase chain reaction (RT-PCR)
At the indicated times, total RNA was isolated from cultured cells or spleens as described previously using Trizol reagent (Gibco-BRL, Gaithersburg, MD). A total of 2 µg RNA was reverse-transcribed using SuperScript II RT (Gibco-BRL). A portion of the total cDNA was amplified by PCR using 94°C denaturation, 61°C annealing, and 72°C extension temperatures, and the first three cycles had extended times. Positive- and negative-strand primers and the number of cycles used for amplification of each mRNA species were as follows: IL-12 receptor (IL-12R)ß2, 30 cycles, AATCTCCATGGCAAGAAAGTCC and GTTGATGGCAGTAACACGGACT, and glyceraldehyde-3-phosphate dehydrogenase (G3PDH), 23 cycles, CCATCACCATCTTCCAGGAGCAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT. Amplified products were visualized under UV illumination following electrophoresis on ethidium bromide-stained agarose gels. Amplification of the appropriate gene fragments was assured by comparison with molecular weight markers run on the same gel (i.e., 220 base pairs for IL-12Rß2 and 340 base pairs for G3PDH). It should be noted that the conditions for amplification of each mRNA species were predetermined to be within the linear range of amplification.
Statistical analysis
Appropriate statistical tests were performed on the data to determine levels of significant differences. Comparisons of the percentage of animals showing clinical disease were analyzed by 
2 test, using Fisher’s exact probability. Single comparisons of two means were analyzed by Student’s t-test. P values 
0.05 were considered significant. The data shown are representative of experiments performed a minimum of three times.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
 View larger version (17K): [in a new window] |
Figure 1. JE32 (CCL2) transgenic (MCP-1 Tg+) mice have decreased, acute clinical EAE. Groups of 10 JE32 and (SJLxSWR)F1 control mice were immunized with PLP139–151 in CFA at day 0 and evaluated for the development of EAE. All of the control mice developed severe EAE (10/10), and a minority of CCL2 transgenic mice (2/10) developed mild EAE. The difference in disease severity between JE32 and control mice is statistically significant from days 10–18 postinduction (P<0.05).
|
 View larger version (63K): [in a new window] |
Figure 2. JE32 (CCL2) transgenic mice show altered, histologic EAE. Control (SJLxSWR)F1 and JE32 mice were immunized with PLP139–151/CFA and assessed for development of histologic disease by examination of 5 µm H&E-stained sections cut from tissue embedded in paraffin. JE32 transgenic mice demonstrated severe mononuclear cell infiltration throughout the spinal cord, evident as large lesions composed of mononuclear cells (A). Control (SJLxSWR)F1 CNS tissue indicated scattered, small mononuclear cell lesions and perivascular cuffs (B). The data are representative of at least three similar experiments.
|
 View larger version (38K): [in a new window] |
Figure 3. JE32 (CCL2) transgenic mice (MCP-1 Tg+) have increased CNS monocyte infiltration. The relative composition of the CNS infiltrate was determined by flow cytometry. Spinal cord samples from JE32 transgenic and control mice were obtained at the peak of acute clinical disease in the control mice. Mononuclear cells were isolated by Percoll density centrifugation and labeled with mAb specific for CD45 (all leukocytes) and F4/80 (monocytes, macrophages, and microglia). The percentages of cells in each quadrant were derived from data gated on lower forward- versus side-scatter light characteristics, representative of mononuclear size and structure.
|
production compared with restimulated control PLN T cells. As we had previously shown that CCL2 could induce IL-4 cytokine expression and differentiation of Th2 cells in vitro [16
], we examined antigen-specific recall IL-4, IL-5, IL-10, and transforming growth factor-ß (TGF-ß) expression by JE32 and control draining PLN T cells as well as cytokine responses from whole CNS tissue and found no significant differences between transgenic and control groups (data not shown).
 View larger version (19K): [in a new window] |
Figure 4. JE32 (CCL2) transgenic mice show decreased peripheral Th1 activation. (A) Antigen-specific T cell proliferation was determined using draining lymph node cells from JE32 transgenic (MCP-1 Tg+) or control mice at the peak of acute, clinical EAE in the control mice and a dose range of PLP139–151 (0.5, 5.0, and 50.0 µM). Cells were also restimulated with a mitogenic dose of anti-CD3 for 24 h to assess the viability and survival of the T cell population. The data are depicted as mean counts per minute (CPM) ± SD. The control groups are statistically significantly greater than the JE32 transgenic groups at doses of 5.0 and 50.0 µM (P<0.05). (B) Supernatants of draining lymph node cell cultures from JE32 transgenic (MCP-1 Tg+) and control mice were evaluated for IFN- production by ELISA. The data are depicted as mean concentration ± SD. The level of IFN- in the JE32 transgenic cell cultures was statistically significantly lower than that of the controls at the 5.0 and 50.0 µM doses of PLP139–151 (P<0.05).
|
expression by T cells isolated from the spinal cords of JE32 or control mice with EAE. At a time-point at which control mice developed signs of EAE, spinal cord-infiltrating T cells were isolated from JE32 and control mice [35
], restimulated with immobilized anti-CD3 and anti-CD28, and assessed for intracytoplasmic IFN- expression. The results in Figure 5
demonstrate that CNS-derived CD4+ T cells from JE32 mice expressed IFN- at a significantly lower frequency than CD4+ T cells from control mice with EAE. Collectively, these results suggested that the mechanism of decreased, clinical EAE in the JE32 mice was associated with impaired T cell effector functions, including antigen-specific proliferation and IFN- production.
 View larger version (18K): [in a new window] |
Figure 5. JE32 (CCL2) transgenic mice (MCP-1 Tg) show decreased CNS Th1 activation. CNS-infiltrating CD4+ T cells were isolated from JE32 transgenic and control mice at the time control mice showed peak acute, clinical EAE and were evaluated for IFN- production by intracytoplasmic cytokine staining, three-color flow cytometric analysis. The data depicted are gated on lower forward- versus side-scatter light characteristics, representative of mononuclear size and structure as well as CD45 staining.
|
expression. The combinatorial effect of in vivo inhibition of the IL-12/IL-12R axis could result in the observed decrease in EAE (Fig. 1)
and PLP-specific Th1 responses (Fig. 4B)
[37
, 38
]. To explore this possibility, we isolated CD4+ lymphocytes from spleen and PLN at the peak of disease in control animals and from JE32 mice and looked for differences in IL-12Rß2 expression following antigen restimulation. The results shown in Figure 6
demonstrate that there was a dramatic abrogation of IL-12Rß2 mRNA expression in lymphocytes isolated from the spleen and PLN CCL2 transgenic animals (T), and there was a high level of expression in cells from control animals (N) that developed EAE. This result suggested that the possible mechanism of disease inhibition may function through down-regulation of the IL-12-mediated Th1 phenotype required for the induction of EAE in the SWRxSJL mice.
 View larger version (36K): [in a new window] |
Figure 6. JE32 (CCL2) transgenic mice have little-to-no IL-12Rß2 RNA expression during the peak of clinical disease in control animals. Lymphocytes isolated from spleen (Spl) and PLN from JE32 (T) and (SWRxSJL)F1 control (N) mice at the peak of clinical disease were stimulated in vitro with PLP139–151 for 48 or 96 h and assayed for IL-12Rß2 RNA expression by RT-PCR. The data depicted of pooled samples are a representation of three independent experiments with similar results.
|
 View larger version (11K): [in a new window] |
Figure 7. JE32 (CCL2) transgenic animals have less severe EAE following adoptive transfer of encephalitogenic T cells, which from PLP139–151-primed (SWRxSJL)F1 animals, were restimulated in vitro with PLP139–151 and then adoptively transferred into naïve (SWRxSJL)F1 or JE32 transgenic animals and monitored for clinical disease as described in Materials and Methods.
|
response through the regulation of IL-12Rß2 in PLP139–151-specific T cells.
 View larger version (16K): [in a new window] |
Figure 8. IL-12Rß2 RNA expression is reduced in encephalitogenic T cells after transfer into JE32 (CCL2) transgenic mice. PLP139–151-specific encephalitogenic SWRxSJL.thy1a+ T cells (SWX) were adoptively transferred into CCL2 transgenic (MCP-1-Tg) or control mice and positively selected from spleens after the onset of disease in the control mice. (A) Positively selected cells from individual animals in each group were then assayed for IL-12Rß2 and G3PDH mRNA expression by RT-PCR. (B) Densitometric analysis, measured by the ratio of IL-12R/G3PDH, was used to quantify the reduced mRNA expression between groups. *, P < 0.05.
|
 View larger version (18K): [in a new window] |
Figure 9. CCL2 dose-dependent attenuation of IL-12Rß2 mRNA expression by CD4+ T cells, which were incubated with increasing amounts of CCL2 and stimulated with anti-CD3 in vitro. (A) The amount of IL-12Rß2 and G3PDH mRNA expression was then determined by RT-PCR. (B) The relative amount of IL-12Rß2 RNA was quantified by calculating the densitometric ratio of IL-12Rß2/G3PDH RNA for each treatment dose of CCL2. *, Doses with a significant reduction of IL-12Rß2 RNA when compared with the untreated control (P<0.05). (A) PCR data are representative of the triplicates.
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Another essential step in the pathogenesis of tissue-specific, autoimmune, inflammatory diseases is the chemotactic-induced recruitment of leukocytes into the tissue. We [26
, 48
, 49
] and others [50
51
52
] demonstrated a relationship between production of chemokines in the CNS and development of acute and relapsing EAE. We further demonstrated the in vivo biological importance for CCL3/macrophage-inflammatory protein-1
(MIP-1) production in the pathogenesis of acute EAE, by showing that disease development could be blocked with anti-MIP-1 administration at the time of disease induction [9
], and similarly established a role for CCL2 in the development of relapsing EAE [26
]. Chemokine expression in the CNS of MS patients has also been described, suggesting a role for these molecules in the pathogenesis of human demyelinating disease [10
, 53
, 54
]. These results led us to hypothesize that temporally and spatially restricted expression of chemokines regulates demyelinating disease development by controlling the distribution of perivascular- and parenchymal-infiltrating mononuclear cells [25
].
Beyond regulating leukocyte migration and accumulation in tissue, chemokines govern diverse biologic processes, including T cell activation and effector cytokine secretion [11
]. In this regard, we have previously demonstrated that CCL2 could induce in vitro Th2 differentiation [16
] and down-regulate IL-12 expression [27
]. To extend these results, we sought to explore the in vivo regulatory effects of CCL2 by creating a line of transgenic mice (JE32), which constitutively expressed CCL2 in the CNS. In the present report, we demonstrated that JE32 mice develop significantly decreased, clinical EAE (Fig. 1)
and distinctly altered histological EAE (Fig. 2)
. It is surprising that these features of inflammatory lesions in JE32 EAE mice were observed, despite the fact that the infiltrates contained increased numbers of monocytes/macrophages (Fig. 3)
. The decreased clinical EAE in JE32 mice appeared to be related to impaired antigen-specific T cell proliferation and IFN- production, as demonstrated by studying PLN T cells (Fig. 5)
and confirmed with intracytoplasmic flow cytometric analysis of CNS-infiltrating CD4+ T cells from JE32 mice and controls (Fig. 6)
. The increased numbers of macrophages in the CNS of CCL2 transgenic mice were apparently not activated as determined by a lack of inducible nitric oxide synthase up-regulation (data not shown), consistent with the demonstration of decreased T cell-dependent IFN- expression. Collectively, our data argue that constitutive expression of CCL2 in the CNS leads to a profound suppression of the antigen-specific Th1 response. Therefore, despite the presence of enhanced numbers of monocyte/macrophage effector cells in the CNS, JE32 mice exhibit significantly less severe EAE than littermate controls.
There are at least three mechanistic possibilities to explain our results: Constitutive CNS expression of CCL2 abrogates the chemotactic gradient necessary to recruit and/or accumulate effector T cells and/or macrophages in the target organ; we do not think this explains our results, as there are increased numbers of macrophages in the CNS of JE32 transgenic mice (Fig. 3) . The CCL2 transgene is inserted into a gene that is related to disease development; we do not think that this explains the result of decreased clinical disease seen in Figure 1
, as adoptive transfer of in vitro-activated, PLP139–151-specific T cells into JE32 transgenic recipient mice results in decreased clinical disease (Fig. 7)
with the accompanying decrease in IFN- production (not shown) and decreased levels of IL-12Rß2 expression (Fig. 8)
. Therefore, the constitutive CNS expression of CCL2 acts on wild-type antigen-specific T cells to inhibit the Th1 phenotype and thus, disease development. Last, rather, we favor the interpretation that CCL2 acts directly on the induction of Th1 cells to inhibit their ability to express IFN-. Support for this idea derives from the results shown in Figure 5
, where CNS CD4+ T cells have a significant reduction in IFN- expression, presumably as a result of a decrease in IL-12Rß2 expression (Fig. 7)
. Similarly, the experiment in Figure 8
, where adoptively transferred, wild-type PLP139–151-specific donor T cells, sorted from JE32 but not control recipient mice, showed decreased IL-12-Rß2 expression. This could account for the inability of these cells to respond to IL-12 and become IFN- secretors, thereby resulting in decreased EAE. We do not believe that CCL2 transgene expression drives the infiltration of regulatory leukocytes secreting regulatory cytokines, as we have never detected increases in IL-4, IL-10, or TGF-ß in the CNS of JE32 mice after EAE induction. Furthermore, we have never detected an increase of CD4+CD25+ regulatory T cells.
The role of CCL2 in the regulation of Th1 immune responses has been described for other in vivo systems. Mouse mammary tumor virus (MMTV)-driven expression of a CCL2 transgene conferred a reduced ability to clear intracellular pathogens, probably as a result of ligand-mediated down-regulation of CCL2 receptors [55
]. Clearly, the results obtained in studies of the high-level MMTV–long terminal repeat/MCP-1 overexpressors differ from our findings, as EAE in JE32 mice was associated with increased macrophage recruitment and direct regulation of the antigen-specific Th1 cells. The role of CCL2 in regulating in vivo Th2 responses has also been shown by a number of investigators. Antibody depletion of CCL2 resulted in a decreased type 2 granulatomatous response [56
], and targeted genetic disruption of CCL2 has been shown to abrogate expression of Th2 responses [22
]. In our experiments, we observed that transgenic CCL2 expression directly down-regulated the Th1-associated IFN- response but did not augment IL-4 production [17
]. The cellular signaling pathways that account for our observations are currently under investigation. Our data raise the possibility of developing molecules with CCL2-like receptor-binding properties that could down-regulate inflammatory effector cytokine expression without enhancing inflammatory cell migration. Such reagents could provide an attractive treatment modality for inflammatory autoimmune diseases such as MS.
Received August 23, 2004; revised October 8, 2004; accepted October 19, 2004.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
for an inflammatory response to viral infection Science 269,1583-1585 (MIP-1) is required for the efferent phase of pulmonary cell-mediated immunity to a Cryptococcus neoformans infection J. Immunol. 159,318-327[Abstract] in Shistosoma mansoni egg-induced granulomatous inflammation J. Exp. Med. 177,1551-1559 in the pathogenesis of the T cell-mediated autoimmune disease, experimental autoimmune encephalomyelitis J. Immunol. 155,5003-5010[Abstract] and monocyte chemotactic protein-1 J. Neuroimmunol. 92,98-108[CrossRef][Medline] production by myelin basic protein-specific T cell clones correlates with encephalitogenicity Int. Immunol. 2,539-5444ß1 integrin Nature 356,63-66[CrossRef][Medline]This article has been cited by other articles:
 |
|
 |
|
  K. M. Omari, S. E. Lutz, L. Santambrogio, S. A. Lira, and C. S. Raine Neuroprotection and Remyelination after Autoimmune Demyelination in Mice that Inducibly Overexpress CXCL1 Am. J. Pathol., January 1, 2009; 174(1): 164 - 176. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Touil, D. Fitzgerald, G.-X. Zhang, A. Rostami, and B. Gran Cutting Edge: TLR3 Stimulation Suppresses Experimental Autoimmune Encephalomyelitis by Inducing Endogenous IFN-beta J. Immunol., December 1, 2006; 177(11): 7505 - 7509. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
