Journal of Leukocyte Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0804465 on November 11, 2004

Published online before print November 11, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0804465v1
77/2/229    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elhofy, A.
Right arrow Articles by Karpus, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elhofy, A.
Right arrow Articles by Karpus, W. J.
(Journal of Leukocyte Biology. 2005;77:229-237.)
© 2005 by Society for Leukocyte Biology

Transgenic expression of CCL2 in the central nervous system prevents experimental autoimmune encephalomyelitis

Adam Elhofy*, Jintang Wang{dagger}, Mari Tani{dagger}, Brian T. Fife*, Kevin J. Kennedy*, Jami Bennett*, DeRen Huang{dagger}, Richard M. Ransohoff{dagger} and William J. Karpus*,1

* Department of Pathology, Interdepartmental Immunobiology Center, Institute of Neuroscience, Robert H. Lurie Comprehensive Cancer Center, Feinberg School of Medicine, Northwestern University, Chicago, Illinois; and
{dagger} Department of Neuroscience, Cleveland Clinic and Foundation, Ohio

1 Correspondence: Department of Pathology, Northwestern University, 303 E. Chicago Ave., W127, Chicago, IL 60611. E-mail: w-karpus{at}northwestern.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
CC chemokine ligand 2 (CCL2)/monocyte chemotactic protein-1, a member of the CC chemokine family, is a chemoattractant for monocytes and T cells through interaction with its receptor CCR2. In the present study, we examined a T helper cell type 1 (Th1)-dependent disease, proteolipid protein-induced experimental autoimmune encephalomyelitis, in a transgenic mouse line that constitutively expressed low levels of CCL2 in the central nervous system (CNS) under control of the astrocyte-specific glial fibrillary acidic protein promoter. CCL2 transgenic mice developed significantly milder clinical disease than littermate controls. As determined by flow cytometry, mononuclear cell infiltrates in the CNS tissues of CCL2 transgenic and littermate-control mice contained equal numbers of CD4+ and CD8+ T cells, and the CCL2 transgenic mice showed an enhanced number of CNS-infiltrating monocytes. CNS antigen-specific T cells from CCL2 transgenic mice produced markedly less interferon-{gamma}. Overexpression of CCL2 in the CNS resulted in decreased interleukin-12 receptor expression by antigen-specific T cells. Collectively, these results indicate that sustained, tissue-specific expression of CCL2 in vivo down-regulates the Th1 autoimmune response, culminating in milder clinical disease.

Key Words: chemokines • EAE • multiple sclerosis • MCP-1 • IL-12R


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemokines are small molecular weight cytokines that induce the chemotaxis of leukocytes (reviewed in ref. [1 ]). Members of the chemokine superfamily are subdivided into four families based on the structural positions of the first two cysteines at the N terminus of the molecule. In addition to having in vitro chemotactic properties for T cells and macrophages, chemokines have been shown to play important processes in a number of inflammatory and allergic diseases, presumably by inducing the migration and/or accumulation of leukocytes from the circulation to tissue parenchyma [2 3 4 5 6 7 8 9 10 ]. Taken together, these reports suggest that chemokines are involved in the initiation and amplification of tissue-specific, inflammatory-associated immune responses with pathologic consequences.

Chemokines are pleiotropic and mediate functions beyond chemotaxis [11 ], including hematopoiesis [12 ], T cell activation [13 ] and T cell costimulation [14 ], and cytokine production [15 16 17 ]. These in vitro results were confirmed by studies of gene-targeted chemokine- and chemokine receptor-deficient mice, which demonstrated alterations in hematopoiesis [18 , 19 ], T cell activation, and cytokine production [20 21 22 ].

Murine CC chemokine ligand 2 [CCL2; monocyte chemotactic protein-1 (MCP-1)] was first described as a chemoattractant factor for monocytes [23 , 24 ], which functioned through activation of its receptor CCR2 [21 ]. CCL2 is expressed in the central nervous system (CNS) during evolution of the T cell-mediated disease, experimental autoimmune encephalomyelitis (EAE; reviewed in ref. [25 ]), and is biologically important for the relapsing phase of that disorder [26 ]. We and others demonstrated that CCL2 can regulate T helper cell type 2 (Th2) commitment [16 ] and interleukin (IL)-4 expression [17 ] as well as the down-regulation of IL-12 [27 ]. It might therefore be anticipated that overexpression of CCL2 could result in milder EAE through induction of Th2-polarized responses or inhibition of the initiation of a Th1 response to myelin antigens. It has been indicated that the major CCL2 receptor was essential for generating a Th1-biased, pathological inflammatory reaction, as mice that lacked CCR2 were resistant to EAE [28 , 29 ], and CCR2 knockout mice are also unable to resolve intracellular infection by Leishmania [30 ].

To assess the function of CCL2 as a regulator of organ-specific T cell function and cytokine expression during EAE, we used a transgenic model that constitutively expressed low concentrations of CCL2 in the CNS [31 ]. Overexpression of CCL2 in the CNS has been reported previously [32 ] to result in accumulation of monocytes in the CNS of a naïve mouse. In the current report, we describe the clinical and histological EAE phenotype of CCL2 transgenic mice.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Mice
CCL2 transgenic mice [31 , 33 ] and nontransgenic littermate mice or normal (SJLxSWR)F1 mice were used as controls. SJLxSWR were crossed to SJL.thy1a, resulting in normal mice having lymphocytes tagged with the Thy1a marker. Animal care and use at Northwestern University (Chicago, IL) and the Cleveland Clinic (OH) were performed according to the Guide and Public Health Service policy.

Induction of EAE
Proteolipid protein amino acid sequence 139–151 (PLP139–151; HSLGKWLGHPDKF) was purchased from Peptides International (Louisville, KY). The amino acid composition was verified by mass spectrometry, and purity (>98%) was assessed by high-pressure liquid chromatography. For active disease, individual CCL2 transgenic and control mice were immunized subcutaneously with 100 µg PLP139–151, emulsified in complete Freund’s adjuvant (CFA), containing 4 mg/ml Mycobacterium tuberculosis (Difco, Detroit, MI). For adoptive transfer of disease, SWRXSJL.thy1a mice were immunized with 50 µg PLP139–151, emulsified in CFA containing 4 mg/ml Mycobacterium. Peripheral lymph node (PLN) cells from the primed mice were isolated after 7 days and stimulated with 50 µg/ml PLP139–151. The in vitro restimulated lymphocytes were then adoptively transferred into CCL2 transgenic or control mice and followed for EAE induction. Mice were evaluated daily for the development of clinical signs of disease using the following scale: grade 0, no abnormality; grade 1, limp tail; grade 2, limp tail and partial hind limb weakness; grade 3, partial hind limb paralysis; grade 4, complete hind limb paralysis.

Histology
Histological evaluation was performed on representative mice from each experimental group. Mice were anesthetized with methoxyflurane (Pitman-Moore Pharmaceuticals, Washington Crossing, NJ) and perfused through the left ventricle with ~60 ml phosphate-buffered saline (PBS). Spinal cords were extruded by flushing the vertebral canal with PBS. The most caudal 1 cm of the lumbar spinal cord was fixed in a phosphate-buffered, 10% formalin solution and embedded in paraffin. Twelve 10-µm sections from each animal were stained with hematoxylin and eosin (H&E) and were examined for the presence of mononuclear cell infiltration. Histological scores were determined using the following scale: 0, no mononuclear cell infiltration; 1, 1–5 perivascular lesions per section with parenchymal infiltration; 2, 5–10 perivascular lesions per section with parenchymal infiltration; and 3, >10 perivascular lesions per section with extensive parenchymal infiltration. The mean histological score ± SD was calculated for each group. Representative photomicrographs were taken using a Nikon microscope (Fryer Company, Huntley, IL) equipped with a SPOT digital camera (Diagnostic Instruments, Sterling Heights, MI). Images were created using Metamorph Meta Imaging Series 4.5 software (Universal Imaging Corp., West Chester, PA) and printed with a Fujix Pictography 3000 (Fuji Photo Film USA, Elmsford, NY).

Cell culture and cytokine analysis
Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 5% fetal bovine serum, 1 mM glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, 1 mM nonessential amino acids, and 5 x 10–5 M 2-mercaptoethanol (complete DMEM-5; all components from Sigma Chemical Co., St. Louis, MO) in a total volume of 2 ml. Antigen-specific stimulation was evaluated in a dose-response manner using 0.5, 5.0, and 50.0 µM PLP139–151 for the ex vivo restimulation of lymph node and spleen cells. Proliferation was determined by standard 3H-thymidine (Amersham, Arlington Heights, IL) incorporation as described previously [32 ]. Cytokine production was assayed from culture supernatants harvested at varying time-points following stimulation and was tested for the presence of interferon-{gamma} (IFN-{gamma}), IL-2, and IL-4 by enzyme-linked immunosorbent assay (ELISA) mini-kits (Endogen, Cambridge, MA). Sensitivity of the cytokine ELISA kits was as follows: IFN-{gamma}, 150 pg/ml; IL-2, 62.5 pg/ml; and IL-4, 15 pg/ml.

Antibodies
Fluorochrome- and biotin-conjugated monoclonal antibodies (mAb) to murine CD4 (RM4-5), CD8a (Ly-2), CD19 (1D3), and CD45 (Ly-5) were purchased from PharMingen (San Diego, CA). Fluorochrome mAb to murine F4/80 were purchased from Caltag Laboratories (Burlingame, CA). Isotype control antibodies were purchased from PharMingen. All antibodies used for flow cytometry were titered using spleen cell suspensions. Purified CD16/32 (Fc block) clone 2.4G2, anti-mouse Fc receptor for immunoglobulin G-{gamma}II/III, was purchased from PharMingen.

Flow cytometry
Cells (0.5–1x106) were incubated with Fc block (CD16/32) for 15 min at 4°C in isotonic-buffered saline (IBS) (Baxter Diagnostics, McGaw Park, IL) containing 0.1% NaN3 and 2% bovine serum albumin (Sigma Chemical Co.) to block Fc-mediated binding. Cells were washed in IBS followed by incubation with biotinylated anti-CD45. Finally, cells were washed twice in IBS followed by incubation with avidin-allophycocyanin and combinations of CD4-peridinin chlorophyll protein, F4/80-fluorescein isothiocyanate, and CD8a-phycoerythrin (PE) or CD19-PE at a predetermined, optimal concentration for 15 min at 4°C in the dark. As a control, parallel populations of cells were incubated in the presence of isotype-matched control antibodies. Cells were washed in IBS and resuspended in 0.5 ml IBS. Intracellular cytokine staining was accomplished using the PharMingen kit per the manufacturer’s specifications following a 24-h restimulation of CNS-derived lymphocytes with immobilized anti-CD3 (2C11, PharMingen) and anti-CD28 (37.51, PharMingen). Data collection and analysis were performed on a FACSCalibur (Becton Dickinson, San Jose, CA) flow cytometer using Cellquest software (Becton Dickinson).

Semiquantitative amplification of mRNA expression by reverse transcriptase-polymerase chain reaction (RT-PCR)
At the indicated times, total RNA was isolated from cultured cells or spleens as described previously using Trizol reagent (Gibco-BRL, Gaithersburg, MD). A total of 2 µg RNA was reverse-transcribed using SuperScript II RT (Gibco-BRL). A portion of the total cDNA was amplified by PCR using 94°C denaturation, 61°C annealing, and 72°C extension temperatures, and the first three cycles had extended times. Positive- and negative-strand primers and the number of cycles used for amplification of each mRNA species were as follows: IL-12 receptor (IL-12R)ß2, 30 cycles, AATCTCCATGGCAAGAAAGTCC and GTTGATGGCAGTAACACGGACT, and glyceraldehyde-3-phosphate dehydrogenase (G3PDH), 23 cycles, CCATCACCATCTTCCAGGAGCAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT. Amplified products were visualized under UV illumination following electrophoresis on ethidium bromide-stained agarose gels. Amplification of the appropriate gene fragments was assured by comparison with molecular weight markers run on the same gel (i.e., 220 base pairs for IL-12Rß2 and 340 base pairs for G3PDH). It should be noted that the conditions for amplification of each mRNA species were predetermined to be within the linear range of amplification.

Statistical analysis
Appropriate statistical tests were performed on the data to determine levels of significant differences. Comparisons of the percentage of animals showing clinical disease were analyzed by {chi}2 test, using Fisher’s exact probability. Single comparisons of two means were analyzed by Student’s t-test. P values ≤0.05 were considered significant. The data shown are representative of experiments performed a minimum of three times.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Decreased severity of clinical and histological EAE in CCL2 transgenic mice
To assess the effect of elevated CNS and peripheral CCL2 levels on the phenotype of EAE, we induced disease in groups of CCL2 transgenic (JE32) and control mice by active immunization. As shown in Figure 1 , JE32 mice developed significantly milder, acute EAE than did their littermate controls. This surprising result raised the possibility that the transgene product might act to desensitize circulating or CNS-infiltrating monocytes, thereby precluding their recruitment to the CNS. To address this possibility, CNS tissues of representative JE32 and littermate controls were analyzed for inflammatory leukocyte infiltrates by H&E staining. The results shown in Figure 2 demonstrate that the CNS of JE32 mice with decreased EAE contained a combination of extensive, diffuse mononuclear infiltrates throughout the parenchyma and large numbers of inflammatory foci (Fig. 2A) in contrast to control mice, which demonstrated lower numbers of perivascular leukocyte infiltrates typical of EAE (Fig. 2B) . The presence of abundant mononuclear cell infiltrates in the CNS of JE32 mice with EAE suggested that the transgene product did not inhibit the accumulation of inflammatory cells in the CNS. Collectively, these data indicated that CNS expression of CCL2 in JE32 mice decreased the clinical severity of EAE despite the presence of high numbers of CNS-infiltrating mononuclear cells.



View larger version (17K):
[in this window]
[in a new window]
  		Figure 1. JE32 (CCL2) transgenic (MCP-1 Tg+) mice have decreased, acute clinical EAE. Groups of 10 JE32 and (SJLxSWR)F1 control mice were immunized with PLP139–151 in CFA at day 0 and evaluated for the development of EAE. All of the control mice developed severe EAE (10/10), and a minority of CCL2 transgenic mice (2/10) developed mild EAE. The difference in disease severity between JE32 and control mice is statistically significant from days 10–18 postinduction (P<0.05).

 


View larger version (63K):
[in this window]
[in a new window]
  		Figure 2. JE32 (CCL2) transgenic mice show altered, histologic EAE. Control (SJLxSWR)F1 and JE32 mice were immunized with PLP139–151/CFA and assessed for development of histologic disease by examination of 5 µm H&E-stained sections cut from tissue embedded in paraffin. JE32 transgenic mice demonstrated severe mononuclear cell infiltration throughout the spinal cord, evident as large lesions composed of mononuclear cells (A). Control (SJLxSWR)F1 CNS tissue indicated scattered, small mononuclear cell lesions and perivascular cuffs (B). The data are representative of at least three similar experiments.

 
Comparison of mononuclear cell subsets in the CNS infiltrate
Histologic evaluation of the CNS mononuclear infiltrate from JE32 mice revealed an altered pattern of inflammatory infiltrates compared with control mice (Fig. 2) . To evaluate whether CNS transgenic expression of CCL2 altered the composition of this mononuclear cell infiltrate, we immunized groups of JE32 and control mice with PLP139–151 in CFA and killed pairs of JE32 and littermate mice when controls exhibited peak acute clinical disease. Spinal cord-infiltrating cells were isolated and phenotyped by flow cytometry for the relative proportions of T cells (CD3+CD4+ or CD3+CD8+), monocytes (CD45hiF4/80+), and microglia (CD45loF4/80+) [34 ]. The results demonstrated that there were no differences in the percentages of CD4+ or CD8+ T cells or CD4+CD25+ T cells in the CNS of JE32 and control mice, and there were no alterations of very late antigen (VLA)-4 expression on CD4+ T cells in JE32 mice (data not shown). However, as shown in Figure 3 , monocytes (CD45brightF4/80+) were significantly enriched as a proportion of the CNS infiltrate in JE32 mice (33.3%) compared with controls (12.0%). The percentages of resident CNS microglia (CD45dimF4/80+) in JE32 (45.5%) and control (47.1%) mice were comparable. There were no significant differences in the proportions of splenic mononuclear cell populations. These data indicated that decreased clinical EAE in JE32 mice was not a consequence of impaired CD4+ T cell accumulation in the CNS. Furthermore, these results demonstrated enhanced macrophage accumulation in JE32 CNS tissues, consistent with CNS overexpression of CCL2 [31 ].



View larger version (38K):
[in this window]
[in a new window]
  		Figure 3. JE32 (CCL2) transgenic mice (MCP-1 Tg+) have increased CNS monocyte infiltration. The relative composition of the CNS infiltrate was determined by flow cytometry. Spinal cord samples from JE32 transgenic and control mice were obtained at the peak of acute clinical disease in the control mice. Mononuclear cells were isolated by Percoll density centrifugation and labeled with mAb specific for CD45 (all leukocytes) and F4/80 (monocytes, macrophages, and microglia). The percentages of cells in each quadrant were derived from data gated on lower forward- versus side-scatter light characteristics, representative of mononuclear size and structure.

 
CCL2 transgenic mice show decreased antigen-specific effector immune responses
To address mechanisms of decreased clinical and altered histologic EAE in JE32 mice, we examined PLP139–151-specific proliferative and cytokine responses from representative mice during acute EAE. Figure 4A shows that PLN T cells from JE32 mice exhibited decreased recall-proliferative responses across a range of PLP139–151 concentrations compared with T cells from control mice. ELISA analysis of culture supernatants for the presence of IL-2 provided comparable results, showing reduced IL-2 production by antigen-stimulated JE32 T cells (data not shown). T cells from the JE32 mice were viable, as demonstrated by vigorous proliferation in response to anti-CD3 (Fig. 4A) . As shown in Figure 4B , PLN T cells from PLP139–151-immunized JE32 mice, restimulated with 5 or 50 µM PLP139–151, exhibited a significantly decreased level of IFN-{gamma} production compared with restimulated control PLN T cells. As we had previously shown that CCL2 could induce IL-4 cytokine expression and differentiation of Th2 cells in vitro [16 ], we examined antigen-specific recall IL-4, IL-5, IL-10, and transforming growth factor-ß (TGF-ß) expression by JE32 and control draining PLN T cells as well as cytokine responses from whole CNS tissue and found no significant differences between transgenic and control groups (data not shown).



View larger version (19K):
[in this window]
[in a new window]
  		Figure 4. JE32 (CCL2) transgenic mice show decreased peripheral Th1 activation. (A) Antigen-specific T cell proliferation was determined using draining lymph node cells from JE32 transgenic (MCP-1 Tg+) or control mice at the peak of acute, clinical EAE in the control mice and a dose range of PLP139–151 (0.5, 5.0, and 50.0 µM). Cells were also restimulated with a mitogenic dose of anti-CD3 for 24 h to assess the viability and survival of the T cell population. The data are depicted as mean counts per minute (CPM) ± SD. The control groups are statistically significantly greater than the JE32 transgenic groups at doses of 5.0 and 50.0 µM (P<0.05). (B) Supernatants of draining lymph node cell cultures from JE32 transgenic (MCP-1 Tg+) and control mice were evaluated for IFN-{gamma} production by ELISA. The data are depicted as mean concentration ± SD. The level of IFN-{gamma} in the JE32 transgenic cell cultures was statistically significantly lower than that of the controls at the 5.0 and 50.0 µM doses of PLP139–151 (P<0.05).

 
Experiments using draining PLN T cells may not accurately represent the functional capacity of T cells that infiltrate the CNS during EAE. Therefore, using flow cytometric analysis, we examined IFN-{gamma} expression by T cells isolated from the spinal cords of JE32 or control mice with EAE. At a time-point at which control mice developed signs of EAE, spinal cord-infiltrating T cells were isolated from JE32 and control mice [35 ], restimulated with immobilized anti-CD3 and anti-CD28, and assessed for intracytoplasmic IFN-{gamma} expression. The results in Figure 5 demonstrate that CNS-derived CD4+ T cells from JE32 mice expressed IFN-{gamma} at a significantly lower frequency than CD4+ T cells from control mice with EAE. Collectively, these results suggested that the mechanism of decreased, clinical EAE in the JE32 mice was associated with impaired T cell effector functions, including antigen-specific proliferation and IFN-{gamma} production.



View larger version (18K):
[in this window]
[in a new window]
  		Figure 5. JE32 (CCL2) transgenic mice (MCP-1 Tg) show decreased CNS Th1 activation. CNS-infiltrating CD4+ T cells were isolated from JE32 transgenic and control mice at the time control mice showed peak acute, clinical EAE and were evaluated for IFN-{gamma} production by intracytoplasmic cytokine staining, three-color flow cytometric analysis. The data depicted are gated on lower forward- versus side-scatter light characteristics, representative of mononuclear size and structure as well as CD45 staining.

 
Regulation of T cell function in EAE induction by CCL2
It has been reported that CCL2 can inhibit IL-12 secretion [36 ]. We wanted to determine whether CCL2 could regulate the IL-12R as a possible explanation for decreased IFN-{gamma} expression. The combinatorial effect of in vivo inhibition of the IL-12/IL-12R axis could result in the observed decrease in EAE (Fig. 1) and PLP-specific Th1 responses (Fig. 4B) [37 , 38 ]. To explore this possibility, we isolated CD4+ lymphocytes from spleen and PLN at the peak of disease in control animals and from JE32 mice and looked for differences in IL-12Rß2 expression following antigen restimulation. The results shown in Figure 6 demonstrate that there was a dramatic abrogation of IL-12Rß2 mRNA expression in lymphocytes isolated from the spleen and PLN CCL2 transgenic animals (T), and there was a high level of expression in cells from control animals (N) that developed EAE. This result suggested that the possible mechanism of disease inhibition may function through down-regulation of the IL-12-mediated Th1 phenotype required for the induction of EAE in the SWRxSJL mice.



View larger version (36K):
[in this window]
[in a new window]
  		Figure 6. JE32 (CCL2) transgenic mice have little-to-no IL-12Rß2 RNA expression during the peak of clinical disease in control animals. Lymphocytes isolated from spleen (Spl) and PLN from JE32 (T) and (SWRxSJL)F1 control (N) mice at the peak of clinical disease were stimulated in vitro with PLP139–151 for 48 or 96 h and assayed for IL-12Rß2 RNA expression by RT-PCR. The data depicted of pooled samples are a representation of three independent experiments with similar results.

 
CCL2 transgenic expression in the CNS regulates adoptively transferred EAE
To this point, the data suggested that CCL2 can regulate the generation of an initial Th1 autoimmune response. We wanted to determine whether CCL2 could regulate a previously primed effector Th1 response. To accomplish this, we performed a series of adoptive transfer experiments where donor (SWRxSJL)F1 mice were primed with PLP139–151 in CFA. Their draining lymph nodes were harvested and restimulated in vitro with PLP139–151 prior to adoptive transfer into JE32 transgenic or (SWRxSJL)F1 control mice. The result shown in Figure 7 demonstrates that control recipient mice, which received encephalitogenic Th1 cells, developed clinical symptoms of EAE, and the JE32 transgenic mice did not develop severe disease. There was no alteration in the CNS inflammatory infiltrate (data not shown). This experiment demonstrated the ability of CCL2 overexpression in the CNS to inhibit already primed encephalitogenic Th1 cells from inducing disease.



View larger version (11K):
[in this window]
[in a new window]
  		Figure 7. JE32 (CCL2) transgenic animals have less severe EAE following adoptive transfer of encephalitogenic T cells, which from PLP139–151-primed (SWRxSJL)F1 animals, were restimulated in vitro with PLP139–151 and then adoptively transferred into naïve (SWRxSJL)F1 or JE32 transgenic animals and monitored for clinical disease as described in Materials and Methods.

 
To determine whether CCL2 overexpression directly regulated the IL-12R expression by the adoptively transferred antigen-specific T cells, we performed a similar experiment, except the donor PLP139–151-primed T cells were derived from SWRxSJL.thy1a mice, allowing us to sort the Thy1a+ T cells from the recipient JE32 or control mice and directly assess IL-12Rß2 expression. EAE is thought to be a Th1-mediated disease, and as such, blocking of the IL-12/IL-12R interaction during the initiation of Th1 differentiation results in the inhibition of disease [39 ]. PLP139–151-specific Thy1a+ T cells were adoptively transferred into JE32 or control mice, and when the control mice showed clinical signs of EAE, the antigen-specific cells (Thy1a+) from the CNS were positively sorted. IL-12Rß2 expression was then assessed by RT-PCR. The results shown in Figure 8 demonstrate that there was a significant decrease in IL-12Rß2 mRNA expression by the Thy1a+ PLP139–151-specific T cells transferred into the JE32 transgenic animals when compared with those transferred into control animals. This result suggests that CCL2 overexpression may be preventing the initiation of EAE by inhibiting the reinduction of a Th1-IFN-{gamma} response through the regulation of IL-12Rß2 in PLP139–151-specific T cells.



View larger version (16K):
[in this window]
[in a new window]
  		Figure 8. IL-12Rß2 RNA expression is reduced in encephalitogenic T cells after transfer into JE32 (CCL2) transgenic mice. PLP139–151-specific encephalitogenic SWRxSJL.thy1a+ T cells (SWX) were adoptively transferred into CCL2 transgenic (MCP-1-Tg) or control mice and positively selected from spleens after the onset of disease in the control mice. (A) Positively selected cells from individual animals in each group were then assayed for IL-12Rß2 and G3PDH mRNA expression by RT-PCR. (B) Densitometric analysis, measured by the ratio of IL-12R/G3PDH, was used to quantify the reduced mRNA expression between groups. *, P < 0.05.

 
CCL2 regulation of IL-12Rß2 mRNA expression in vitro
To further support the idea that CCL2 can regulate the development of Th cells by limiting IL-12R expression, we treated CD4+ T cells with CCL2, stimulated them with anti-CD3 and anti-CD28, and then examined the level of IL-12Rß2 mRNA expression. Figure 9 shows a dose-dependent CCL2 attenuation of the mRNA expression of the high-affinity IL-12R. The reduced expression of IL-12Rß2 is statistically significant (P<0.05) at the 100 and 200 ng/ml CCL2 dose, and there is a marked decrease at 50 ng/ml. These data further support the in vivo evidence that CCL2 has the potential to regulate the immune response by limiting a Th1 response through the attenuation of the IL-12R.



View larger version (18K):
[in this window]
[in a new window]
  		Figure 9. CCL2 dose-dependent attenuation of IL-12Rß2 mRNA expression by CD4+ T cells, which were incubated with increasing amounts of CCL2 and stimulated with anti-CD3 in vitro. (A) The amount of IL-12Rß2 and G3PDH mRNA expression was then determined by RT-PCR. (B) The relative amount of IL-12Rß2 RNA was quantified by calculating the densitometric ratio of IL-12Rß2/G3PDH RNA for each treatment dose of CCL2. *, Doses with a significant reduction of IL-12Rß2 RNA when compared with the untreated control (P<0.05). (A) PCR data are representative of the triplicates.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
EAE is a CD4+ Th1-mediated, demyelinating disease of the CNS and serves as an experimental model to dissect pathogenic and regulatory mechanisms of human multiple sclerosis (MS). EAE pathogenesis requires migration of activated T cells from peripheral lymphoid tissue to the CNS, which presumably occurs in a multistep manner. Following activation, T cells leave the peripheral lymphoid tissue by down-regulating expression of CD62L [40 ]. Once in the blood, activated T cells encounter cerebrovascular endothelial cells, which together with pericytes and astrocytic processes, form the blood brain barrier (BBB) [41 ]. The factors involved in this initial step of T cell interaction with endothelium are not well understood; however, encephalitogenic T cells are thought to activate endothelium to express intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 [42 43 44 ]. It is evident that T cell interaction with endothelium through integrins and adhesion molecules is an important event in the pathogenesis of EAE, as disease development can be blocked by treatment with antibodies to the integrins VLA-4 [45 ] and lymphocyte function-associated antigen-1 [46 ] as well as ICAM-1 [47 ]. Therefore, one of the first steps in the pathogenesis of EAE appears to be T cell interaction with and activation of the BBB.

Another essential step in the pathogenesis of tissue-specific, autoimmune, inflammatory diseases is the chemotactic-induced recruitment of leukocytes into the tissue. We [26 , 48 , 49 ] and others [50 51 52 ] demonstrated a relationship between production of chemokines in the CNS and development of acute and relapsing EAE. We further demonstrated the in vivo biological importance for CCL3/macrophage-inflammatory protein-1{alpha} (MIP-1{alpha}) production in the pathogenesis of acute EAE, by showing that disease development could be blocked with anti-MIP-1{alpha} administration at the time of disease induction [9 ], and similarly established a role for CCL2 in the development of relapsing EAE [26 ]. Chemokine expression in the CNS of MS patients has also been described, suggesting a role for these molecules in the pathogenesis of human demyelinating disease [10 , 53 , 54 ]. These results led us to hypothesize that temporally and spatially restricted expression of chemokines regulates demyelinating disease development by controlling the distribution of perivascular- and parenchymal-infiltrating mononuclear cells [25 ].

Beyond regulating leukocyte migration and accumulation in tissue, chemokines govern diverse biologic processes, including T cell activation and effector cytokine secretion [11 ]. In this regard, we have previously demonstrated that CCL2 could induce in vitro Th2 differentiation [16 ] and down-regulate IL-12 expression [27 ]. To extend these results, we sought to explore the in vivo regulatory effects of CCL2 by creating a line of transgenic mice (JE32), which constitutively expressed CCL2 in the CNS. In the present report, we demonstrated that JE32 mice develop significantly decreased, clinical EAE (Fig. 1) and distinctly altered histological EAE (Fig. 2) . It is surprising that these features of inflammatory lesions in JE32 EAE mice were observed, despite the fact that the infiltrates contained increased numbers of monocytes/macrophages (Fig. 3) . The decreased clinical EAE in JE32 mice appeared to be related to impaired antigen-specific T cell proliferation and IFN-{gamma} production, as demonstrated by studying PLN T cells (Fig. 5) and confirmed with intracytoplasmic flow cytometric analysis of CNS-infiltrating CD4+ T cells from JE32 mice and controls (Fig. 6) . The increased numbers of macrophages in the CNS of CCL2 transgenic mice were apparently not activated as determined by a lack of inducible nitric oxide synthase up-regulation (data not shown), consistent with the demonstration of decreased T cell-dependent IFN-{gamma} expression. Collectively, our data argue that constitutive expression of CCL2 in the CNS leads to a profound suppression of the antigen-specific Th1 response. Therefore, despite the presence of enhanced numbers of monocyte/macrophage effector cells in the CNS, JE32 mice exhibit significantly less severe EAE than littermate controls.

There are at least three mechanistic possibilities to explain our results: Constitutive CNS expression of CCL2 abrogates the chemotactic gradient necessary to recruit and/or accumulate effector T cells and/or macrophages in the target organ; we do not think this explains our results, as there are increased numbers of macrophages in the CNS of JE32 transgenic mice (Fig. 3) . The CCL2 transgene is inserted into a gene that is related to disease development; we do not think that this explains the result of decreased clinical disease seen in Figure 1 , as adoptive transfer of in vitro-activated, PLP139–151-specific T cells into JE32 transgenic recipient mice results in decreased clinical disease (Fig. 7) with the accompanying decrease in IFN-{gamma} production (not shown) and decreased levels of IL-12Rß2 expression (Fig. 8) . Therefore, the constitutive CNS expression of CCL2 acts on wild-type antigen-specific T cells to inhibit the Th1 phenotype and thus, disease development. Last, rather, we favor the interpretation that CCL2 acts directly on the induction of Th1 cells to inhibit their ability to express IFN-{gamma}. Support for this idea derives from the results shown in Figure 5 , where CNS CD4+ T cells have a significant reduction in IFN-{gamma} expression, presumably as a result of a decrease in IL-12Rß2 expression (Fig. 7) . Similarly, the experiment in Figure 8 , where adoptively transferred, wild-type PLP139–151-specific donor T cells, sorted from JE32 but not control recipient mice, showed decreased IL-12-Rß2 expression. This could account for the inability of these cells to respond to IL-12 and become IFN-{gamma} secretors, thereby resulting in decreased EAE. We do not believe that CCL2 transgene expression drives the infiltration of regulatory leukocytes secreting regulatory cytokines, as we have never detected increases in IL-4, IL-10, or TGF-ß in the CNS of JE32 mice after EAE induction. Furthermore, we have never detected an increase of CD4+CD25+ regulatory T cells.

The role of CCL2 in the regulation of Th1 immune responses has been described for other in vivo systems. Mouse mammary tumor virus (MMTV)-driven expression of a CCL2 transgene conferred a reduced ability to clear intracellular pathogens, probably as a result of ligand-mediated down-regulation of CCL2 receptors [55 ]. Clearly, the results obtained in studies of the high-level MMTV–long terminal repeat/MCP-1 overexpressors differ from our findings, as EAE in JE32 mice was associated with increased macrophage recruitment and direct regulation of the antigen-specific Th1 cells. The role of CCL2 in regulating in vivo Th2 responses has also been shown by a number of investigators. Antibody depletion of CCL2 resulted in a decreased type 2 granulatomatous response [56 ], and targeted genetic disruption of CCL2 has been shown to abrogate expression of Th2 responses [22 ]. In our experiments, we observed that transgenic CCL2 expression directly down-regulated the Th1-associated IFN-{gamma} response but did not augment IL-4 production [17 ]. The cellular signaling pathways that account for our observations are currently under investigation. Our data raise the possibility of developing molecules with CCL2-like receptor-binding properties that could down-regulate inflammatory effector cytokine expression without enhancing inflammatory cell migration. Such reagents could provide an attractive treatment modality for inflammatory autoimmune diseases such as MS.


   ACKNOWLEDGEMENTS
 
This work was supported by National Institutes of Health (NIH) R01 NS34510 (W. J. K.), NIH T32 AI07476 (J. B. and B. T. F.), National Multiple Sclerosis Society post-doctoral fellowships (A. E. and M. T.), and NIH R01 NS32151 (R. M. R.).

Received August 23, 2004; revised October 8, 2004; accepted October 19, 2004.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Zlotnik, A., Yoshie, O. (2000) Chemokines: a new classification system and their role in immunity Immunity 12,121-127[CrossRef][Medline]
  2. Gosling, J., Slaymaker, S., Gu, L., Tseng, S., Zlot, C. H., Young, S. G., Rollins, B. J., Charo, I. F. (1999) MCP-1 deficiency reduces susceptibility to atherosclerosis in mice that overexpress human apolipoprotein B J. Clin. Invest. 103,773-778[Medline]
  3. Koch, A. E., Kunkel, S. L., Pearce, W. H., Shah, M. R., Parikh, D., Evanoff, H. L., Haines, G. K., Burdick, M. D., Strieter, R. M. (1993) Enhanced production of the chemotactic cytokines interleukin-8 and monocyte chemoattractant protein-1 in human abdominal aortic aneurysms Am. J. Pathol. 142,1423-1431[Abstract]
  4. Kunkel, S. L., Lukacs, N., Kasama, T., Strieter, R. M. (1996) The role of chemokines in inflammatory joint disease J. Leukoc. Biol. 59,6-12[Abstract]
  5. Lukacs, N. W., Strieter, R. M., Chensue, S. W., Kunkel, S. L. (1996) Activation and regulation of chemokines in allergic airway inflammation J. Leukoc. Biol. 59,13-17[Abstract]
  6. Cook, D. N., Beck, M. A., Coffman, T. M., Kirby, S. L., Sheridan, J. F., Pragnell, I. B., Smithies, O. (1995) Requirement of MIP-1{alpha} for an inflammatory response to viral infection Science 269,1583-1585[Abstract/Free Full Text]
  7. Huffnagle, G. B., Strieter, R. M., McNeil, L. K., McDonald, R. A., Burdick, M. D., Kunkel, S. L., Toews, G. B. (1997) Macrophage inflammatory protein-1{alpha} (MIP-1{alpha}) is required for the efferent phase of pulmonary cell-mediated immunity to a Cryptococcus neoformans infection J. Immunol. 159,318-327[Abstract]
  8. Lukacs, N. W., Kunkel, S. L., Strieter, R. M., Warmington, K., Chensue, S. W. (1993) The role of macrophage inflammatory protein 1{alpha} in Shistosoma mansoni egg-induced granulomatous inflammation J. Exp. Med. 177,1551-1559[Abstract/Free Full Text]
  9. Karpus, W. J., Lukacs, N. W., McRae, B. L., Strieter, R. M., Kunkel, S. L., Miller, S. D. (1995) An important role for the chemokine macrophage inflammatory protein-1{alpha} in the pathogenesis of the T cell-mediated autoimmune disease, experimental autoimmune encephalomyelitis J. Immunol. 155,5003-5010[Abstract]
  10. Sorensen, T. L., Tani, M., Jensen, J., Pierce, V., Lucchinetti, C., Folcik, V. A., Qin, S., Rottman, J., Sellebjerg, F., Strieter, R. M., Frederiksen, J. L., Ransohoff, R. M. (1999) Expression of specific chemokines and chemokine receptors in the central nervous system of multiple sclerosis patients J. Clin. Invest. 103,807-815[Medline]
  11. Ward, S. G., Bacon, K., Westwick, J. (1998) Chemokines and T lymphocytes: more than an attraction Immunity 9,1-11[CrossRef][Medline]
  12. Broxmeyer, H. E., Sherry, B., Cooper, S., Lu, L., Maze, R., Beckmann, M. P., Cerami, A., Ralph, P. (1993) Comparative analysis of the human macrophage inflammatory protein family of cytokines (chemokines) on proliferation of human myeloid progenitor cells. Interacting effects involving suppression, synergistic suppression, and blocking of suppression J. Immunol. 150,3448-3458[Abstract]
  13. Bacon, K. B., Premack, B. A., Gardner, P., Schall, T. J. (1995) Activation of dual T cell signaling pathways by the chemokine RANTES Science 269,1727-1730[Abstract/Free Full Text]
  14. Taub, D. D., Turcovski-Corrales, S. M., Key, M. L., Longo, D. L., Murphy, W. J. (1996) Chemokines and T lymphocyte activation: I. ß chemokines costimulate human T lymphocyte activation in vitro J. Immunol. 156,2095-2103[Abstract]
  15. Taub, D. D., Ortaldo, J. R., Turcovski-Corrales, S. M., Key, M. L., Longo, D. L., Murphy, W. J. (1996) ß Chemokines costimulate lymphocyte cytolysis, proliferation, and lymphokine production J. Leukoc. Biol. 59,81-89[Abstract]
  16. Karpus, W. J., Lukacs, N. W., Kennedy, K. J., Smith, W. S., Hurst, S. D., Barrett, T. A. (1997) Differential CC chemokine-induced enhancement of T helper cell cytokine production J. Immunol. 158,4129-4136[Abstract]
  17. Lukacs, N. W., Chensue, S. W., Karpus, W. J., Lincoln, P., Keefer, C., Strieter, R. M., Kunkel, S. L. (1997) C-C chemokines differentially alter interleukin-4 production from lymphocytes Am. J. Pathol. 150,1861-1868[Abstract]
  18. Gao, J. L., Wynn, T. A., Chang, Y., Lee, E. J., Broxmeyer, H. E., Cooper, S., Tiffany, H. L., Westphal, H., Kwon-Chung, J., Murphy, P. M. (1997) Impaired host defense, hematopoiesis, granulomatous inflammation and type 1-type 2 cytokine balance in mice lacking CC chemokine receptor 1 J. Exp. Med. 185,1959-1968[Abstract/Free Full Text]
  19. Broxmeyer, H. E., Cooper, S., Hangoc, G., Gao, J. L., Murphy, P. M. (1999) Dominant myelopoietic effector functions mediated by chemokine receptor CCR1 J. Exp. Med. 189,1987-1992[Abstract/Free Full Text]
  20. Boring, L., Gosling, J., Chensue, S. W., Kunkel, S. L., Farese, R. V., Jr, Broxmeyer, H. E., Charo, I. F. (1997) Impaired monocyte migration and reduced type 1 (Th1) cytokine responses in C-C chemokine receptor 2 knockout mice J. Clin. Invest. 100,2552-2561[Medline]
  21. Lu, B., Rutledge, B. J., Gu, L., Fiorillo, J., Lukacs, N. W., Kunkel, S. L., North, R., Gerard, C., Rollins, B. J. (1998) Abnormalities in monocyte recruitment and cytokine expression in monocyte chemoattractant protein 1-deficient mice J. Exp. Med. 187,601-608[Abstract/Free Full Text]
  22. Gu, L., Tseng, S., Horner, R. M., Tam, C., Loda, M., Rollins, B. J. (2000) Control of TH2 polarization by the chemokine monocyte chemoattractant protein-1 Nature 404,407-411[CrossRef][Medline]
  23. Rollins, B. J., Morriso, E. D., Stiles, C. D. (1988) Cloning and expression of JE, a gene inducible by platelet-derived growth factor and whose product has cytokine-like properties Proc. Natl. Acad. Sci. USA 85,3738-3742[Abstract/Free Full Text]
  24. Ernst, C. A., Zhang, Y. J., Hancock, P. R., Rutledge, B. J., Corless, C. L., Rollins, B. J. (1994) Biochemical and biologic characterization of murine monocyte chemoattractant protein-1 J. Immunol. 152,3541-3549[Abstract]
  25. Karpus, W. J., Ransohoff, R. M. (1998) Chemokine regulation of experimental autoimmune encephalomyelitis: temporal and spatial expression patterns govern disease pathogenesis J. Immunol. 161,2667-2671[Abstract/Free Full Text]
  26. Kennedy, K. J., Strieter, R. M., Kunkel, S. L., Lukacs, N. W., Karpus, W. J. (1998) Acute and relapsing experimental autoimmune encephalomyelitis are regulated by differential expression of the CC chemokines macrophage inflammatory protein-1{alpha} and monocyte chemotactic protein-1 J. Neuroimmunol. 92,98-108[CrossRef][Medline]
  27. Karpus, W. J., Kennedy, K. J., Kunkel, S. L., Lukacs, N. W. (1998) Monocyte chemotactic protein 1 regulates oral tolerance induction by inhibition of T helper cell 1-related cytokines J. Exp. Med. 187,733-741[Abstract/Free Full Text]
  28. Fife, B. T., Huffnagle, G. B., Kuziel, W. A., Karpus, W. J. (2000) CC chemokine receptor 2 is critical for induction of experimental autoimmune encephalomyelitis J. Exp. Med. 192,899-906[Abstract/Free Full Text]
  29. Izikson, L., Klein, R. S., Charo, I. F., Weiner, H. L., Luster, A. D. (2000) Resistance to experimental autoimmune encephalomyelitis in mice lacking the CC chemokine receptor (CCR)2 J. Exp. Med. 192,1075-1080[Abstract/Free Full Text]
  30. Sato, N., Ahuja, S. K., Quinones, M., Kostecki, V., Reddick, R. L., Melby, P. C., Kuziel, W. A., Ahuja, S. S. (2000) CC chemokine receptor (CCR)2 is required for Langerhans cell migration and localization of T helper cell type 1 (Th1)-inducing dendritic cells: absence of CCR2 shifts the Leishmania major-resistant phenotype to a susceptible state dominated by Th2 cytokines, B cell outgrowth, and sustained neutrophilic inflammation J. Exp. Med. 192,205-218[Abstract/Free Full Text]
  31. Bennett, J. L., Elhofy, A., Dal Canto, M. C., Tani, M., Ransohoff, R. M., Karpus, W. J. (2003) CCL2 transgene expression in the central nervous system directs diffuse infiltration of CD45highCD11b+ monocytes and enhanced Theiler’s murine encephalomyelitis virus-induced demyelinating disease J. Neurovirol. 9,623-636[Medline]
  32. Fuentes, M. E., Durham, S. K., Swerdel, M. R., Lewin, A. C., Barton, D. S., Megill, J. R., Bravo, R., Lira, S. A. (1995) Controlled recruitment of monocytes and macrophages to specific organs through transgenic expression of monocyte chemoattractant protein-1 J. Immunol. 155,5769-5776[Abstract]
  33. Huang, D., Tani, M., Wang, J., Han, Y., He, T. T., Weaver, J., Charo, I. F., Tuohy, V. K., Rollins, B. J., Ransohoff, R. M. (2002) Pertussis toxin-induced reversible encephalopathy dependent on monocyte chemoattractant protein-1 overexpression in mice J. Neurosci. 22,10633-10642[Abstract/Free Full Text]
  34. Ford, A. L., Goodsall, A. L., Hickey, W. F., Sedgwick, J. D. (1995) Normal adult ramified microglia separated from other central nervous system macrophages by flow cytometric sorting. Phenotypic differences defined and direct ex vivo antigen presentation to myelin basic protein-reactive CD4+ T cells compared J. Immunol. 154,4309-4321[Abstract]
  35. Pope, J. G., Karpus, W. J., VanderLugt, C., Miller, S. D. (1996) Flow cytometric and functional analyses of central nervous system-infiltrating cells in SJL/J mice with Theiler’s virus-induced demyelinating disease. Evidence for a CD4+ T cell-mediated pathology J. Immunol. 156,4050-4058[Abstract]
  36. Braun, M. C., Lahey, E., Kelsall, B. L. (2000) Selective suppression of IL-12 production by chemoattractants J. Immunol. 164,3009-3017[Abstract/Free Full Text]
  37. Constantinescu, C. S., Wysocka, M., Hilliard, B., Ventura, E. S., Lavi, E., Trinchieri, G., Rostami, A. (1998) Antibodies against IL-12 prevent superantigen-induced and spontaneous relapses of experimental autoimmune encephalomyelitis J. Immunol. 161,5097-5104[Abstract/Free Full Text]
  38. Zhang, G. X., Yu, S., Gran, B., Li, J., Siglienti, I., Chen, X., Calida, D., Ventura, E., Kamoun, M., Rostami, A. (2003) Role of IL-12 receptor {ß}1 in regulation of T cell response by APC in experimental autoimmune encephalomyelitis J. Immunol. 171,4485-4492[Abstract/Free Full Text]
  39. Chang, J. T., Shevach, E. M., Segal, B. M. (1999) Regulation of interleukin (IL)-12 receptor ß 2 subunit expression by endogenous IL-12: a critical step in the differentiation of pathogenic autoreactive T cells J. Exp. Med. 189,969-978[Abstract/Free Full Text]
  40. Springer, T. A. (1994) Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm Cell 76,301-314[CrossRef][Medline]
  41. Hartung, H. P., Rieckmann, P. (1997) Pathogenesis of immune-mediated demyelination in the CNS J. Neural Transm. Suppl. 50,173-181[Medline]
  42. Rosenman, S. J., Shrikant, P., Dubb, L., Benveniste, E. N., Ransohoff, R. M. (1995) Cytokine-induced expression of vascular adhesion molecule-1 (VCAM-1) by astrocytes and astrocytoma cell lines J. Immunol. 154,1888-1899[Abstract]
  43. Lou, J., Dayer, J. M., Grau, G. E., Burger, D. (1996) Direct cell/cell contact with stimulated T lymphocytes induces the expression of cell adhesion molecules and cytokines by human brain microvascular endothelial cells Eur. J. Immunol. 26,3107-3113[Medline]
  44. Powell, M. B., Mitchell, D., Lederman, J., Buckmeier, J., Zamvil, S. S., Graham, M., Ruddle, N. H., Steinman, L. (1990) Lymphotoxin and tumor necrosis factor-{alpha} production by myelin basic protein-specific T cell clones correlates with encephalitogenicity Int. Immunol. 2,539-544[Abstract/Free Full Text]
  45. Yednock, T. A., Cannon, C., Fritz, L. C., Sanchez-Madrid, F., Steinman, L., Karin, N. (1992) Prevention of experimental autoimmune encephalomyelitis by antibodies against {alpha}4ß1 integrin Nature 356,63-66[CrossRef][Medline]
  46. Kobayashi, Y., Kawai, K., Honda, H., Tomida, S., Niimi, N., Tamatani, T., Miyasaka, M., Yoshikai, Y. (1995) Antibodies against leukocyte function-associated antigen-1 and against intercellular adhesion molecule-1 together suppress the progression of experimental allergic encephalomyelitis Cell. Immunol. 164,295-305[CrossRef][Medline]
  47. Morrissey, S. P., Deichmann, R., Syha, J., Simonis, C., Zettl, U., Archelos, J. J., Jung, S., Stodal, H., Lassmann, H., Toyka, K. V., Haase, A., Hartung, H. P. (1996) Partial inhibition of AT-EAE by an antibody to ICAM-1: clinico-histological and MRI studies J. Neuroimmunol. 69,85-93[CrossRef][Medline]
  48. Ransohoff, R. M., Hamilton, T. A., Tani, M., Stoler, M. H., Shick, H. E., Major, J. A., Estes, M. L., Thomas, D. M., Tuohy, V. K. (1993) Astrocyte expression of mRNA encoding cytokines IP-10 and JE/MCP-1 in experimental autoimmune encephalomyelitis FASEB J. 7,592-600[Abstract]
  49. Glabinski, A. R., Tani, M., Tuohy, V. K., Ransohoff, R. M. (1997) Murine experimental autoimmune encephalomyelitis: a model of immune-mediated inflammation and multiple sclerosis Methods Enzymol. 288,182-190[Medline]
  50. Hulkower, K., Brosnan, C. F., Aquino, D. A., Cammer, W., Kulshrestha, S., Guida, M. P., Rapoport, D. A., Berman, J. W. (1993) Expression of CSF-1, c-fms, and MCP-1 in the central nervous system of rats with experimental allergic encephalomyelitis J. Immunol. 150,2525-2533[Abstract]
  51. Godiska, R., Chantry, D., Dietsch, G. N., Gray, P. W. (1995) Chemokine expression in murine experimental allergic encephalomyelitis J. Neuroimmunol. 58,167-176[CrossRef][Medline]
  52. Juedes, A. E., Hjelmstrom, P., Bergman, C. M., Neild, A. L., Ruddle, N. H. (2000) Kinetics and cellular origin of cytokines in the central nervous system: insight into mechanisms of myelin oligodendrocyte glycoprotein-induced experimental autoimmune encephalomyelitis J. Immunol. 164,419-426[Abstract/Free Full Text]
  53. Hvas, J., McLean, C., Justesen, J., Kannourakis, G., Steinman, L., Oksenberg, J. R., Bernard, C. C. A. (1997) Perivascular T cells express the pro-inflammatory chemokine RANTES mRNA in multiple sclerosis lesions Scand. J. Immunol. 46,195-203[CrossRef][Medline]
  54. Van, D. V., Tekstra, J., Beelen, R. H., Tensen, C. P., Van, D. V., De, G. C. (1999) Expression of MCP-1 by reactive astrocytes in demyelinating multiple sclerosis lesions Am. J. Pathol. 154,45-51[Abstract/Free Full Text]
  55. Gu, L., Rutledge, B., Fiorillo, J., Ernst, C., Grewal, I., Flavell, R., Gladue, R., Rollins, B. (1997) In vivo properties of monocyte chemoattractant protein-1 J. Leukoc. Biol. 62,577-580[Abstract]
  56. Chensue, S. W., Warmington, K. S., Ruth, J. H., Sanghi, P. S., Lincoln, P., Kunkel, S. L. (1996) Role of monocyte chemoattractant protein-1 (MCP-1) in Th1 (mycobacterial) and Th2 (schistosomal) antigen-induced granuloma formation. Relationship to local inflammation, Th cell expression, and IL-12 production J. Immunol. 157,4602-4608[Abstract]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
T. Touil, D. Fitzgerald, G.-X. Zhang, A. Rostami, and B. Gran
Cutting Edge: TLR3 Stimulation Suppresses Experimental Autoimmune Encephalomyelitis by Inducing Endogenous IFN-beta
J. Immunol., December 1, 2006; 177(11): 7505 - 7509.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0804465v1
77/2/229    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elhofy, A.
Right arrow Articles by Karpus, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elhofy, A.
Right arrow Articles by Karpus, W. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS