Published online before print September 17, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


* Texas A&M University System Health Science Center, Department of Medical Microbiology & Immunology, College Station, and
Institute of Biosciences and Technology, Houston, Texas; and
National Cancer Institute, Frederick, Maryland
1 Correspondence: Department of Medical Microbiology and Immunology, Texas A&M University System Health Science Center, 407 Reynolds Medical Building, College Station, TX 77843-1114. E-mail address: skwor{at}medicine.tamu.edu
|
|
|---|
(TNF-
), interleukin (IL)-1ß, CCL2 (monocyte chemoattractant protein-1), and CXC chemokine ligand 8 (IL-8) were analyzed by reverse transcription followed by real-time polymerase chain reaction analysis using SYBR Green. Bioactive TNF-
protein concentration was measured using the L929 bioassay. Both macrophage populations displayed significant enhancement of all the genes and TNF-
protein levels when stimulated with rgpCCL5, except for CCL2 in alveolar macrophages. When peritoneal or alveolar macrophages were pretreated with rgpCCL5 for 2 h and then exposed to low concentrations of LPS, diminished cytokine and chemokine mRNA levels were apparent at 6 h compared with LPS alone. At the protein level, there was a reduction in TNF-
protein at 6 h in the CCL5-pretreated cells compared with LPS alone. These results further support a role for CCL5 in macrophage activation in addition to chemotactic properties and suggest a role in regulating the inflammatory response to LPS in the guinea pig by modulating the production of proinflammatory cytokines by macrophages.
Key Words: IL-1ß lipopolysaccharide TNF-
CXCL8 CCL2
|
|
|---|
(MIP-1
)], and CCL4 (MIP-1ß) have been shown to activate macrophages [1
2
3
4
] and T lymphocytes [4
5
6
7
8
9
]. The differentiation of helper T lymphocytes into polarized T helper cell type 1 (Th1) and Th2 cytokine-producing subpopulations has been shown to be regulated by numerous chemokines, including CCL5 [1
]. This chemokine is chemotactic for eosinophils [10
], basophils [11
], dendritic cells [12
], macrophages/monocytes [2
, 13
], and T lymphocytes [13
], including those of the Th1 phenotype [14
]. The diverse physiological roles of CCL5 might be a result of the large family of receptors through which it can signal. Many of these receptor interactions are determined by the concentration of CCL5 present. CCL5 has been shown to interact with the G-coupled protein receptors CC chemokine receptor (CCR)1, -3, -4, and -5 at low concentrations [15 ], and at higher concentrations, it appears to bind to glycosaminoglycans (GAG) [16 ] and CD44 [17 ]. These various receptor interactions may allow CCL5 to trigger diverse cellular responses.
Lipopolysaccharide (LPS) induces a pronounced inflammatory response, which can eventually lead to septic shock syndrome [18 ]. Previous studies have demonstrated that LPS up-regulates numerous cytokines and chemokines in naive macrophages [19 20 21 22 23 ]. These molecules proceed to activate neighboring cells, resulting in a cascade of events leading to the recruitment of leukocytes to the site of infection. Chemokines are the primary inducers of leukocyte accumulation. It is likely that leukocytes leaving the circulation to enter an inflammatory tissue focus would encounter host chemokines before interacting with products of an invading pathogen.
Previously, we have demonstrated that guinea pig (gp)CXC chemokine ligand 8 (CXCL8) [interleukin (IL-8)], CCL2 (monocyte chemoattractant protein-1), and CCL5 mRNA expression and/or secretion were enhanced in macrophages cultured with LPS or Mycobacterium tuberculosis [21
, 24
]. In the present studies, the role of gpCCL5 on macrophages was further investigated, and its ability to induce tumor necrosis factor
(TNF-
), IL-1ß, CCL2, and CXCL8 expression in alveolar and peritoneal macrophages was evaluated. In addition, we examined the effect of pretreatment with CCL5 on the ability of macrophages to respond to subsequent stimulation with LPS.
|
|
|---|
Animals
Specific, pathogen-free, outbred, male and female Hartley guinea pigs from Charles River Breeding Laboratories (Wilmington, MA) were used in this study. They were housed in polycarbonate cages within an air-filtered environment under a 12-h light-dark cycle. Food (Ralston Purina, St. Louis, MO) and tap water were supplied to the animals ad libitum. All procedures were reviewed and approved by the Texas A&M University Laboratory Animal Care Committee (College Station).
Isolation of macrophages
Guinea pigs were killed by two 1.5 ml intramuscular injections of sodium pentobarbital (100 mg/ml; Sleepaway euthanasia solution, Fort Dodge Laboratories, IA). To obtain peritoneal exudate cells (PEC), guinea pigs were injected intraperitoneally with 5 ml 3% sodium thioglycollate (Becton Dickinson, Cockeysville, MD) 4 days before euthanasia. Guinea pigs not injected with sodium thioglycollate were used as a source of resident peritoneal macrophages. The abdominal and thoracic cavities were opened aseptically. The peritoneal cavity was flushed twice with 30 ml cold phosphate-buffered saline (PBS) with 10 U/ml heparin and 2% fetal bovine serum (FBS) to obtain PEC and resident peritoneal macrophages. Alveolar macrophages were obtained by exposing the trachea and inserting an 18-gauge cannula fixed to a 20-ml syringe. The bronchoalveolar lavage (BAL) was performed by filling the lungs with cold 12 mM lidocaine in PBS with 3% FBS as described previously [21
]. Cells were pelleted by centrifuging at 380 g for 10 min. These pellets were washed twice with RPMI-1640 medium without phenol red, supplemented with 10% FBS, 10 µM 2-mercaptoethanol, and 2 µM L-glutamine (RPMI complete medium). The cells were resuspended in 1 ml RPMI complete medium, and viable cells were enumerated on a hemacytometer by the trypan blue exclusion method. Cells from BAL were resuspended at 1 x 106 cells/ml, resident peritoneal cells at 1.5 x 106 cells/ml, and PEC at a concentration of 5 x 106 cells/ml in RPMI complete medium.
Chemotaxis assay for rgpCCL5 bioactivity
Chemotaxis was performed using ChemoTx (Neuroprobe, Inc., Gaithersburg, MD) disposable chemotaxis systems containing 5 µm pore-size polycarbonate filters, following modified instructions from the manufacturer. Briefly, PEC were resuspended in RPMI 1640 with 0.1% bovine serum albumin (RPMI-BSA) at a concentration of 5 x 106 cells/ml. Dilutions of N-formyl-Met-Leu-Phe (fMLP; Sigma Chemical Co., St. Louis, MO) and rgpCCL5 were made in RPMI-BSA and added to the wells of a 96-well plate. The polycarbonate filter was then placed on the plate and checked to ensure that the fluid in each well was in contact with the filter. The cells were then added to the top of the filter in a 50-µl vol containing 2.5 x 105 cells/well. Chemotaxis was performed at 37°C in 5% CO2 for 2 h. Fluid on top of the filter was aspirated, and cold PBS with 0.5 M EDTA was added and incubated at 4°C for 30 min. Cotton swabs were used to wipe off any cells remaining on the top of the filters. Plates were centrifuged for 430 g for 10 min to dislodge any remaining cells bound to the underside of the filter. The filter plate was removed, and 150 ul was aspirated from each well. A tetrazolium salt, 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT; Sigma Chemical Co.), was added at 5 mg/ml to each well and allowed to incubate for 2 h at 37°C in 5% CO2. Plates were centrifuged at 140 g for 5 min, and supernatants were aspirated. Warm lysis buffer (50% 2-2 dimethylformamide and 20% SDS at pH 4.7) was added to each well and allowed to incubate for 4 h at 37°C and 5% CO2. This colormetric assay was then read at 570 nm using a Dynatech MR5000 automated plate reader and analyzed with Biolinx software, Version 2.1 (Dynatech Laboratories, Chantilly, VA).
Macrophage stimulation
Cells from the BAL and peritoneal cavity were plated on 96-well plates and allowed to adhere for 1.5 h at 37°C in a 5% CO2 incubator. Nonadherent cells were aspirated, and the adherent cells were washed with RPMI complete medium. Adherent macrophages were stimulated with rgpCCL5 at different concentrations (1.35, 405, 1350, and 4050 ng/ml) for 2 h and 6 h. To examine the priming effect of rgpCCL5 on the response to LPS, macrophages were preincubated with 1350 ng/ml rgpCCL5 for 2 h. The cells were then exposed to LPS (10 ng/ml), and samples were collected at 2 h and 6 h post-LPS exposure. At each time-point, supernatants were collected and stored at 70°C until analyzed for TNF-
by the L929 bioassay, and total RNA was isolated using the RNeasy kit (Qiagen, Valencia, CA) with the addition of RNase-free DNase, according to the manufacturers instructions.
Real time-polymerase chain reaction for cytokine mRNA
Reverse transcription was performed on 15 µg total RNA using TaqMan reverse transcription reagents (Applied Biosystems, Foster City, CA). Negative controls were performed to ensure that PCR amplification of cDNA was not a result of contaminating, genomic DNA. Real time-PCR analysis was performed on the cDNA using SYBR Green I (Applied Biosystems) following a previously published protocol [21
]. Primer Express software (Applied Biosystems) was used to design the sequences for guinea pig hypoxanthine phosphoribosyltransferase (HPRT; forward primer, AGGTGTTTATCCCTCATGGACTAATT; reverse primer, CCTCCCATCTCCTTCATCACAT) and guinea pig IL-1ß (forward primer, GCCCAGGCAACAGCTCTC; reverse primer, GGAGTCTCTACCAGCTCAACTTGG). The sequences for TNF-
, CXCL8, and CCL2 primers were described previously [21
, 26
]. Real-time PCR was performed using the Applied Biosystems Prism 7700 sequence detector following the manufacturers instructions. Results were expressed as fold induction of mRNA, which was determined by normalizing cytokine threshhold cycle values against HPRT values. This was normalized further against samples from unstimulated cells at 0 h.
L929 bioassay
The concentration of bioactive TNF-
protein in macrophage culture supernatants was measured by cytotoxicity on L929 fibroblasts [27
]. Briefly, L929 cells were plated into 96-well plates in RPMI 1640 without phenol red supplemented with 2 µM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin/ml, and 2% FBS. Serial twofold dilutions of supernatants in 8 µg/ml actinomycin D were added to each well and incubated for 20 h. Cells were incubated for an additional 2 h at 37°C + 5% CO2 after the addition of WST-1 (6 mM)/1-methoxymethyl phenazium methylsulfate (0.4 mM; Dojindo, Kumamoto, Japan). The color development was halted with 1 N H2SO4, and the optical densities (OD) were measured at OD450 and OD630. Human recombinant (hr)TNF-
(R&D Systems, Minneapolis, MN) was used to derive a standard curve, and all samples were expressed as the 50% cytotoxicity value based on the standard curve.
Statistical analysis
ANOVA was used to determine statistical significance between mean differences of rgpCCL5-treated and untreated macrophages at a 95% confidence interval using Duncan post hoc analysis. A two-tailed t-test was used to determine statistical significance at a 95% confidence interval between the rgpCCL5-prestimulated group and naive macrophages cultured with LPS. The statistical tests were performed using SAS software (Release 8.01, SAS Institute, Cary, NC).
|
|
|---|
14 kDa on a 1020% tris-tricine gel after SDS-PAGE analysis (Fig. 1A
, lane 8). The fusion protein was then exposed to Factor Xa protease to obtain the mature form of gpCCL5. Cleavage by the endoproteinase resulted in three bands on SDS-PAGE analysis (Fig. 1A
, lane 9), suggesting an uncut, improperly cut, and mature recombinant protein. The amino acid compositions were determined using Edman degradation. The improperly cut protein (
12 kDa) appeared to have a 5'-terminal amino acid sequence GSGMKE, which suggested the protein was improperly cleaved at the thrombin site found in the fusion peptide. The
8 kDa mature protein was sequenced and contained SPYASD hexa-peptide on the 5' end, verifying that it was the mature form of gpCCL5. Separation of these proteins was performed by retarding the acetonitrile gradient between 25% and 42% on reverse-phase HPLC, resulting in two distinct peaks (Fig. 1C)
. The first peak appeared to contain all three forms of the recombinant protein after SDS-PAGE analysis (Fig. 1A
, lane 9). However, the second peak contained mature CCL5 alone at greater than 99% purity (Fig. 1C
, peak b; Fig. 1A
, lane 10).
![]() View larger version (47K): [in a new window] |
Figure 1. SDS-PAGE analysis was used to trace rgpCCL5 through the expression and purification process (A). Lane 1, Low molecular weight ladder; lane 2, uninduced, total E. coli proteins; lane 3, cellular proteins from 0.1 mM IPTG-induced E. coli; lane 4, secreted proteins from induced cultures; lane 5, soluble proteins from E. coli lysate; lane 6, insoluble proteins from E. coli lysate; lane 7, proteins after refolding; lane 8, purification of rgpCCL5 uncut from inclusion body proteins after reverse-phase high-pressure liquid chromatography (HPLC; B); lane 9, protein obtained from peak a (C); lane 10, mature rgpCCL5 purified from peak b (C) after reverse-phase HPLC (rgpCCL5). Reverse-phase HPLC displayed purification of rgpCCL5 with fusion peptide between 40% and 50% acetonitrile concentrations (B). Following cleavage with Factor Xa, the fusion peptide and mature rgpCCL5 were separated by running solution over reverse-phase HPLC (C).
|
![]() View larger version (12K): [in a new window] |
Figure 2. Chemotactic abilities of rgpCCL5 were assessed by determining the migration of PEC in vitro to varying concentrations of recombinant protein and fMLP against media (RPMI+0.1% BSA) alone. Cell migration was determined using MTT viability assay after the cells were dislodged from the filters. Results are displayed as the mean ± SEM for three experiments, each containing quadruplicate wells per concentration tested. *, Significant differences (P<0.05) were seen in migration of chemotactic agents compared with media alone, and ** (P<0.05) displayed significance between chemotactic concentrations using ANOVA.
|
and IL-1ß, were significantly enhanced at 2 h post-rgpCCL5 exposure compared with media alone (Fig. 3A
, and 3B)
. This effect was optimal at 1350 ng/ml rgpCCL5 compared with the other concentrations tested. After 6 h, TNF-
mRNA levels swiftly declined, but IL-1ß levels tapered off to a lesser extent (Fig. 3A
, and 3B)
. In comparison, LPS (10 ng/ml)-stimulated resident peritoneal macrophages resulted in 42.62 ± 11.95- and 11.21 ± 4.57-fold induction for TNF-
mRNA at 2 h and 6 h, respectively, and IL-1ß mRNA increased to 6.87 ± 0.64- and 5.99 ± 1.32-fold induction at similar time intervals.
![]() View larger version (22K): [in a new window] |
Figure 3. Peritoneal macrophage activation by rgpCCL5 as evaluated by cytokine and chemokine mRNA expression. Expression of TNF- (A), IL-ß (B), CCL2 (C), and CXCL8 (D) mRNA was determined at 2 h and 6 h after rgpCCL5 (1.35, 405, 1350, and 4050 ng/ml) stimulation via real-time PCR. Data represent the mean ± SEM for three to four experiments. *, Significant differences (P<0.05) between rgpCCL5 and media alone (RPMI+10% FBS); **, significance (P<0.05) between different concentrations of rgpCCL5 at the same time-points. Statistical analysis was performed using ANOVA.
|
and IL-1ß mRNA. At 2 h post-exposure to rgpCCL5, CXCL8 and CCL2 mRNA levels were significantly elevated compared with untreated cells. The stimulatory effect was short-lived, and at 6 h, these levels had declined (Fig. 3C
, and 3D)
. LPS (10 ng/ml) was used as a positive control with these chemokines resulting in 7.22 ± 2.78 and 7.44 ± 3.3 CCL2 mRNA-fold induction at 2 h and 6 h, respectively, from stimulated resident peritoneal macrophages. CXCL8 mRNA-fold induction levels were also heightened in these samples to 23.26 ± 5.00 and 18.48 ± 7.16 at similar time-points.
The diverse biological properties of different macrophage populations [30
31
32
33
] prompted us to extend our studies of the stimulatory effect of rgpCCL5 to alveolar macrophages, a cell type that we have studied previously and is relevant to our focus about the pathogenesis of pulmonary tuberculosis in the guinea pig model [21
, 34
]. Figure 4
illustrates mRNA levels for TNF-
, IL-1ß, CCL2, and CXCL8 in alveolar macrophages stimulated with rgpCCL5. At 1350 ng/ml, rgpCCL5 significantly enhanced mRNA levels of TNF-
and IL-1ß compared with all other concentrations tested (Fig. 4A
, and 4B)
. At 6 h, these levels fell in a manner similar to that observed in resident peritoneal macrophages. However, this kinetic pattern was not repeated with alveolar macrophages stimulated with LPS (10 ng/ml). TNF-
mRNA-fold induction levels increased from 2 h (67.1±33.53) to 6 h (108.45±27.02), and IL-1ß mirrored similar patterns with mRNA-fold induction levels increasing from 28.38 ± 11.55 to 112.98 ± 39.95 at 2 h and 6 h, respectively. Chemokines were evaluated in alveolar macrophages in response to rgpCCL5 stimulation. CXCL8 mRNA levels were enhanced significantly with rgpCCL5 at 1350 ng/ml in alveolar macrophages at 2 h and 6 h following stimulation, a kinetic pattern that differed from peritoneal macrophages. Fold-induction levels of CXCL8 mRNA from LPS (10 ng/ml)-stimulated alveolar macrophages were 52.92 ± 23.34 at 2 h and 234.83 ± 88.28 at 6 h. CCL2 mRNA expression was not increased significantly by stimulation with rgpCCL5 compared with media alone, although mRNA levels were higher at all concentrations tested. In contrast, LPS-stimulated alveolar macrophages produced elevated levels of CCL2 mRNA at 2 h (5.33±1.21) and at 6 h (14.15±3.95).
![]() View larger version (22K): [in a new window] |
Figure 4. Alveolar macrophage activation by rgpCCL5 was represented by enhanced mRNA levels of cytokine and chemokine genes. Stimulation was assessed at 2 h and 6 h for enhanced levels of TNF- (A), IL-ß (B), CCL2 (C), and CXCL8 (D) mRNA using real-time PCR. Data represent the mean ± SEM of three experiments. **, Significance (P<0.05) between rgpCCL5 concentrations and media alone. Significance was determined by ANOVA analyzing data at relative time-points.
|
levels were assessed in macrophages treated with rgpCCL5. Resident peritoneal macrophages stimulated with rgpCCL5 displayed significantly enhanced levels of bioactive TNF-
protein at 2 h and 6 h following stimulation with all concentrations of rgpCCL5 tested (1.35, 405, 1350, and 4050 ng/ml) compared with media alone (Fig. 5A)
. However, in alveolar macrophages exposed to the same stimulants, TNF-
protein levels followed the same narrow rgpCCL5 concentration kinetics as seen in mRNA levels with significantly higher levels of protein at 2 h in response to 1350 ng/ml rgpCCL5 compared with all other lower concentrations tested (Fig. 5B)
. At 6 h, this pattern was repeated, and 1350 ng/ml rgpCCL5 induced significantly higher TNF-
protein levels than all other concentrations tested (Fig. 5B)
.
![]() View larger version (20K): [in a new window] |
Figure 5. TNF- protein levels from resident peritoneal (A) and alveolar (B) macrophages stimulated with rgpCCL5. The L929 bioassay was used to determine TNF- protein concentrations. Data represent mean ± SEM from three to four experiments. *, Significance (P<0.05) of rgpCCL5 compared with media alone; **, significance (P<0.05) between concentrations. Statistical analysis was performed using ANOVA.
|
, IL-1ß, CCL2, and CXCL8 in resident peritoneal macrophages prestimulated with rgpCCL5 (1350 ng/ml) for 2 h and then exposed to a low concentration of LPS (10 ng/ml) for 2 h or 6 h. Post-LPS stimulation (2 h and 6 h), TNF-
mRNA was diminshed by nearly 40% in peritoneal macrophages prestimulated with rgpCCL5 compared with mRNA levels in cells not exposed to rgpCCL5 (Fig. 6A)
. CCL2 mRNA was enhanced modestly (30% increased) in the rgpCCL5-pretreated macrophages at 2 h post-LPS stimulation; however, by 6 h, the levels had fallen significantly (Fig. 6C)
. Levels of mRNA for IL-1ß and CXCL8 were minimally affected by rgpCCL5 pretreatment at 2 h, but at 6 h post-LPS stimulation, they were diminished modestly in rgpCCL5-pretreated cultures (Fig. 6B
, and 6D)
.
![]() View larger version (16K): [in a new window] |
Figure 6. Regulation of LPS-induced cytokine and chemokine mRNA expression in guinea pig peritoneal macrophages by pretreatment with rgpCCL5. Expression of TNF- (A), IL-ß (B), CCL2 (C), and CXCL8 (D) mRNA was assessed by real-time PCR. Cells were pretreated with 1350 ng/ml rgpCCL5 for 2 h and then stimulated with LPS (10 ng/ml) for 2 h or 6 h. Results are expressed as mean ± SEM of the ratios of mRNA in rgpCCL5-pretreated over untreated cells of three to four experiments. *, Significance (P<0.05) between ratios at different time-points was determined using Students t-test.
|
mRNA levels were reduced by 40% at 2 h post-LPS stimulation in rgpCCL5-pretreated macrophages compared with untreated, LPS-stimulated alveolar macrophages (Fig. 7A)
. However, IL-1ß, CCL2, and CXCL8 mRNA levels displayed a different trend. At 2 h, rgpCCL5-pretreated alveolar macrophages had slightly higher mRNA levels than alveolar macrophages not exposed to rgpCCL5. This trend was reversed at 6 h post-LPS stimulation when all rgpCCL5-pretreated macrophages expressed lower mRNA levels compared with LPS alone. This change in mRNA expression levels between 2 h and 6 h is significant in pretreated alveolar macrophages for CCL2 (P=0.067) and CXCL8 (P<0.02).
![]() View larger version (19K): [in a new window] |
Figure 7. Regulation of LPS-induced cytokine and chemokine mRNA expression in guinea pig alveolar macrophages by pretreatment with rgpCCL5. Expression of TNF- (A), IL-ß (B), CCL2 (C), and CXCL8 (D) mRNA was assessed by real-time RT-PCR. Cells were pretreated with 1350 ng/ml rgpCCL5 for 2 h and then stimulated with LPS (10 ng/ml) for 2 h or 6 h. Results are expressed as mean ± SEM of the ratios of mRNA in rgpCCL5-pretreated over untreated cells of three to four experiments. *, Significance (P<0.05) between ratios at different time-points was determined using Students t-test.
|
protein produced between alveolar and peritoneal macrophages tested with rgpCCL5 or untreated following stimulation with LPS. Resident peritoneal macrophages produced significantly more bioactive TNF-
protein levels at 2 h post-LPS stimulation in cells pretreated with rgpCCL5 (Fig. 8A)
. However, this pattern was reversed at 6 h with TNF-
levels becoming stagnant in rgpCCL5-pretreated macrophages compared with the enhanced expression in macrophages exposed to LPS alone. This trend was present in alveolar macrophages as well, but as a result of the variability between animals, statistical significance was not reached (Fig. 8C)
. Both macrophage populations displayed minimal alterations in TNF-
protein levels at 6 h post-LPS stimulation in cells primed with rgpCCL5 (1350 ng/ml) compared with 2 h (Fig. 8A
, and 8C)
. A significant difference was seen when comparing the ratios of TNF-
protein in rgpCCL5-pretreated versus untreated macrophages following LPS stimulation. The ratio (treated/untreated) at 2 h was significantly greater than at 6 h (Fig. 8B
, and 8D)
, suggesting CCL5 has the ability to enhance TNF-
protein production immediately; however, production declines thereafter. This trend was seen in both macrophage populations.
![]() View larger version (19K): [in a new window] |
Figure 8. Regulation of LPS-induced TNF- protein production by rgpCCL5 pretreatment in peritoneal (A) or alveolar (C) macrophages. Macrophages were pretreated with 1350 ng/ml rgpCCL5 for 2 h followed by stimulation with 10 ng/ml LPS for 2 h or 6 h. Supernatants were assessed for TNF- protein levels using the L929 bioassay. (A and C) Data are the mean ± SEM of TNF- protein concentrations (ng/ml) from four experiments. The ratios of TNF- protein concentration of rgpCCL5-pretreated/untreated cells are represented in peritoneal (B) and alveolar (D) macrophages. *, Significant differences (P<0.05) between LPS-stimulated macrophages from rgpCCL5 pretreated versus LPS alone at similar time-points. **, Significance (P<0.005) between TNF- protein production at 2 h versus 6 h with the same stimulus (A and C) or significance between the average ratios (LPS+rgpCCL5/LPS) of 2 h and 6 h (B and D). Statistics were performed using the Students t-test.
|
|
|
|---|
Our data show that rgpCCL5 significantly enhanced IL-1ß and TNF-
mRNA levels (Figs. 3A
, and 3B
, and, 4A
and 4B)
as well as TNF-
protein production (Fig. 5A
, and 5B)
compared with media alone in resident peritoneal and alveolar macrophages isolated from guinea pigs. This is the first time CCL5 has been shown to stimulate the expression of both proinflammatory cytokines in tissue-specific macrophages. The ability of CCL5 to enhance IL-1ß mRNA is in agreement with a previous study investigating human nonadherent monocytes exposed to recombinant CCL5 [38
]. hrCCL5 alone, at varying concentrations, was able to heighten IL-1ß mRNA levels significantly in nonadherent human monocytes [38
]. However, in that study, increased IL-1ß protein synthesis was not seen. Other studies have shown that adherence enhances IL-1ß mRNA in macrophages; however, this priming results in earlier and enhanced IL-1ß synthesis in human peripheral blood mononuclear cells stimulated with LPS [39
]. As a result of the absence of reagents for the guinea pig, IL-1ß protein levels could not be measured in our study.
For the first time in any species, enhanced expression and secretion of bioactive TNF-
were documented when resident peritoneal and alveolar macrophages were incubated with rgpCCL5 (Figs. 3A
, 4A
, and, 5A
and 5B)
. These findings contrast with the previous report in which no increase in TNF-
protein levels was observed in nonadherent human monocytes treated with CCL5 [38
]. This apparent contradiction may be related to species or macrophage differences. The previous study used human nonadherent monocytes compared with the adherent guinea pig resident tissue macrophages examined in this study. Another plausible explanation may be that our macrophages were slightly activated as a result of adherence to plastic, which may have enhanced the stimulatory effect of rgpCCL5 on macrophage production of TNF-
. The study of macrophages, which have been slightly activated by adherence, may mimic what is occurring in vivo, as these macrophages are migrating along chemokine concentration gradients to arrive at the site of inflammation. It has been shown previously that cytokines, including TNF-
, IL-1ß, and/or inteferon-
, enhance CCL5 mRNA and/or protein in human synovial fibroblasts [40
], human endothelial cells [41
], murine macrophages [42
], and human monocytes [43
]. These data suggest that CCL5 and cytokines may cooperate to enhance each others expression.
Stimulation with rgpCCL5 enhanced CCL2 mRNA expression significantly by resident peritoneal macrophages but not alveolar macrophages (Figs. 3C and 4C) . Levels of CXCL8 mRNA were increased significantly in both macrophage types by stimulation with rgpCCL5 (Figs. 3D and 4D) . These chemokines are chemotactic for T lymphocytes [44 ], neutrophils [45 ], and monocyte/macrophages [46 , 47 ]. CCL2 has previously been shown to induce IL-1 and IL-6 protein in human monocytes [48 ] and to enhance Th2 polarization in mice [49 ]. CXCL8 has been suggested to play a role in providing protection against infection, as enhanced levels of expression are observed in vaccinated compared with naive animals [21 ]. In a study where the IL-8 receptor (IL-8R; CXC chemokine receptor 2) was knocked out, the mice were more susceptible to gastric and acute systemic candidiasis [7 , 50 ]. A previous study showed that CCL2 and CXCL8 mRNA levels were enhanced in human nonadherent monocytes when exposed to CCL5 alone, and CCL2 protein levels mimicked mRNA expression [38 ]. In our studies, CCL5 enhanced CXCL8 and CCL2 mRNA levels. These results suggest that CCL5, although attracting the macrophages to the site of infection, is priming macrophages for an encounter with microbes by enhancing cytokine and chemokine expression levels.
Differences observed in this study between peritoneal and alveolar macrophages have also been documented with regard to a variety of biological responses [33
, 51
52
53
54
]. However, very few studies have looked at the response of different resident macrophage populations to chemokines alone. Our results show that alveolar macrophages were less sensitive to stimulation with rgpCCL5 than peritoneal macrophages. Alveolar macrophages displayed a significant enhancement in TNF-
, IL-1ß, and CXCL8 mRNA expression (Fig. 4)
and TNF-
protein (Fig. 5B)
, only when stimulated with 1350 ng/ml rgpCCL5 compared with media alone. In contrast, peritoneal macrophages displayed significant enhancement of TNF-
, IL-1ß, CCL2, and CXCL8 mRNA expression (Fig. 3)
and TNF-
protein (Fig. 5A)
at lower concentrations of rgpCCL5. This might be a result of different expression levels of CCL5 receptors and/or differences in signal transduction pathways. Differences between macrophage populations were also seen in the degree of stimulation of chemokine mRNA levels post-rgpCCL5 exposure. CCL2 mRNA was not significantly enhanced in alveolar macrophages exposed to rgpCCL5 (Fig. 4C)
, whereas it was significantly increased in peritoneal macrophages (Fig. 3C)
. Also, the kinetics of CXCL8 differed between the two cell types. Alveolar macrophages expressed increasing levels of CXCL8 mRNA at 6 h compared with 2 h, in contrast to peritoneal macrophages in which expression of CXCL8 mRNA was diminished at 6 h. These data contribute to a better understanding of the variation between different resident macrophage populations in terms of their responses to CCL5.
It has been shown in previous studies that LPS induces the expression of many chemokines, including CCL5, in vitro [19
, 55
, 56
] and in vivo [19
]. In an attempt to better understand the effect of CCL5 exposure on the response of macrophages to LPS, alveolar and peritoneal macrophages were pretreated with rgpCCL5 and then stimulated with low levels of LPS. We observed a significant reduction in the ratio (LPS+rgpCCL5/LPS) of CCL2 mRNA in peritoneal macrophages (Fig. 6C)
and CXCL8 mRNA in alveolar macrophages (Fig. 7D)
between 2 h and 6 h. TNF-
exhibited diminished levels of mRNA at 2 h post-LPS stimulation in the rgpCCL5-pretreated macrophages (Figs. 6A
and 7A)
; however, the bioactive TNF-
protein levels appeared slightly enhanced at 2 h followed by a reduction at 6 h (Fig. 8)
. One explanation for these findings might be the presence of endogenous TNF-
produced by the macrophages before exposure to LPS. We have shown that CCL5 alone can induce bioactive TNF-
protein as early as 2 h post-CCL5 exposure (Fig. 5) . This production, plus the additional TNF-
produced by macrophages upon activation by LPS, might result in the production of the immunoregulatory cytokine, IL-10. Previous studies have shown that TNF-
alone induces IL-10 expression and production in human monocytes [57
] and enhances IL-10 secretion when the cells are cocultured with LPS [57
58
59
]. IL-10 suppresses many proinflammatory cytokines and chemokines in human monocytes, including TNF-
, IL-1ß, and CXCL8 [60
]. Human monocytes incubated with IL-10 and LPS exhibited a profound reduction in TNF-
production compared with LPS alone [59
], and this effect appeared to be dependent on adherence to plastic [61
]. Pretreatment of monocytes with TNF-
has resulted in partial cross-tolerance to LPS by suppressing extracellular signal-regulated kinase phosphorylation and increasing nuclear factor (NF)-
B p50 homodimers [62
], which are associated with LPS tolerance. The topic of TNF-
-induced LPS tolerance has resulted in numerous contradicting publications, suggesting the inability and ability to induce cross-tolerance to LPS [59
, 62
63
64
]. We plan to investigate the controversial role of endogenous TNF-
by blocking TNF-
activity in the cultures using anti-rgpTNF-
antiserum. The contribution of IL-10 to the CCL5-induced hyporesponsiveness of macrophages to LPS will have to wait until rgpIL-10 and anti-gpIL-10 are available.
Another plausible explanation for the altered cytokine expression in CCL5-pretreated macrophages following LPS exposure may be the ability of IL-1ß to induce LPS tolerance. In our experiments, IL-1ß mRNA was induced within 2 h of CCL5 treatment of alveolar and peritoneal macrophages (Figs. 3B and 4B)
. Previous experiments have shown that IL-1ß is regulated at the transcriptional and translational levels and that two signals are needed for IL-1ß protein production [39
]. As a result of the lack of guinea pig reagents, IL-1ß protein levels were not assessed. However, it has been demonstrated that adherence of macrophages alone induces IL-1ß mRNA levels [39
], and stimulation of human nonadherent monocytes with CCL5 triggers IL-1ß mRNA synthesis [38
]. Pretreatment of macrophages with IL-1ß has resulted in LPS tolerance in many studies [62
, 64
, 65
]. This may be the result of common signaling intermediates between the LPS receptor [Toll-like receptor 4 (TLR4)] and IL-1R, such as MyD88, IL-1R-associated kinase, TNF receptor-associated factor-6, and NF-
B-inducing kinase [66
]. Another explanation for this cross-tolerance involves the ability of IL-1ß to down-regulate TLR4 expression in peritoneal macrophages [65
]. It has also been shown that TNF-
and IL-1ß synergistically enhance LPS-induced production of the immunoregulatory cytokine IL-10 [59
]. These data suggest that IL-1ß and TNF-
are induced in guinea pig macrophages by pretreatment with rgpCCL5 and lead to a state of tolerance when macrophages are exposed subsequently to LPS.
A novel, direct role of CCL5 may account for the altered cytokine expression in rgpCCL5-pretreated macrophages. Interactions between the signal transduction pathways elicited by CCL5 following engagement with seven transmembrane, G-coupled protein receptors (CCR1, -3, -4, and -5) and GAG might affect the ability of LPS to induce exceedingly high levels of cytokines and chemokines. A previous study induced nonadherent monocytes with hrCCL5 and observed the up-regulation of 114 genes involved in various biological activities [38 ]. Many of these genes have not been analyzed for their ability to alter the response of the cells to LPS.
These results suggest CCL5 may directly or indirectly regulate the host-immune response to prevent uncontrollable release of dangerous concentrations of proinflammatory cytokines. We plan to elucidate further the mechanisms by which CCL5 pretreatment alters macrophage responses to bacterial products and the role it may play in host-pathogen interactions, especially in the response of the guinea pig to M. tuberculosis.
Received July 21, 2004; revised August 27, 2004; accepted August 31, 2004.
|
|
|---|
, MIP-1ß, RANTES, and ATAC/lymphotactin function together with IFN-
as type 1 cytokines Proc. Natl. Acad. Sci. USA 99,6181-6186
, and MIP-1ß induce trypanocidal activity in human macrophages via nitric oxide Infect. Immun. 66,4690-4695
B activation and cytokine release in human alveolar macrophages is PKC-independent and TK- and PC-PLC-dependent Am. J. Respir. Cell Mol. Biol. 18,384-391
, IL-6 and IL-8 release by human monocytes and alveolar macrophages J. Immunol. 150,2885-2891[Abstract]
production from distinct guinea pig leukocyte populations Infect. Immun. 71,7035-7042
transcription utilizes distinct MAP kinase pathways in different macrophage populations J. Leukoc. Biol. 67,885-893[Abstract]
plus TNF-
and inhibition by IL-4 and IL-13 J. Immunol. 154,1870-1878[Abstract]
and TNF regulate macrophage expression of the chemotactic S100 protein S100A8 J. Immunol. 164,4916-4923
by resident and activated murine macrophages J. Leukoc. Biol. 51,251-255[Abstract]
by murine alveolar and peritoneal macrophages Am. J. Respir. Cell Mol. Biol. 10,8-15[Abstract]
-induced macrophage chemokine secretion is more dependent on NF-
B expression than lipopolysaccharides-induced macrophage chemokine secretion Eur. J. Immunol. 32,2037-2045[CrossRef][Medline]
in human monocyte IL-10 synthesis J. Immunol. 151,6853-6861[Abstract]
and cAMP elevating drugs Int. Immunol. 7,517-523
: role of the p38 and p42/44 mitogen-activated protein kinases J. Immunol. 160,920-928
or IL-1ß on cellular signaling and mediator production J. Leukoc. Biol. 70,821-829This article has been cited by other articles:
![]() |
K. V. Sawant and D. N. McMurray Guinea Pig Neutrophils Infected with Mycobacterium tuberculosis Produce Cytokines Which Activate Alveolar Macrophages in Noncontact Cultures Infect. Immun., April 1, 2007; 75(4): 1870 - 1877. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||