science pharmaceutical expo biotech jobs
Originally published online as doi:10.1189/jlb.0903428 on September 8, 2004

Published online before print September 8, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0903428v1
76/6/1200    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Westgaard, I. H.
Right arrow Articles by Fossum, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Westgaard, I. H.
Right arrow Articles by Fossum, S.
(Journal of Leukocyte Biology. 2004;76:1200-1206.)
© 2004 by Society for Leukocyte Biology

Rat NKp46 activates natural killer cell cytotoxicity and is associated with Fc{varepsilon}RI{gamma} and CD3{zeta}

Ingunn H. Westgaard*,{dagger},1,2, Siri F. Berg*,2, John T. Vaage{ddagger}, Lawrence L. Wang{dagger}, Wayne M. Yokoyama{dagger}, Erik Dissen* and Sigbjørn Fossum*

* Department of Anatomy, Institute of Basic Medical Sciences, University of Oslo, Norway;
{dagger} Department of Medicine, Rheumatology Division, Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, Missouri; and
{ddagger} Institute of Immunology, Rikshospitalet University Hospital, Oslo, Norway

1 Correspondence: Department of Anatomy, University of Oslo, Box 1105 Blindern, N-0317 Oslo, Norway. E-mail: i.h.westgaard{at}basalmed.uio.no


arrow
ABSTRACT
 
NKp46 has been identified in the human, rat, mouse, monkey, and cattle. We have generated a monoclonal antibody, WEN23, against rat NKp46. By flow cytometry, NKp46 is expressed by all natural killer (NK) cells but not by T cells, B cells, granulocytes, monocytes, dendritic cells, or macrophages. Thus, NKp46/WEN23 is the first NK cell-specific marker in the rat. In a redirected lysis assay, preincubation of the effector cells with WEN23 augmented lysis of the Fc receptor (FcR)+ murine tumor target cells, indicating that NKp46 is an activating NK cell receptor. Moreover, preincubation of the effector cells with WEN23 F(ab')2 fragments reduced killing of target cells, confirming the activating function of NKp46 and indicating that the mouse tumor target cells express a ligand for rat NKp46. Lysis of FcR mouse and human tumor target cells was reduced after incubation of effector cells with WEN23, suggesting that rat NKp46 recognizes a ligand that is conserved between primates and rodents. By Western blot and immunoprecipitation using WEN23, NKp46 is expressed as a monomer of ~47 kDa in interleukin-2-activated NK cells. The immunoreceptor tyrosine-based activation motif bearing adaptor proteins CD3{zeta} and the {gamma} chain of FcRI for IgE (Fc{varepsilon}RI{gamma}) with NKp46 from lysates of NK cells, indicating that rat NKp46 activates NK cell cytotoxicity by similar pathways as CD16.

Key Words: activating receptor • natural cytotoxicity • immunoglobulin superfamily • adaptor protein


arrow
INTRODUCTION
 
Natural killer (NK) cells mediate natural immunity against cancer and pathogens by secretion of cytokines and by spontaneous cytolytic activity [1 , 2 ]. They express receptors recognizing a number of different ligands, including major histocompatibility complex (MHC) class I and MHC class I-like molecules [3 4 5 ]. The outcome of an interaction between a NK cell and a potential target cell is dependent on a balance of signals received through activating and inhibitory NK cell receptors. Receptors that inactivate NK cell functions upon recognition of their ligands have been studied extensively, whereas knowledge about activating receptors has been more limited. In the human, NKp46 has been shown to trigger killing of target cells [6 ] and to be noncovalently associated with the immunoreceptor tyrosine-based activation motif (ITAM)-containing adaptor proteins CD3{zeta} and/or the {gamma} chain of FcRI for IgE (Fc{varepsilon}RI{gamma}) [7 , 8 ]. This interaction is thought to depend on salt bridges created between a positively charged arginine residue in the transmembrane (TM) domain of the receptor and a negatively charged aspartic acid residue at the corresponding position of the adaptor protein. Signaling through ITAM-containing adaptor proteins has previously been shown to involve tyrosine phosphorylation of ITAMs and recruitment and activation of the tyrosine kinases Syk or {zeta}-associated protein 70 [9 , 10 ], leading to activation of T cell and NK cell effector functions. Orthologs of the human NKp46 gene have previously been identified in the rat, mouse, monkey, and cattle [11 12 13 14 15 ]. We have generated a monoclonal antibody (mAb) against rat NKp46 and used it to study the expression of NKp46 on different cell types. The lack of NK-specific markers in the rat has been a disadvantage. However, the newly generated anti-NKp46 mAb is a precise marker for all NK cells in the rat. In addition, we have for the first time in rodents demonstrated that NKp46 activates NK cell cytotoxicity and shown that it is noncovalently associated with CD3{zeta} and Fc{varepsilon}RI{gamma}.


arrow
MATERIALS AND METHODS
 
Animals
BALB/c mice and the inbred rat strains AO, AGUS, AUG, DA, LEW, PVG, PVG.1AV1, and PVG rnu/rnu rats were reared under conventional conditions (routinely screened for pathogens) in Oslo or obtained commercially (Harlan Olac, Bicester, UK). The experimental protocol was approved by the veterinary surgeon and registered by the Experimental Animal Board under the Ministry of Agriculture of Norway.

Cloning of rat NKp46
A cDNA library generated from interleukin (IL)-2-activated NK cells from PVG rats [16 ] was screened with a cDNA probe corresponding to the 5'-untranslated region and open reading frame of mouse gp49B1 [17 , 18 ]. Plaques were lifted onto nylon membranes (colony/plaque screen, NEN Life Science Products, Boston, MA) and hybridized to radiolabeled probe (Megaprime DNA labeling system, Amersham Biosciences, Buckinghamshire, UK) under low-stringency conditions, as described earlier. Isolated clones were sequenced on both strands as described previously [19 ]. A cDNA library made from IL-2-activated NK cells from F344 rats [20 ] and a rat spleen cDNA library from Sprague-Dawley (Clontech, Palo Alto, CA) were screened in search of similar genes.

Cell preparations
NK cells were purified from rat spleen by Isopaque-Ficoll density centrifugation (Lymphoprep, Axis-Shield, Oslo, Norway) followed by passage through nylon wool (Leucopac, Fenwal Laboratories, Deerfield, IL) and removal of T cells and B cells by negative selection as described [21 ], yielding a >98% NK receptor (NKR)-P1+ NK cell population as determined by flow cytometry using mAb 3.2.3 [22 ]. These cells were cultured for 14 days in medium containing rat recombinant IL-2 [21 ]. Mesenterial lymph nodes from 2-month-old rats perfused with phosphate-buffered saline (PBS) were disrupted in PBS and filtered (CellStrainer, BD Biosciences, San Jose, CA). Cells from afferent lymph collected from mesenterially lymphadenectomized rats were obtained as described [23 ]. Spleen cells were obtained by density centrifugation (Lymphoprep) followed by passage through nylon wool. Concanavalin A (ConA) blasts, thoracic duct lymphocytes, macrophages, and neutrophilic granulocytes were purified as described [19 ]. The macrophage cell line R2 [24 ], the mast cell line RBL-2H3 [25 ], and the F344-derived NK cell lines RNK-16 [26 ] and A181 [27 ] were cultured under standard conditions [21 ]. A stable, IL-2-dependent rat NK cell line, RNKDA1, was generated from DA rat spleen NK cells by long-term culture in complete medium with IL-2 and 2-mercaptoethanol. The cells were analyzed by flow cytometry and were shown to be NKp46+/NKR-P1+/CD3 [21 ].

DNA and RNA electrophoresis
DNA was extracted from rat liver, digested with restriction endonucleases (New England Biolabs, Beverly, MA), subjected to horizontal agarose gel electrophoresis, and blotted onto nylon membranes (Biotrans membranes, ICN Biomedicals, Irvin, CA) by conventional methods. Extraction of total cellular RNA, formaldehyde agarose gel electrophoresis, and transfer to nylon membranes were performed by conventional methods. Equal loading of RNA in all lines was verified by ethidium bromide staining. Hybridization was performed under conditions described earlier [20 ].

Generation of anti-NKp46 mAb WEN23 and WEN23 F(ab')2 fragments
The anti-NKp46 mAb WEN23 was obtained by immunizing BALB/c female mice with a soluble rNKp46/mFc{gamma}2b fusion protein generated as follows: nt –3–729 of rat NKp46 was amplified by polymerase chain reaction (PCR) using gene-specific primers containing BamHI restriction sites (5' primer GGATCCGGTATGCTGCCAACACTCACTG, 3' primer GGATCCCTGCAATCCTGATTCTTTGGTTGA). The PCR product was cloned into pCR2.1-TOPO (Invitrogen, San Diego, CA). The BamHI fragment was inserted into the mammalian expression vector pcDNAI (Invitrogen) containing exons for the hinge, CH2, and CH3 regions of the mouse IgG2b gene (kindly provided by Hans-Christian Aasheim, The Norwegian Cancer Hospital, Oslo). 293T cells were transiently transfected with the chimeric gene construct using Lipofectamine (Invitrogen) as described [21 ]. The cells were then grown for 4 days in serum-free AIM-V medium (Invitrogen). Soluble rNKp46/mFc{gamma}2b fusion protein was purified from supernatant on a protein G column (HiTrap, Amersham Biosciences) and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Silver-staining revealed a major band of ~120 kDa (nonreducing conditions).

Specificity of the generated mAb was confirmed by flow cytometry analysis of 293T cells transfected with the NKp46 expression construct. WEN23 F(ab')2 fragments were produced as described [21 ].

Flow cytometry
Two-color analysis was performed in five steps: Primary labeling was with anti-CD3 (G4.18, ref. [28 ]), anti-NKR-P1 (3.2.3 [22 ]), anti-CD4 (W3/25 [29 ]), anti-CD8 (OX8 [29 ]), anti-Ig{kappa} (OX12 [30 ]), and ED1 [24 ], followed by fluorescein isothiocyanate (FITC)-conjugated F(ab')2 of sheep anti-mouse (SAM) IgG (F-2266, Sigma Aldrich, St. Louis, MO), mouse IgG, biotinylated WEN23, and finally, phycoerythrin (PE)-conjugated streptavidin (Jackson ImmunoResearch Laboratories, West Grove, CA). Three-color analysis was performed in two steps using biotinylated WEN23, PE-conjugated anti-CD3, and FITC-conjugated anti-NKR-P1 (G4.18 and 10/78, respectively, BD Biosciences PharMingen, San Diego, CA), followed by allophycocyanin-conjugated streptavidin (Molecular Probes, Junction City, OR).

Redirected lysis assay
Standard 4 h 51Cr release cytotoxicity assays were performed as described [31 ]. Exponentially growing FcR YAC-1 (mouse) and RPMI8866 (human) and FcR+ P815 and P388D1 (both mouse) tumor cells were used as targets and IL-2-activated DA NK cells as effectors [21 ]. Fifteen-minute preincubations with medium alone, WEN23, WEN23 F(ab')2, or a control Ig (anti-CD2, OX34, ref. [32 ]) were performed where indicated.

Biochemistry
For immunoprecipitations, 20 x 106 cells were lysed in 1% digitonin buffer and precipitated using 3 µg WEN23, anti-CD3{zeta} (6B10.2, Santa Cruz Biotechnology, Santa Cruz, CA), or control Ig as detailed [21 ]. Samples were run on SDS-PAGE, transferred to polyvinylidene difluoride membranes (Immobilon-P, Millipore Corp., Bedford, MA), and probed with 1:1000 anti-CD3{zeta} mAb, 1 µg/ml anti-Fc{varepsilon}RI{gamma} antibody (Upstate Biotechnology, Lake Placid, NY), or 1:1000 antiphosphotyrosine mAb (4G10, Upstate Biotechnology), followed by goat anti-mouse IgG horseradish peroxidase (HRP) or goat anti-rabbit IgG HRP (Jackson ImmunoReseach Laboratories) and chemiluminescent detection (Super Signal West Pico, Pierce, Rockford, IL; BiomaxMR film, Eastman Kodak, Rochester, NY).

Sodium pervanadate stimulation was done as described [21 ]. For biotinylation of surface proteins, cells were washed three times in PBS, pH 8.0, incubated for 30 min at room temperature with 0.5 mg/ml N-hydroxysuccinimide-biotin (Sigma-Aldrich) in PBS, pH 8.0, at 25 x 106 cells/ml, and then washed three times in PBS, pH 8.0. Biotinylated cells were lysed in 1% digitonin buffer as described [21 ].


arrow
RESULTS
 
cDNA isolation and sequence analysis
A NK cell cDNA library was screened at low-stringency conditions with a mouse gp49B1 cDNA probe. Following the sequencing of this cDNA clone, originally termed killer cell Ig-like receptor (KILR-1) in the GenBank entry (accession number AF082533), the cDNA sequences of human NKp46 and later mouse and rat NKp46 were published by others [11 , 13 , 14 ]. The KILR-1 protein is 65% identical to human NKp46 and 100% identical to the published rat NKp46 ortholog [13 ], and the name KILR-1 has accordingly been replaced with NKp46.

Rescreening of the rat NK cell library with a NKp46 probe at low stringency and PCR analysis of two NK cell libraries (from PVG and F344 rats) plus a rat spleen cDNA library did not reveal variants with immunoreceptor tyrosine-based inhibitory motifs. Moreover, Southern blots of rat genomic DNA suggested a single gene without close relatives (data not shown), and computer searches of rat genomic sequence data yielded a single Nkp46 gene.

NKp46 is expressed by all NK cells
By Northern blot analysis, NKp46 transcription was detected in IL-2-activated NK cells and the NK cell lines RNK-16 and A181. NKp46 mRNA was not detectable in purified populations of B cells, CD4+, or CD8+ T cells, ConA blasts, granulocytes, peritoneal macrophages, the macrophage cell line R2, or the mast cell line RBL-2H3 (Fig. 1 ). By Northern blot analysis, no NKp46 expression was detected with RNA from brain, heart, skeletal muscle, kidney, testis, liver, and thymus. No differences in the level of transcription could be seen in IL-2-stimulated NK cells from the DA, PVG, AO, AUG, AGUS, or LEW rat strains (data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. NKp46 is expressed by rat NK cells. Northern blot analysis of total RNA from different cell types hybridized to a full-length NKp46 probe. A181 and RNK16 are rat NK cell lines, R2 is a rat macrophage line, and RBL-2H3 is a rat mast cell line.

The mAb WEN23, specifically recognizing rat NKp46 (Fig. 2A ), was generated by immunizing mice with a soluble fusion protein of the extracellular region of NKp46 and the Fc region of mouse IgG2b. Flow cytometry showed that all IL-2-stimulated NK cells isolated from rat spleen stained with WEN23 (Fig. 2B) . At present, rat NK cells are defined as NKR-P1bright, CD3. Flow cytometry analysis of spleen cells demonstrated that all cells in this category were NKp46+. Seventy-eight percent of the NKp46+ cells expressed CD8, in accordance with previous findings with rat NK cells [33 , 34 ]. A small population of cells not recognized by the anti-NKR-P1 mAb 3.2.3 or 10/78 was stained at variable intensities with WEN23. Less than 0.5% of CD3+ cells were stained with WEN23. The CD4+, Ig{kappa}+, and ED1+ populations were NKp46. Together, our findings indicate that NKp46 was not expressed on T cells, B cells, monocytes, or macrophages (Fig. 3A and 3B ). Similar results were obtained with peripheral blood leukocytes. Less than 0.5% of the cells in bone marrow, thymus, and peritoneal fluid stained with WEN23. Granulocytes in the blood and bone marrow were NKp46 (data not shown). OX62+/MHC class II+ dendritic cells collected from afferent lymph of lymphadenectomized rats did not express NKp46 (Fig. 3A) . To look for the presence of NK cells in lymph nodes, rats were perfused with PBS to remove contaminating blood cells. Essentially no NKp46+ cells (<0.3%) were detected (Fig. 3A) . As previously shown, a subpopulation of rat CD3+ cells is NKR-P1dim [35 ]. The functional nature of this cell population is poorly investigated, and they may represent NKT cells or conventional T cells expressing NK cell markers. Less than 0.5% of NKR-P1dim, CD3+ spleen cells expressed NKp46 (Fig. 3B) .



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. All IL-2-stimulated rat NK cells express NKp46. (A) The newly generated mAb WEN23 specifically recognizes rat NKp46, as demonstrated by flow cytometry analysis of 293T cells transfected with empty vector or with a rat NKp46 expression construct. Staining of transfected cells with SAM secondary antibody alone is shown for comparison. (B) Flow cytometry analysis of IL-2-stimulated NK cells with the anti-NKp46 mAb WEN23 and mAb specific for rat NKR-P1, CD3, Ig{kappa} light-chain, and MHC class II.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Flow cytometry analysis of different rat cell types using WEN23. (A) Two-color analysis of nylon wool-passed spleen cells, lymph node cells from PBS-perfused rats, and cells from afferent lymph collected from mesenteric, lymphadenectomized rats using biotinylated anti-NKp46 mAb WEN23 and mAb specific for rat CD3, CD4, CD8, Ig{kappa}, NKR-P1, MHC class II, or markers for dendritic cells (OX62) and monocytes/macrophages (ED1). Staining with FITC-conjugated SAM and PE-conjugated streptavidin (str) was used as control. (B) Three-color analysis of nylon wool-passed rat spleen cells with WEN23, anti-CD3, and anti-NKR-P1. All cells tested were from the PVG strain.

NKp46 activates NK cell cytotoxicity
The functional activity of NKp46 was assessed by a redirected lysis assay using IL-2-activated DA NK cells as effector cells and the murine FcR bearing (Fc{gamma}R+) tumor cell lines P388D1 and P815 as targets. Lysis of the Fc{gamma}R+ targets was augmented by preincubation of the effector cells with WEN23 mAb (whole IgG molecules), indicating that NKp46 activates cytotoxicity (Fig. 4A ). In contrast to whole IgG WEN23, incubation with WEN23 F(ab')2 fragments led to reduced killing of P388D1 and P815 cells, suggesting that the mouse tumor target cells express a ligand for rat NKp46 and that binding to this ligand could be blocked by WEN23 F(ab')2. Lysis of the Fc{gamma}R mouse tumor cell line YAC-1 and the human tumor cell line RPMI 8866 was reduced when effector cells were preincubated with WEN23 mAb (whole IgG), suggesting that rat NKp46 recognizes a phylogenetically conserved ligand (Fig. 4B) . Treatment of the effector cells with an isotype-matched, cell-bound, control mAb had no effect on the level of cytotoxicity.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Rat NKp46 activates NK cell-mediated cytotoxicity. Four-hour chromium release redirected lysis assay with IL-2-activated DA NK cells as effector cells and (A) the FcR+ mouse tumor cells P815 and P388D1 or (B) the FcR mouse tumor cells YAC-1 and human tumor cells RPMI 8866 as targets. The effector cells were preincubated with medium alone, WEN23 whole Ig, WEN23 F(ab')2, or a cell-bound, control mAb as indicated.

Biochemical characterization of the NKp46 protein
Western blot analysis with WEN23 of whole cell lysates from 293T cells transiently transfected with a rat NKp46 expression construct yielded a band of ~47 kDa under nonreducing and reducing conditions. Immunoprecipitation with WEN23 of surface-biotinylated 293T cells transiently transfected with rat NKp46 yielded similar bands. This indicates that rat NKp46 is expressed as a monomer (Fig. 5A and 5B ). The ~12 kDa discrepancy between observed molecular mass and calculated mass of the NKp46 polypeptide probably reflects glycosylation.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 5. Rat NKp46 is expressed as a 47-kDa monomer and is associated with Fc{varepsilon}RI{gamma} and CD3{zeta}. Western blot (WB) analysis of (A) whole cell lysate (WCL) from 293T cells transiently transfected with a rat NKp46 expression construct or empty vector (EV) and (B) WEN23 immunoprecipitate (IP) from surface-biotinylated, transiently transfected 293T cells using HRP-conjugated streptavidin under nonreducing (NR) and reducing (R) conditions. (C–F) RNKDA1 cells were incubated with (+) or without (–) pervanadate (PV) and immunoprecipitated with WEN23, a cell-bound, control antibody [IgG1 (cIg)], or anti-CD3{zeta} mAb. Western blot analysis was performed using (C) the antiphosphotyrosine ({alpha}-Py) mAb 4G10, (D) WEN23 mAb, (E) polyclonal (P) anti-Fc{varepsilon}RI{gamma}, and (F) anti-CD3{zeta} mAb. Relative molecular masses in kDa have been indicated.

As a rule, the activating NKRs transmit their signals by associating with ITAM-containing TM adaptor proteins. To investigate whether NKp46 is coupled to tyrosine-phosphorylated signaling proteins, the IL-2-dependent rat NK cell line RNKDA1 [21 ] was pretreated with pervanadate, and digitonin lysates of the cells were precipitated with WEN23, a cell surface-bound, irrelevant IgG1 control (anti-CD2), or with an anti-CD3{zeta} mAb. By Western blot analysis under reducing conditions using an antiphosphotyrosine mAb, NKp46 and CD3{zeta} were found to coprecipitate with a band of ~12 kDa plus a band of ~21 kDa, compatible with the phosphorylated forms of Fc{varepsilon}RI{gamma} and CD3{zeta}, respectively [36 , 37 ] (Fig. 5C) . To further investigate the nature of the phosphorylated proteins associated with NKp46, Western blot analysis using WEN23 on NKp46 and CD3{zeta} immunoprecipitates was performed under nonreducing conditions, and CD3{zeta} was shown to coprecipitate NKp46 (Fig. 5D) . In addition, Western blot analysis of the NKp46 immunoprecipitate with anti-Fc{varepsilon}RI{gamma} antibodies under reducing conditions revealed bands of ~10 and ~12 kDa, probably representing nonphosphorylated and phosphorylated forms of Fc{varepsilon}RI{gamma}, respectively (Fig. 5E) . Together, these observations demonstrate that NKp46 is associated with Fc{varepsilon}RI{gamma} and CD3{zeta}. Western blot analysis under nonreducing conditions following immunoprecipitation with WEN23 revealed that NKp46 coprecipitated a band of ~26 kDa stained by the anti-CD3{zeta} mAb (Fig. 5F) . This molecular weight fits with a Fc{varepsilon}RI{gamma}/CD3{zeta} heterodimer, indicating that NKp46 can associate with a disulfide-linked heterodimer of Fc{varepsilon}RI{gamma} and CD3{zeta}. A band of identical molecular mass was detected following immunoprecipitation with anti-CD3{zeta}, corroborating the presence of a possible Fc{varepsilon}RI{gamma}/CD3{zeta} heterodimer in this cell line. In addition, anti-CD3{zeta} precipitated a weak band of 32 kDa, suggesting the presence of the homodimeric form of CD3{zeta} [38 ]. This band was not detectable in the NKp46 immunoprecipitate (Fig. 5F) . In our hands, the anti-Fc{varepsilon}RI{gamma} antibody did not perform well in immunoprecipitation.


arrow
DISCUSSION
 
NKp46 constitutes a single gene without close relatives. Orthologs have been described in the mouse, human, monkey, and cattle [11 12 13 14 15 ]. The rat Nkp46 gene is located within the leukocyte receptor gene complex on chromosome 1 together with Nilr1 [39 ] and Kir3dl1 [40 ]. Human, mouse, and bovine Nkp46 are localized to homologous regions on chromosome 19q13.4, MMU7, and BTA18, respectively [14 , 15 , 40 ].

Our finding that rat NKp46 activates cytotoxicity, as shown in a redirected lysis assay using the WEN23 mAb, corroborates previous observations in the human [41 ]. The reduced killing of the FcR, bearing mouse target cells following preincubation of the effector cells with WEN23 F(ab')2 fragments, suggested that the WEN23 F(ab')2 fragments blocked a NKp46 ligand on the mouse tumor cells, supporting previous data suggesting that human NKp46 interacts with a ligand on mouse tumor cells [6 , 41 ]. Our data with human tumor target cells suggest that rat NKp46 recognizes a ligand that is conserved between rodents and primates. Results obtained in the human point to virally encoded haemagglutinins as NKp46 ligands with binding in part dependent on sialic acid residues [42 ]. The putative tumor cell ligand may be structurally related to the virally encoded ligands, or alternatively, NKp46 can recognize different, unrelated ligands.

The biochemical analysis indicated that rat NKp46 associates with Fc{varepsilon}RI{gamma} and CD3{zeta}, as previously shown for the T cell receptor and human CD16 [43 , 44 ]. The association between the TM regions of activating receptors and ITAM-containing adaptor proteins involves pairs of oppositely charged amino acid residues that form stable ionic bonds. The NKp46 TM region is highly conserved among species and contains the basic amino acid residue arginine at the N-terminal side as well as two acidic amino acid residues at the start of the cytoplasmic region. This pattern, with an arginine residue in the +3 position and a glutamic acid residue at the TM/cytoplasmic region transition, is also conserved among several Ig-like receptors with sequence similarities to NKp46, such as Fc{alpha}R (CD89), glycoprotein (GP)VI, paired Ig-like receptor (PIR)A1, and leukocyte Ig-like receptor (LILR)A1 and -A2 (alias LIR-6 and ILT1). A common feature of these receptors is their interaction with the ITAM-containing adaptor protein Fc{varepsilon}RI{gamma} [45 46 47 ]. Also CD16 [43 ] and the Fc{varepsilon}RI{alpha} [48 ] chain have been shown to interact with Fc{varepsilon}RI{gamma}, but their TM regions are dissimilar from that of NKp46, and their potential for salt-bridging to Fc{varepsilon}RI{gamma} or CD3{zeta} is not evident from their primary sequences (Fig. 6 ). The similarity between the TM regions of Fc{varepsilon}RI{gamma} and CD3{zeta}, both with an aspartic acid residue in the +3 position, suggests that they can substitute for each other in forming an ionic bond with NKp46 (Fig. 6) .



View larger version (67K):
[in this window]
[in a new window]
 
Figure 6. Alignment of the TM domain of several Ig-like receptors that associate with Fc{varepsilon}RI{gamma}. Conserved-charged amino acid residues are shown in bold. LILRA1 is also known as LIR-6 and LILRA2, as ILT1. h, Human; r, rat; m, mouse; bt, cattle.

In accordance with findings in the human, our data indicate that NKp46 is expressed by all rat NK cells. It is not expressed by T cells, B cells, monocytes, macrophages, dendritic cells, or granulocytes. Recent work in the human has demonstrated the presence of CD56bright, CD16 cells in lymph nodes. These cells only expressed NKp46 at a low level [49 , 50 ]. We did not detect NKp46+ cells in lymph nodes from perfused rats. At present, mAb specific for CD56 or CD16 are not available in the rat, and we cannot rule out the presence of NKp46 NK cells in rat lymph nodes. A small minority of NKp46+ nylon wool-passed spleen cells was NKR-P1. A possible explanation is that not all NK cells are stained with the 3.2.3 or 10/78 mAb. As a result of the low number of cells, their natural killing capacity was not tested. NKp46 is expressed by freshly isolated and IL-2-activated NK cells and by NK cells in all strains tested. Thus, it should be regarded as the standard marker for rat NK cells. The availability of mAb toward rat NKp46 will thus facilitate isolation and functional characterization of NK cells.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by the Norwegian Research Council, the Norwegian Cancer Society, the Odd Fellow Medical Research Fund, and Bergljot and Sigurd Skaugen’s Fund. I. H. W. and S. F. B. contributed equally to this work. We thank W. Jensen, J. Norrström, and M. Lauritzen for technical assistance and J. C. Ryan, A. N. Barclay, T. Hünig, L. L. Spruyt, J. G. M. C. Damoiseaux, and H-C. Aasheim for sharing reagents.


arrow
FOOTNOTES
 
2 Ingunn H. Westgaard and Siri F. Berg contributed equally to this work. Back

Received September 17, 2003; revised July 21, 2004; accepted August 11, 2004.


arrow
REFERENCES
 
    1
  1. Biron, C. A., Nguyen, K. B., Pien, G. C., Cousens, L. P., Salazar-Mather, T. P. (1999) Natural killer cells in antiviral defense: function and regulation by innate cytokines Annu. Rev. Immunol. 17,189-220[CrossRef][Medline]
  2. 2
  3. Cerwenka, A., Lanier, L. L. (2001) Natural killer cells, viruses and cancer Nat. Rev. Immunol. 1,41-49[CrossRef][Medline]
  4. 3
  5. Diefenbach, A., Raulet, D. H. (2001) Strategies for target cell recognition by natural killer cells Immunol. Rev. 181,170-184[CrossRef][Medline]
  6. 4
  7. Karlhofer, F. M., Ribaudo, R. K., Yokoyama, W. M. (1992) MHC class I alloantigen specificity of Ly-49+ IL-2-activated natural killer cells Nature 358,66-70[CrossRef][Medline]
  8. 5
  9. Long, E. O., Burshtyn, D. N., Clark, W. P., Peruzzi, M., Rajagopalan, S., Rojo, S., Wagtmann, N., Winter, C. C. (1997) Killer cell inhibitory receptors: diversity, specificity, and function Immunol. Rev. 155,135-144[CrossRef][Medline]
  10. 6
  11. Sivori, S., Pende, D., Bottino, C., Marcenaro, E., Pessino, A., Biassoni, R., Moretta, L., Moretta, A. (1999) NKp46 is the major triggering receptor involved in the natural cytotoxicity of fresh or cultured human NK cells. Correlation between surface density of NKp46 and natural cytotoxicity against autologous, allogeneic or xenogeneic target cells Eur. J. Immunol. 29,1656-1666[CrossRef][Medline]
  12. 7
  13. Cantoni, C., Bottino, C., Vitale, M., Pessino, A., Augugliaro, R., Malaspina, A., Parolini, S., Moretta, L., Moretta, A., Biassoni, R. (1999) NKp44, a triggering receptor involved in tumor cell lysis by activated human natural killer cells, is a novel member of the immunoglobulin superfamily J. Exp. Med. 189,787-796[Abstract/Free Full Text]
  14. 8
  15. Vitale, M., Bottino, C., Sivori, S., Sanseverino, L., Castriconi, R., Marcenaro, E., Augugliaro, R., Moretta, L., Moretta, A. (1998) NKp44, a novel triggering surface molecule specifically expressed by activated natural killer cells, is involved in non-major histocompatibility complex-restricted tumor cell lysis J. Exp. Med. 187,2065-2072[Abstract/Free Full Text]
  16. 9
  17. Brumbaugh, K. M., Binstadt, B. A., Billadeau, D. D., Schoon, R. A., Dick, C. J., Ten, R. M., Leibson, P. J. (1997) Functional role for Syk tyrosine kinase in natural killer cell-mediated natural cytotoxicity J. Exp. Med. 186,1965-1974[Abstract/Free Full Text]
  18. 10
  19. Lanier, L. L., Corliss, B. C., Wu, J., Leong, C., Phillips, J. H. (1998) Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells Nature 391,703-707[CrossRef][Medline]
  20. 11
  21. Biassoni, R., Pessino, A., Bottino, C., Pende, D., Moretta, L., Moretta, A. (1999) The murine homologue of the human NKp46, a triggering receptor involved in the induction of natural cytotoxicity Eur. J. Immunol. 29,1014-1020[CrossRef][Medline]
  22. 12
  23. De Maria, A., Biassoni, R., Fogli, M., Rizzi, M., Cantoni, C., Costa, P., Conte, R., Mavilio, D., Ensoli, B., Cafaro, A., Moretta, A., Moretta, L. (2001) Identification, molecular cloning and functional characterization of NKp46 and NKp30 natural cytotoxicity receptors in Macaca fascicularis NK cells Eur. J. Immunol. 31,3546-3556[CrossRef][Medline]
  24. 13
  25. Falco, M., Cantoni, C., Bottino, C., Moretta, A., Biassoni, R. (1999) Identification of the rat homologue of the human NKp46 triggering receptor Immunol. Lett. 68,411-414[CrossRef][Medline]
  26. 14
  27. Pessino, A., Sivori, S., Bottino, C., Malaspina, A., Morelli, L., Moretta, L., Biassoni, R., Moretta, A. (1998) Molecular cloning of NKp46: a novel member of the immunoglobulin superfamily involved in triggering of natural cytotoxicity J. Exp. Med. 188,953-960[Abstract/Free Full Text]
  28. 15
  29. Storset, A. K., Slettedal, I. O., Williams, J. L., Law, A., Dissen, E. (2003) Natural killer cell receptors in cattle: a bovine killer cell immunoglobulin-like receptor multigene family contains members with divergent signaling motifs Eur. J. Immunol. 33,980-990[CrossRef][Medline]
  30. 16
  31. Naper, C., Hayashi, S., Lovik, G., Kveberg, L., Niemi, E. C., Rolstad, B., Dissen, E., Ryan, J. C., Vaage, J. T. (2002) Characterization of a novel killer lectin-like receptor (KLRH1) expressed by alloreactive rat NK cells J. Immunol. 68,5147-5154
  32. 17
  33. Castells, M. C., Wu, X., Arm, J. P., Austen, K. F., Katz, H. R. (1994) Cloning of the gp49B gene of the immunoglobulin superfamily and demonstration that one of its two products is an early-expressed mast cell surface protein originally described as gp49 J. Biol. Chem. 269,8393-8401[Abstract/Free Full Text]
  34. 18
  35. Wang, L. L., Mehta, I. K., LeBlanc, P. A., Yokoyama, W. M. (1997) Mouse natural killer cells express gp49B1, a structural homologue of human killer inhibitory receptors J. Immunol. 158,13-17[Abstract]
  36. 19
  37. Dissen, E., Berg, S. F., Westgaard, I. H., Fossum, S. (1997) Molecular characterization of a gene in the rat homologous to human CD94 Eur. J. Immunol. 27,2080-2086[Medline]
  38. 20
  39. Dissen, E., Ryan, J. C., Seaman, W. E., Fossum, S. (1996) An autosomal dominant locus, Nka, mapping to the Ly-49 region of a rat natural killer (NK) gene complex, controls NK cell lysis of allogeneic lymphocytes J. Exp. Med. 183,2197-2207[Abstract/Free Full Text]
  40. 21
  41. Westgaard, I. H., Dissen, E., Torgersen, K. M., Lazetic, S., Lanier, L. L., Phillips, J. H., Fossum, S. (2003) The lectin-like receptor KLRE1 inhibits natural killer cell cytotoxicity J. Exp. Med. 197,1551-1561[Abstract/Free Full Text]
  42. 22
  43. Chambers, W. H., Vujanovic, N. L., DeLeo, A. B., Olszowy, M. W., Herberman, R. B., Hiserodt, J. C. (1989) Monoclonal antibody to a triggering structure expressed on rat natural killer cells and adherent lymphokine-activated killer cells J. Exp. Med. 169,1373-1389[Abstract/Free Full Text]
  44. 23
  45. Fossum, S. (1988) Lymph-borne dendritic leucocytes do not recirculate, but enter the lymph node paracortex to become interdigitating cells Scand. J. Immunol. 27,97-105[CrossRef][Medline]
  46. 24
  47. Damoiseaux, J. G., Dopp, E. A., Calame, W., Chao, D., MacPherson, G. G., Dijkstra, C. D. (1994) Rat macrophage lysosomal membrane antigen recognized by monoclonal antibody ED1 Immunology 83,140-147[Medline]
  48. 25
  49. Barsumian, E. L., Isersky, C., Petrino, M. G., Siraganian, R. P. (1981) IgE-induced histamine release from rat basophilic leukemia cell lines: isolation of releasing and nonreleasing clones Eur. J. Immunol. 11,317-323[Medline]
  50. 26
  51. Reynolds, C. W., Bere, E. W., Jr, Ward, J. M. (1984) Natural killer activity in the rat. III. Characterization of transplantable large granular lymphocyte (LGL) leukemias in the F344 rat J. Immunol. 132,534-540[Abstract]
  52. 27
  53. Spruyt, L. L., Glennie, M. J., Beyers, A. D., Williams, A. F. (1991) Signal transduction by the CD2 antigen in T cells and natural killer cells: requirement for expression of a functional T cell receptor or binding of antibody Fc to the Fc receptor, Fc {gamma} RIIIA (CD16) J. Exp. Med. 174,1407-1415[Abstract/Free Full Text]
  54. 28
  55. Nicolls, M. R., Aversa, G. G., Pearce, N. W., Spinelli, A., Berger, M. F., Gurley, K. E., Hall, B. M. (1993) Induction of long-term specific tolerance to allografts in rats by therapy with an anti-CD3-like monoclonal antibody Transplantation 55,459-468[Medline]
  56. 29
  57. Brideau, R. J., Carter, P. B., McMaster, W. R., Mason, D. W., Williams, A. F. (1980) Two subsets of rat T lymphocytes defined with monoclonal antibodies Eur. J. Immunol. 10,609-615[Medline]
  58. 30
  59. Hunt, S. V., Fowler, M. H. (1981) A repopulation assay for B and T lymphocyte stem cells employing radiation chimaeras Cell Tissue Kinet. 14,445-464[Medline]
  60. 31
  61. Vaage, J. T., Naper, C., Lovik, G., Lambracht, D., Rehm, A., Hedrich, H. J., Wonigeit, K., Rolstad, B. (1994) Control of rat natural killer cell-mediated allorecognition by a major histocompatibility complex region encoding nonclassical class I antigens J. Exp. Med. 180,641-651[Abstract/Free Full Text]
  62. 32
  63. Jefferies, W. A., Green, J. R., Williams, A. F. (1985) Authentic T helper CD4 (W3/25) antigen on rat peritoneal macrophages J. Exp. Med. 162,117-127[Abstract/Free Full Text]
  64. 33
  65. Lovik, G., Vaage, J. T., Naper, C., Benestad, H. B., Rolstad, B. (1995) Recruitment of alloreactive natural killer cells to the rat peritoneum by a transfected cell line secreting rat recombinant interleukin-2 J. Immunol. Methods 179,59-69[CrossRef][Medline]
  66. 34
  67. Vaage, J. T., Dissen, E., Ager, A., Fossum, S., Rolstad, B. (1991) Allospecific recognition of hemic cells in vitro by natural killer cells from athymic rats: evidence that allodeterminants coded for by single major histocompatibility complex haplotypes are recognized Eur. J. Immunol. 21,2167-2175[Medline]
  68. 35
  69. Lovik, G., Vaage, J. T., Dissen, E., Szpirer, C., Ryan, J. C., Rolstad, B. (2000) Characterization and molecular cloning of rat C1qRp, a receptor on NK cells Eur. J. Immunol. 30,3355-3362[CrossRef][Medline]
  70. 36
  71. Qian, D., Sperling, A. I., Lancki, D. W., Tatsumi, Y., Barrett, T. A., Bluestone, J. A., Fitch, F. W. (1993) The {gamma} chain of the high-affinity receptor for IgE is a major functional subunit of the T-cell antigen receptor complex in {gamma} {delta} T lymphocytes Proc. Natl. Acad. Sci. USA 90,11875-11879[Abstract/Free Full Text]
  72. 37
  73. Vivier, E., Rochet, N., Kochan, J. P., Presky, D. H., Schlossman, S. F., Anderson, P. (1991) Structural similarity between Fc receptors and T cell receptors. Expression of the {gamma}-subunit of Fc {varepsilon} RI in human T cells, natural killer cells and thymocytes J. Immunol. 147,4263-4270[Abstract]
  74. 38
  75. Baniyash, M., Garcia-Morales, P., Bonifacino, J. S., Samelson, L. E., Klausner, R. D. (1988) Disulfide linkage of the {zeta} and {eta} chains of the T cell receptor. Possible identification of two structural classes of receptors J. Biol. Chem. 263,9874-9878[Abstract/Free Full Text]
  76. 39
  77. Berg, S. F., Fossum, S., Dissen, E. (1999) NILR-1, a novel immunoglobulin-like receptor expressed by neutrophilic granulocytes, is encoded by a leukocyte receptor gene complex on rat chromosome 1 Eur. J. Immunol. 29,2000-2006[CrossRef][Medline]
  78. 40
  79. Hoelsbrekken, S. E., Nylenna, O., Saether, P. C., Slettedal, I. O., Ryan, J. C., Fossum, S., Dissen, E. (2003) Cutting edge: molecular cloning of a killer cell Ig-like receptor in the mouse and rat J. Immunol. 170,2259-2263[Abstract/Free Full Text]
  80. 41
  81. Sivori, S., Vitale, M., Morelli, L., Sanseverino, L., Augugliaro, R., Bottino, C., Moretta, L., Moretta, A. (1997) p46, a novel natural killer cell-specific surface molecule that mediates cell activation J. Exp. Med. 186,1129-1136[Abstract/Free Full Text]
  82. 42
  83. Mandelboim, O., Lieberman, N., Lev, M., Paul, L., Arnon, T. I., Bushkin, Y., Davis, D. M., Strominger, J. L., Yewdell, J. W., Porgador, A. (2001) Recognition of haemagglutinins on virus-infected cells by NKp46 activates lysis by human NK cells Nature 409,1055-1060[CrossRef][Medline]
  84. 43
  85. Hibbs, M. L., Selvaraj, P., Carpen, O., Springer, T. A., Kuster, H., Jouvin, M. H., Kinet, J. P. (1989) Mechanisms for regulating expression of membrane isoforms of Fc {gamma} RIII (CD16) Science 246,1608-1611[Abstract/Free Full Text]
  86. 44
  87. Orloff, D. G., Ra, C. S., Frank, S. J., Klausner, R. D., Kinet, J. P. (1990) Family of disulphide-linked dimers containing the {zeta} and {eta} chains of the T-cell receptor and the {gamma} chain of Fc receptors Nature 347,189-191[CrossRef][Medline]
  88. 45
  89. Tsuji, M., Ezumi, Y., Arai, M., Takayama, H. (1997) A novel association of Fc receptor {gamma}-chain with glycoprotein VI and their co-expression as a collagen receptor in human platelets J. Biol. Chem. 272,23528-23531[Abstract/Free Full Text]
  90. 46
  91. Maeda, A., Kurosaki, M., Kurosaki, T. (1998) Paired immunoglobulin-like receptor (PIR)-A is involved in activating mast cells through its association with Fc receptor {gamma} chain J. Exp. Med. 188,991-995[Abstract/Free Full Text]
  92. 47
  93. Nakajima, H., Samaridis, J., Angman, L., Colonna, M. (1999) Human myeloid cells express an activating ILT receptor (ILT1) that associates with Fc receptor {gamma}-chain J. Immunol. 162,5-8[Abstract/Free Full Text]
  94. 48
  95. Blank, U., Ra, C., Miller, L., White, K., Metzger, H., Kinet, J. P. (1989) Complete structure and expression in transfected cells of high affinity IgE receptor Nature 337,187-189[CrossRef][Medline]
  96. 49
  97. Ferlazzo, G., Thomas, D., Lin, S. L., Goodman, K., Morandi, B., Muller, W. A., Moretta, A., Munz, C. (2004) The abundant NK cells in human secondary lymphoid tissues require activation to express killer cell Ig-like receptors and become cytolytic J. Immunol. 172,1455-1462[Abstract/Free Full Text]
  98. 50
  99. Fehniger, T. A., Cooper, M. A., Nuovo, G. J., Cella, M., Facchetti, F., Colonna, M., Caligiuri, M. A. (2003) CD56bright natural killer cells are present in human lymph nodes and are activated by T cell-derived IL-2: a potential new link between adaptive and innate immunity Blood 101,3052-3057[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
C. Chauvin, J.-M. Philippeau, C. Hemont, F.-X. Hubert, Y. Wittrant, F. Lamoureux, B. Trinite, D. Heymann, F. Redini, and R. Josien
Killer Dendritic Cells Link Innate and Adaptive Immunity against Established Osteosarcoma in Rats
Cancer Res., November 15, 2008; 68(22): 9433 - 9440.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. C. Saether, I. H. Westgaard, S. E. Hoelsbrekken, J. Benjamin, L. L. Lanier, S. Fossum, and E. Dissen
KLRE/I1 and KLRE/I2: A Novel Pair of Heterodimeric Receptors That Inversely Regulate NK Cell Cytotoxicity
J. Immunol., September 1, 2008; 181(5): 3177 - 3182.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. Thomas, J. K. Haseman, J. I. Goodman, J. M. Ward, T. P. Loughran Jr, and P. J. Spencer
A Review of Large Granular Lymphocytic Leukemia in Fischer 344 Rats as an Initial Step Toward Evaluating the Implication of the Endpoint to Human Cancer Risk Assessment
Toxicol. Sci., September 1, 2007; 99(1): 3 - 19.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Walzer, M. Blery, J. Chaix, N. Fuseri, L. Chasson, S. H. Robbins, S. Jaeger, P. Andre, L. Gauthier, L. Daniel, et al.
Identification, activation, and selective in vivo ablation of mouse NK cells via NKp46
PNAS, February 27, 2007; 104(9): 3384 - 3389.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Leeansyah, B. D. Wines, S. M. Crowe, and A. Jaworowski
The Mechanism Underlying Defective Fc{gamma} Receptor-Mediated Phagocytosis by HIV-1-Infected Human Monocyte-Derived Macrophages
J. Immunol., January 15, 2007; 178(2): 1096 - 1104.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. E. Bakema, S. de Haij, C. F. den Hartog-Jager, J. Bakker, G. Vidarsson, M. van Egmond, J. G. J. van de Winkel, and J. H. W. Leusen
Signaling through Mutants of the IgA Receptor CD89 and Consequences for Fc Receptor {gamma}-Chain Interaction
J. Immunol., March 15, 2006; 176(6): 3603 - 3610.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
P. Boysen, S. Klevar, I. Olsen, and A. K. Storset
The Protozoan Neospora caninum Directly Triggers Bovine NK Cells To Produce Gamma Interferon and To Kill Infected Fibroblasts
Infect. Immun., February 1, 2006; 74(2): 953 - 960.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0903428v1
76/6/1200    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Westgaard, I. H.
Right arrow Articles by Fossum, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Westgaard, I. H.
Right arrow Articles by Fossum, S.