Published online before print September 8, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RI
and CD3
,1,2
* Department of Anatomy, Institute of Basic Medical Sciences, University of Oslo, Norway;
Department of Medicine, Rheumatology Division, Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, Missouri; and
Institute of Immunology, Rikshospitalet University Hospital, Oslo, Norway
1 Correspondence: Department of Anatomy, University of Oslo, Box 1105 Blindern, N-0317 Oslo, Norway. E-mail: i.h.westgaard{at}basalmed.uio.no
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
47 kDa in interleukin-2-activated NK cells. The immunoreceptor tyrosine-based activation motif bearing adaptor proteins CD3
and the 
chain of FcRI for IgE (Fc
RI) with NKp46 from lysates of NK cells, indicating that rat NKp46 activates NK cell cytotoxicity by similar pathways as CD16.
Key Words: activating receptor • natural cytotoxicity • immunoglobulin superfamily • adaptor protein
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and/or the chain of FcRI for IgE (FcRI) [7
, 8
]. This interaction is thought to depend on salt bridges created between a positively charged arginine residue in the transmembrane (TM) domain of the receptor and a negatively charged aspartic acid residue at the corresponding position of the adaptor protein. Signaling through ITAM-containing adaptor proteins has previously been shown to involve tyrosine phosphorylation of ITAMs and recruitment and activation of the tyrosine kinases Syk or -associated protein 70 [9
, 10
], leading to activation of T cell and NK cell effector functions. Orthologs of the human NKp46 gene have previously been identified in the rat, mouse, monkey, and cattle [11
12
13
14
15
]. We have generated a monoclonal antibody (mAb) against rat NKp46 and used it to study the expression of NKp46 on different cell types. The lack of NK-specific markers in the rat has been a disadvantage. However, the newly generated anti-NKp46 mAb is a precise marker for all NK cells in the rat. In addition, we have for the first time in rodents demonstrated that NKp46 activates NK cell cytotoxicity and shown that it is noncovalently associated with CD3 and FcRI. |
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Cloning of rat NKp46
A cDNA library generated from interleukin (IL)-2-activated NK cells from PVG rats [16
] was screened with a cDNA probe corresponding to the 5'-untranslated region and open reading frame of mouse gp49B1 [17
, 18
]. Plaques were lifted onto nylon membranes (colony/plaque screen, NEN Life Science Products, Boston, MA) and hybridized to radiolabeled probe (Megaprime DNA labeling system, Amersham Biosciences, Buckinghamshire, UK) under low-stringency conditions, as described earlier. Isolated clones were sequenced on both strands as described previously [19
]. A cDNA library made from IL-2-activated NK cells from F344 rats [20
] and a rat spleen cDNA library from Sprague-Dawley (Clontech, Palo Alto, CA) were screened in search of similar genes.
Cell preparations
NK cells were purified from rat spleen by Isopaque-Ficoll density centrifugation (Lymphoprep, Axis-Shield, Oslo, Norway) followed by passage through nylon wool (Leucopac, Fenwal Laboratories, Deerfield, IL) and removal of T cells and B cells by negative selection as described [21
], yielding a >98% NK receptor (NKR)-P1+ NK cell population as determined by flow cytometry using mAb 3.2.3 [22
]. These cells were cultured for 14 days in medium containing rat recombinant IL-2 [21
]. Mesenterial lymph nodes from 2-month-old rats perfused with phosphate-buffered saline (PBS) were disrupted in PBS and filtered (CellStrainer, BD Biosciences, San Jose, CA). Cells from afferent lymph collected from mesenterially lymphadenectomized rats were obtained as described [23
]. Spleen cells were obtained by density centrifugation (Lymphoprep) followed by passage through nylon wool. Concanavalin A (ConA) blasts, thoracic duct lymphocytes, macrophages, and neutrophilic granulocytes were purified as described [19
]. The macrophage cell line R2 [24
], the mast cell line RBL-2H3 [25
], and the F344-derived NK cell lines RNK-16 [26
] and A181 [27
] were cultured under standard conditions [21
]. A stable, IL-2-dependent rat NK cell line, RNKDA1, was generated from DA rat spleen NK cells by long-term culture in complete medium with IL-2 and 2-mercaptoethanol. The cells were analyzed by flow cytometry and were shown to be NKp46+/NKR-P1+/CD3– [21
].
DNA and RNA electrophoresis
DNA was extracted from rat liver, digested with restriction endonucleases (New England Biolabs, Beverly, MA), subjected to horizontal agarose gel electrophoresis, and blotted onto nylon membranes (Biotrans membranes, ICN Biomedicals, Irvin, CA) by conventional methods. Extraction of total cellular RNA, formaldehyde agarose gel electrophoresis, and transfer to nylon membranes were performed by conventional methods. Equal loading of RNA in all lines was verified by ethidium bromide staining. Hybridization was performed under conditions described earlier [20
].
Generation of anti-NKp46 mAb WEN23 and WEN23 F(ab')2 fragments
The anti-NKp46 mAb WEN23 was obtained by immunizing BALB/c female mice with a soluble rNKp46/mFc2b fusion protein generated as follows: nt –3–729 of rat NKp46 was amplified by polymerase chain reaction (PCR) using gene-specific primers containing BamHI restriction sites (5' primer GGATCCGGTATGCTGCCAACACTCACTG, 3' primer GGATCCCTGCAATCCTGATTCTTTGGTTGA). The PCR product was cloned into pCR2.1-TOPO (Invitrogen, San Diego, CA). The BamHI fragment was inserted into the mammalian expression vector pcDNAI (Invitrogen) containing exons for the hinge, CH2, and CH3 regions of the mouse IgG2b gene (kindly provided by Hans-Christian Aasheim, The Norwegian Cancer Hospital, Oslo). 293T cells were transiently transfected with the chimeric gene construct using Lipofectamine (Invitrogen) as described [21
]. The cells were then grown for 4 days in serum-free AIM-V medium (Invitrogen). Soluble rNKp46/mFc2b fusion protein was purified from supernatant on a protein G column (HiTrap, Amersham Biosciences) and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Silver-staining revealed a major band of 120 kDa (nonreducing conditions).
Specificity of the generated mAb was confirmed by flow cytometry analysis of 293T cells transfected with the NKp46 expression construct. WEN23 F(ab')2 fragments were produced as described [21 ].
Flow cytometry
Two-color analysis was performed in five steps: Primary labeling was with anti-CD3 (G4.18, ref. [28
]), anti-NKR-P1 (3.2.3 [22
]), anti-CD4 (W3/25 [29
]), anti-CD8 (OX8 [29
]), anti-Ig
(OX12 [30
]), and ED1 [24
], followed by fluorescein isothiocyanate (FITC)-conjugated F(ab')2 of sheep anti-mouse (SAM) IgG (F-2266, Sigma Aldrich, St. Louis, MO), mouse IgG, biotinylated WEN23, and finally, phycoerythrin (PE)-conjugated streptavidin (Jackson ImmunoResearch Laboratories, West Grove, CA). Three-color analysis was performed in two steps using biotinylated WEN23, PE-conjugated anti-CD3, and FITC-conjugated anti-NKR-P1 (G4.18 and 10/78, respectively, BD Biosciences PharMingen, San Diego, CA), followed by allophycocyanin-conjugated streptavidin (Molecular Probes, Junction City, OR).
Redirected lysis assay
Standard 4 h 51Cr release cytotoxicity assays were performed as described [31
]. Exponentially growing FcR– YAC-1 (mouse) and RPMI8866 (human) and FcR+ P815 and P388D1 (both mouse) tumor cells were used as targets and IL-2-activated DA NK cells as effectors [21
]. Fifteen-minute preincubations with medium alone, WEN23, WEN23 F(ab')2, or a control Ig (anti-CD2, OX34, ref. [32
]) were performed where indicated.
Biochemistry
For immunoprecipitations, 20 x 106 cells were lysed in 1% digitonin buffer and precipitated using 3 µg WEN23, anti-CD3 (6B10.2, Santa Cruz Biotechnology, Santa Cruz, CA), or control Ig as detailed [21
]. Samples were run on SDS-PAGE, transferred to polyvinylidene difluoride membranes (Immobilon-P, Millipore Corp., Bedford, MA), and probed with 1:1000 anti-CD3 mAb, 1 µg/ml anti-FcRI antibody (Upstate Biotechnology, Lake Placid, NY), or 1:1000 antiphosphotyrosine mAb (4G10, Upstate Biotechnology), followed by goat anti-mouse IgG horseradish peroxidase (HRP) or goat anti-rabbit IgG HRP (Jackson ImmunoReseach Laboratories) and chemiluminescent detection (Super Signal West Pico, Pierce, Rockford, IL; BiomaxMR film, Eastman Kodak, Rochester, NY).
Sodium pervanadate stimulation was done as described [21 ]. For biotinylation of surface proteins, cells were washed three times in PBS, pH 8.0, incubated for 30 min at room temperature with 0.5 mg/ml N-hydroxysuccinimide-biotin (Sigma-Aldrich) in PBS, pH 8.0, at 25 x 106 cells/ml, and then washed three times in PBS, pH 8.0. Biotinylated cells were lysed in 1% digitonin buffer as described [21 ].
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Rescreening of the rat NK cell library with a NKp46 probe at low stringency and PCR analysis of two NK cell libraries (from PVG and F344 rats) plus a rat spleen cDNA library did not reveal variants with immunoreceptor tyrosine-based inhibitory motifs. Moreover, Southern blots of rat genomic DNA suggested a single gene without close relatives (data not shown), and computer searches of rat genomic sequence data yielded a single Nkp46 gene.
NKp46 is expressed by all NK cells
By Northern blot analysis, NKp46 transcription was detected in IL-2-activated NK cells and the NK cell lines RNK-16 and A181. NKp46 mRNA was not detectable in purified populations of B cells, CD4+, or CD8+ T cells, ConA blasts, granulocytes, peritoneal macrophages, the macrophage cell line R2, or the mast cell line RBL-2H3 (Fig. 1
). By Northern blot analysis, no NKp46 expression was detected with RNA from brain, heart, skeletal muscle, kidney, testis, liver, and thymus. No differences in the level of transcription could be seen in IL-2-stimulated NK cells from the DA, PVG, AO, AUG, AGUS, or LEW rat strains (data not shown).
 View larger version (32K): [in a new window] |
Figure 1. NKp46 is expressed by rat NK cells. Northern blot analysis of total RNA from different cell types hybridized to a full-length NKp46 probe. A181 and RNK16 are rat NK cell lines, R2 is a rat macrophage line, and RBL-2H3 is a rat mast cell line.
|
+, and ED1+ populations were NKp46–. Together, our findings indicate that NKp46 was not expressed on T cells, B cells, monocytes, or macrophages (Fig. 3A
and 3B
). Similar results were obtained with peripheral blood leukocytes. Less than 0.5% of the cells in bone marrow, thymus, and peritoneal fluid stained with WEN23. Granulocytes in the blood and bone marrow were NKp46– (data not shown). OX62+/MHC class II+ dendritic cells collected from afferent lymph of lymphadenectomized rats did not express NKp46 (Fig. 3A)
. To look for the presence of NK cells in lymph nodes, rats were perfused with PBS to remove contaminating blood cells. Essentially no NKp46+ cells (<0.3%) were detected (Fig. 3A)
. As previously shown, a subpopulation of rat CD3+ cells is NKR-P1dim [35
]. The functional nature of this cell population is poorly investigated, and they may represent NKT cells or conventional T cells expressing NK cell markers. Less than 0.5% of NKR-P1dim, CD3+ spleen cells expressed NKp46 (Fig. 3B)
.
 View larger version (24K): [in a new window] |
Figure 2. All IL-2-stimulated rat NK cells express NKp46. (A) The newly generated mAb WEN23 specifically recognizes rat NKp46, as demonstrated by flow cytometry analysis of 293T cells transfected with empty vector or with a rat NKp46 expression construct. Staining of transfected cells with SAM secondary antibody alone is shown for comparison. (B) Flow cytometry analysis of IL-2-stimulated NK cells with the anti-NKp46 mAb WEN23 and mAb specific for rat NKR-P1, CD3, Ig light-chain, and MHC class II.
|
 View larger version (36K): [in a new window] |
Figure 3. Flow cytometry analysis of different rat cell types using WEN23. (A) Two-color analysis of nylon wool-passed spleen cells, lymph node cells from PBS-perfused rats, and cells from afferent lymph collected from mesenteric, lymphadenectomized rats using biotinylated anti-NKp46 mAb WEN23 and mAb specific for rat CD3, CD4, CD8, Ig, NKR-P1, MHC class II, or markers for dendritic cells (OX62) and monocytes/macrophages (ED1). Staining with FITC-conjugated SAM and PE-conjugated streptavidin (str) was used as control. (B) Three-color analysis of nylon wool-passed rat spleen cells with WEN23, anti-CD3, and anti-NKR-P1. All cells tested were from the PVG strain.
|
R+) tumor cell lines P388D1 and P815 as targets. Lysis of the FcR+ targets was augmented by preincubation of the effector cells with WEN23 mAb (whole IgG molecules), indicating that NKp46 activates cytotoxicity (Fig. 4A
). In contrast to whole IgG WEN23, incubation with WEN23 F(ab')2 fragments led to reduced killing of P388D1 and P815 cells, suggesting that the mouse tumor target cells express a ligand for rat NKp46 and that binding to this ligand could be blocked by WEN23 F(ab')2. Lysis of the FcR– mouse tumor cell line YAC-1 and the human tumor cell line RPMI 8866 was reduced when effector cells were preincubated with WEN23 mAb (whole IgG), suggesting that rat NKp46 recognizes a phylogenetically conserved ligand (Fig. 4B)
. Treatment of the effector cells with an isotype-matched, cell-bound, control mAb had no effect on the level of cytotoxicity.
 View larger version (18K): [in a new window] |
Figure 4. Rat NKp46 activates NK cell-mediated cytotoxicity. Four-hour chromium release redirected lysis assay with IL-2-activated DA NK cells as effector cells and (A) the FcR+ mouse tumor cells P815 and P388D1 or (B) the FcR– mouse tumor cells YAC-1 and human tumor cells RPMI 8866 as targets. The effector cells were preincubated with medium alone, WEN23 whole Ig, WEN23 F(ab')2, or a cell-bound, control mAb as indicated.
|
47 kDa under nonreducing and reducing conditions. Immunoprecipitation with WEN23 of surface-biotinylated 293T cells transiently transfected with rat NKp46 yielded similar bands. This indicates that rat NKp46 is expressed as a monomer (Fig. 5A
and 5B
). The 12 kDa discrepancy between observed molecular mass and calculated mass of the NKp46 polypeptide probably reflects glycosylation.
 View larger version (34K): [in a new window] |
Figure 5. Rat NKp46 is expressed as a 47-kDa monomer and is associated with FcRI and CD3. Western blot (WB) analysis of (A) whole cell lysate (WCL) from 293T cells transiently transfected with a rat NKp46 expression construct or empty vector (EV) and (B) WEN23 immunoprecipitate (IP) from surface-biotinylated, transiently transfected 293T cells using HRP-conjugated streptavidin under nonreducing (NR) and reducing (R) conditions. (C–F) RNKDA1 cells were incubated with (+) or without (–) pervanadate (PV) and immunoprecipitated with WEN23, a cell-bound, control antibody [IgG1 (cIg)], or anti-CD3 mAb. Western blot analysis was performed using (C) the antiphosphotyrosine ( -Py) mAb 4G10, (D) WEN23 mAb, (E) polyclonal (P) anti-FcRI, and (F) anti-CD3 mAb. Relative molecular masses in kDa have been indicated.
|
mAb. By Western blot analysis under reducing conditions using an antiphosphotyrosine mAb, NKp46 and CD3 were found to coprecipitate with a band of 12 kDa plus a band of 21 kDa, compatible with the phosphorylated forms of FcRI and CD3, respectively [36
, 37
] (Fig. 5C)
. To further investigate the nature of the phosphorylated proteins associated with NKp46, Western blot analysis using WEN23 on NKp46 and CD3 immunoprecipitates was performed under nonreducing conditions, and CD3 was shown to coprecipitate NKp46 (Fig. 5D)
. In addition, Western blot analysis of the NKp46 immunoprecipitate with anti-FcRI antibodies under reducing conditions revealed bands of 10 and 12 kDa, probably representing nonphosphorylated and phosphorylated forms of FcRI, respectively (Fig. 5E)
. Together, these observations demonstrate that NKp46 is associated with FcRI and CD3. Western blot analysis under nonreducing conditions following immunoprecipitation with WEN23 revealed that NKp46 coprecipitated a band of 26 kDa stained by the anti-CD3 mAb (Fig. 5F)
. This molecular weight fits with a FcRI/CD3 heterodimer, indicating that NKp46 can associate with a disulfide-linked heterodimer of FcRI and CD3. A band of identical molecular mass was detected following immunoprecipitation with anti-CD3, corroborating the presence of a possible FcRI/CD3 heterodimer in this cell line. In addition, anti-CD3 precipitated a weak band of 32 kDa, suggesting the presence of the homodimeric form of CD3 [38
]. This band was not detectable in the NKp46 immunoprecipitate (Fig. 5F)
. In our hands, the anti-FcRI antibody did not perform well in immunoprecipitation. |
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Our finding that rat NKp46 activates cytotoxicity, as shown in a redirected lysis assay using the WEN23 mAb, corroborates previous observations in the human [41 ]. The reduced killing of the FcR, bearing mouse target cells following preincubation of the effector cells with WEN23 F(ab')2 fragments, suggested that the WEN23 F(ab')2 fragments blocked a NKp46 ligand on the mouse tumor cells, supporting previous data suggesting that human NKp46 interacts with a ligand on mouse tumor cells [6 , 41 ]. Our data with human tumor target cells suggest that rat NKp46 recognizes a ligand that is conserved between rodents and primates. Results obtained in the human point to virally encoded haemagglutinins as NKp46 ligands with binding in part dependent on sialic acid residues [42 ]. The putative tumor cell ligand may be structurally related to the virally encoded ligands, or alternatively, NKp46 can recognize different, unrelated ligands.
The biochemical analysis indicated that rat NKp46 associates with FcRI and CD3, as previously shown for the T cell receptor and human CD16 [43
, 44
]. The association between the TM regions of activating receptors and ITAM-containing adaptor proteins involves pairs of oppositely charged amino acid residues that form stable ionic bonds. The NKp46 TM region is highly conserved among species and contains the basic amino acid residue arginine at the N-terminal side as well as two acidic amino acid residues at the start of the cytoplasmic region. This pattern, with an arginine residue in the +3 position and a glutamic acid residue at the TM/cytoplasmic region transition, is also conserved among several Ig-like receptors with sequence similarities to NKp46, such as FcR (CD89), glycoprotein (GP)VI, paired Ig-like receptor (PIR)A1, and leukocyte Ig-like receptor (LILR)A1 and -A2 (alias LIR-6 and ILT1). A common feature of these receptors is their interaction with the ITAM-containing adaptor protein FcRI [45
46
47
]. Also CD16 [43
] and the FcRI [48
] chain have been shown to interact with FcRI, but their TM regions are dissimilar from that of NKp46, and their potential for salt-bridging to FcRI or CD3 is not evident from their primary sequences (Fig. 6
). The similarity between the TM regions of FcRI and CD3, both with an aspartic acid residue in the +3 position, suggests that they can substitute for each other in forming an ionic bond with NKp46 (Fig. 6)
.
 View larger version (67K): [in a new window] |
Figure 6. Alignment of the TM domain of several Ig-like receptors that associate with FcRI. Conserved-charged amino acid residues are shown in bold. LILRA1 is also known as LIR-6 and LILRA2, as ILT1. h, Human; r, rat; m, mouse; bt, cattle.
|
Received September 17, 2003; revised July 21, 2004; accepted August 11, 2004.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
RIIIA (CD16) J. Exp. Med. 174,1407-1415 chain of the high-affinity receptor for IgE is a major functional subunit of the T-cell antigen receptor complex in 
T lymphocytes Proc. Natl. Acad. Sci. USA 90,11875-11879-subunit of Fc RI in human T cells, natural killer cells and thymocytes J. Immunol. 147,4263-4270[Abstract] and 
chains of the T cell receptor. Possible identification of two structural classes of receptors J. Biol. Chem. 263,9874-9878 RIII (CD16) Science 246,1608-1611 and chains of the T-cell receptor and the chain of Fc receptors Nature 347,189-191[CrossRef][Medline]-chain with glycoprotein VI and their co-expression as a collagen receptor in human platelets J. Biol. Chem. 272,23528-23531 chain J. Exp. Med. 188,991-995-chain J. Immunol. 162,5-8This article has been cited by other articles:
 |
|
 |
|
  C. Chauvin, J.-M. Philippeau, C. Hemont, F.-X. Hubert, Y. Wittrant, F. Lamoureux, B. Trinite, D. Heymann, F. Redini, and R. Josien Killer Dendritic Cells Link Innate and Adaptive Immunity against Established Osteosarcoma in Rats Cancer Res., November 15, 2008; 68(22): 9433 - 9440. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. C. Saether, I. H. Westgaard, S. E. Hoelsbrekken, J. Benjamin, L. L. Lanier, S. Fossum, and E. Dissen KLRE/I1 and KLRE/I2: A Novel Pair of Heterodimeric Receptors That Inversely Regulate NK Cell Cytotoxicity J. Immunol., September 1, 2008; 181(5): 3177 - 3182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Thomas, J. K. Haseman, J. I. Goodman, J. M. Ward, T. P. Loughran Jr, and P. J. Spencer A Review of Large Granular Lymphocytic Leukemia in Fischer 344 Rats as an Initial Step Toward Evaluating the Implication of the Endpoint to Human Cancer Risk Assessment Toxicol. Sci., September 1, 2007; 99(1): 3 - 19. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Walzer, M. Blery, J. Chaix, N. Fuseri, L. Chasson, S. H. Robbins, S. Jaeger, P. Andre, L. Gauthier, L. Daniel, et al. Identification, activation, and selective in vivo ablation of mouse NK cells via NKp46 PNAS, February 27, 2007; 104(9): 3384 - 3389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Leeansyah, B. D. Wines, S. M. Crowe, and A. Jaworowski The Mechanism Underlying Defective Fc{gamma} Receptor-Mediated Phagocytosis by HIV-1-Infected Human Monocyte-Derived Macrophages J. Immunol., January 15, 2007; 178(2): 1096 - 1104. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Bakema, S. de Haij, C. F. den Hartog-Jager, J. Bakker, G. Vidarsson, M. van Egmond, J. G. J. van de Winkel, and J. H. W. Leusen Signaling through Mutants of the IgA Receptor CD89 and Consequences for Fc Receptor {gamma}-Chain Interaction J. Immunol., March 15, 2006; 176(6): 3603 - 3610. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Boysen, S. Klevar, I. Olsen, and A. K. Storset The Protozoan Neospora caninum Directly Triggers Bovine NK Cells To Produce Gamma Interferon and To Kill Infected Fibroblasts Infect. Immun., February 1, 2006; 74(2): 953 - 960. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
