PeproTech Inc.
Originally published online as doi:10.1189/jlb.0104019 on August 3, 2004

Published online before print August 3, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0104019v1
76/5/926    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Misson, P.
Right arrow Articles by Huaux, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Misson, P.
Right arrow Articles by Huaux, F.
(Journal of Leukocyte Biology. 2004;76:926-932.)
© 2004 by Society for Leukocyte Biology

Markers of macrophage differentiation in experimental silicosis

Pierre Misson1, Sybille van den Brûle, Virginie Barbarin, Dominique Lison and François Huaux

Unit of Industrial Toxicology and Occupational Medicine, Université Catholique de Louvain, Belgium

1 Correspondence: UCL, Industrial Toxicology and Occupational Medicine, 3054, Clos Chapelle aux Champs, 1200 Brussels, Belgium 027643259. E-mail: pierre-damien.misson{at}toxi.ucl.ac.be


arrow
ABSTRACT
 
Macrophages are characterized by a marked phenotypic heterogeneity depending on their microenvironmental stimulation. Beside classical activation (M1), it has been shown that macrophages could follow a different activation pathway after stimulation with interleukin (IL)-4 or IL-13 (M2). Recently, it has been postulated that those "alternatively activated" macrophages may be critical in the control of fibrogenesis. In an experimental model of silicosis, where pulmonary macrophages play a central role, we addressed the question of whether lung fibrosis development would be associated with alternative macrophage activation. As available markers for alternative macrophage activation, type-1 arginase (Arg-1), Fizz1, Ym1/2, and mannose receptor expression were evaluated at the mRNA and/or protein levels at different stages of the disease. Nitric oxide synthase-2 (NOS-2) expression was also examined to investigate the classical counterpart. We found that the expression of Arg-1, Fizz1, and NOS-2 in adherent bronchoalveolar lavage cells was highly up-regulated 3 days after silica administration but returned to control levels during the fibrotic stage of the disease (60 days). By comparing the early response to silica in C57BL/6 and BALB/c mice, we observed that the amplitude of Arg-1 mRNA up-regulation was not associated with the severity of lung fibrosis. Using a model of manganese dioxide particles (resolutive alveolitis), we showed that this early Arg-1 mRNA was not specific to a fibrogenic lung response. Our data indicate that the modifications of M1/M2 marker expression are limited to the early inflammatory stage of silicosis and that the establishment of a fibrotic process is not necessarily associated with M2 polarization.

Key Words: M1/M2 • fibrosis • collagen


arrow
INTRODUCTION
 
Macrophages are characterized by a marked phenotypic heterogeneity depending on their microenvironmental stimulation. Classical activation by microbial agents and/or T helper cell type 1 (Th1) cytokines, interferon-{gamma} (IFN-{gamma}), in particular, is associated with the production of large amounts of nitric oxide (NO) and proinflammatory cytokines involved in cytotoxicity, microbial killing, and regulation of cell proliferation (M1 or type-1 polarization) [1 2 ]. More recently, it was shown that macrophages could also follow a different activation pathway after stimulation with the Th2 cytokines interleukin (IL)-4 or IL-13 (M2 or type-2 polarization) [3 4 ]. The induction of arginase in these "alternatively activated" cells leads to polyamine and proline biosynthesis, and a possible role in the control of cell growth, collagen deposition, and tissue repair has been suggested [5 ].

Recent studies have shown that in murine Th2 granuloma, the development of fibrosis was associated with arginase up-regulation [6 ]. The same authors demonstrated that shifting to a type-1 macrophage activation by administration of IL-12 resulted in NO synthase-2 (NOS-2) overexpression and reduction of fibrosis intensity [7 ]. From these observations, we addressed the question of whether this association between type-2 macrophage polarization and fibrosis development also holds in other experimental models. We focused our interest on a murine model of silica-induced lung fibrosis, as the alveolar macrophage acts as a key cell in the pathogenesis of this chronic disease. Following silica exposure, these cells are indeed able to produce mediators involved not only in initiation and extension of inflammation but also in mesenchymal cells transformation and fibrosis [8 9 10 ]. At different stages of the disease, we evaluated the expression of Arginase-1 (Arg-1) and Fizz1, Ym1/2, and mannose receptor (MR) as markers of alternative macrophage activation [11 12 ]. NOS-2 expression was examined to investigate the classical counterpart.


arrow
MATERIALS AND METHODS
 
Animals
C57BL/6 and BALB/c female mice were obtained from the local breeding facility (Brussels, Belgium). NMRI female mice were purchased from Charles River Laboratories (Brussels, Belgium). Mice were used at 8–10 weeks of age. The animals were housed in positive pressure air-conditioned units (25°C, 50% relative humidity) on a 12-h light/dark cycle.

Instillation method
A suspension of crystalline silica particles (DQ12, d50=2.2 µm, a gift from Dr. Armbruster, Institut für Bewetterung, Klimatisierung und Staubbekämpfung, Essen, Germany), tungsten carbide (WC, d50=1 µm), or manganese dioxide (MnO2, d50=3.7 µm) in sterile 0.9% saline was injected into the lungs via the trachea by trans-oral instillation (2.5 mg; 60 µl/mouse). To allow sterilization and inactivation of any trace of endotoxin, particles were heated at 200°C for 2 h immediately before suspension and administration. Mice were anesthetized with a mix of Ketalar (N.V. Warner-Lambert, Zavemtem, Belgium) and Rompun [Bayer, Leverkusen, Germany; 1 and 0.2 mg intraperitoneally (i.p.)/mouse, respectively].

Lung homogenates
At selected time-points after instillation, the animals were killed with sodium pentobarbital (20 mg/animal i.p.). Whole lungs were perfused with 5 ml sterile 0.9% NaCl and excised. The left lobe was placed in Trizol (Invitrogen, Gaithersburg, MD) for subsequent RNA extraction, and the right lobes were transferred into 3 ml cold phosphate-buffered saline (PBS) for hydroxyproline measurements. The content of each tube was then homogenized for 30 s using an Ultra-Turax T25 homogenizer (Janke and Kunkel, Brussels, Belgium) and stored frozen at –80°C.

Bronchoalveolar lavage (BAL) cells and macrophage enrichment
The animals were killed with sodium pentobarbital (20 mg/animal i.p.), and BAL was performed by cannulating the trachea and lavaging the lungs with 4 vol 1 ml sterile NaCl 0.9%. BAL cells from saline- or silica-treated mice were pooled and centrifuged (400 g, 10 min, 4°C). For macrophage enrichment, cell pellets were resuspended in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with fetal bovine serum 10%, penicillin 50 U/ml, streptomycin 50 µg/ml, and L-glutamine (2 mM). Cells were plated in 24- or 96-well culture plates at, respectively, 106 (mRNA quantification) or 2 x 105 macrophages/well (arginase activity). Following 2 h adherence at 37°C in an atmosphere of 5% CO2, the supernatants were removed, and adherent cells were washed twice with 1 ml PBS. Macrophage enrichment was evaluated by microscopic examination of the culture wells after Diff-Quick staining, indicating a macrophage purity higher than 95% (Dave NV/SA, Brussels, Belgium).

Hydroxyproline assay
Collagen deposition was estimated by measuring the hydroxyproline content of the lung. The lung homogenates were hydrolyzed in 6 N HCl 24 h at 110°C. Hydroxyproline was assessed by high-pressure liquid chromatography analysis [13 ], and data are expressed as µg of hydroxyproline per lung.

RNA extraction and mRNA quantification
Total lung RNA extraction was performed with Trizol, according to the manufacturer’s instructions. RNA from total or adherent BAL cells was extracted with RNeasy mini-kits (Qiagen, Hilden, Germany). Residual DNA contamination was removed by treatment of the samples with DNA-free kit (Ambion, Austin, TX). RNA (100 ng–1 µg) was reverse-transcribed using Superscript RNase H reverse transcriptase (Invitrogen) with 350 pM random hexamers (Eurogentec, Seraing, Belgium) in a final volume of 25 µl. Resulting cDNA was then diluted 50x in sterile, distilled water and used as a template in subsequent real-time polymerase chain reactions (PCR). Sequences of interest were amplified using the following forward primers (Invitrogen): AGAGGGAAATCGTGCGTGAC (ß-actin), CAAGACAGGGCTCCTTTCAG (Arg-1), CAGCTGGGCTGTACAAACCTT (NOS-2), TCCCAGTGAATACTGATGAGA (Fizz1), GGGCATACCTTTATCCTGAG (Ym1/2), and CATGAGGCTTCTCCTGCTTCTG (MR); and reverse primers: CAATAGTGATGACCTGGCCGT (ß-actin), GTAGTCAGTCCCTGGCTTATGG (Arg-1), CATTGGAAGTGAAGCGTTTCG (NOS-2), CCACTCTGGATCTCCCAAGA (Fizz1), CCACTGAAGTCATCCATGTC (Ym1/2), and TTGCCGTCTGAACTGAGATGG (MR). A relative quantification of mRNA expression was performed on an ABI 7000 (Applied Biosystems, Foster City, CA) in the following conditions: 2 min 50°C, 10 min 95°C (15 s 95°C, 1 min 60°C) x 40. Six serial 1:10 dilutions of a positive control sample of cDNA were used as standards in each reaction. Standards and samples (5 µl) were amplified with 300 nM primers using SYBR green PCR master mix (Applied Biosystems) in a total volume of 25 µl. Preliminary settings confirmed that the technique allowed to detect the up-regulation of the evaluated, alternative activation markers after stimulation of murine macrophages with 10 ng/ml IL-4 (R&D Systems, Minneapolis, MN; data not shown).

Determination of arginase activity
Arginase activity was measured in adherent BAL cell lysates as described by Munder et al. [14 ]. Briefly, 2 x 105 adherent cells were lyzed with 100 µl Triton X-100 (0.1%). After 30 min shaking, arginase was activated by adding 100 µl Tris-HCl (25 mM) and 35 µl MnCl2 (10 mM, 10 min, 56°C). L-Arginine hydrolysis was conducted by incubating the cell lysate with 100 µl L-arginine (0.5 M, pH 9.7) at 37°C for 1 h. The reaction was stopped with 800 µl H2SO4 (96%)/H3PO4 (85%)/H2O (1:3:7). The produced urea was quantified at 540 nm after addition of 40 µl {alpha}-isonitrosopropiophenone (dissolved in 100% ethanol), followed by heating at 100°C for 20 min. One unit of enzyme is defined as the amount that catalyzes the formation of 1 µmol urea/min. The up-regulation of arginase activity after stimulation of murine macrophages with 10 ng/ml IL-4 (R&D Systems) could be detected by the technique in preliminary experiments (data not shown).

Immunocytochemistry
BAL cells from saline- or silica-treated mice were cytocentrifuged on glass slides using a Cytospin 3 (1500 rpm, 5 min, Shandon, Pittsburgh, PA). Cells were fixed in acetone for 2 min. Slides were then washed in 10 mM PBS (pH 7.4). Endogenous peroxidase activity was blocked by incubating the sections in 0.3% hydrogen peroxide for 30 min. After washing and blocking with normal rabbit serum for 10 min, slides were incubated for 1 h at room temperature with anti-human Arg-1 rabbit polyclonal immunoglobulin G antibody (Ab; 1 µg/ml; Santa Cruz Biotechnology, Santa Cruz, CA) or PBS and then visualized by peroxidase-conjugated avidin and diaminobenzidine with a Vectastain ABC kit (Vector Laboratories, Burlingame, CA), following the manufacturer’s instructions. Nuclei were counterstained with Mayer’s hemalun (Merck, Darmstadt, Germany).

Statistics
Treatment-related differences were evaluated using t-tests or one-way ANOVA followed by pair-wise comparisons using the Student-Newman-Keuls test, as appropriate. Statistical significance was considered at P < 0.05.


arrow
RESULTS
 
Arg-1 mRNA is early, but not persistently, overexpressed in the lung and BAL cells of silica-treated mice
C57BL/6 mice received an intratracheal instillation with saline or 2.5 mg crystalline silica. At different time-points after treatment, hydroxyproline content was measured in the lung homogenates to monitor fibrosis development. As shown in Figure 1 , the increase in hydroxyproline content indicated the progressive establishment of lung fibrosis in silica-treated animals with a clear effect 2 months after instillation.



View larger version (8K):
[in this window]
[in a new window]
 
Figure 1. Time-course of lung hydroxyproline content changes. At days (d) 3, 30, and 60 after instillation, hydroxyproline levels were measured in the lung homogenates obtained from saline- or silica-treated (2.5 mg) C57BL/6 mice. The results for individual mice are shown; the bars denote the mean values for each group (n=5). **, P< 0.01; and ***, P< 0.001, represent the level of significant differences in mean values measured in silica-treated mice compared with their corresponding saline-treated control, as analyzed by the Student-Newman-Keuls multiple comparison test.

Arg-1 and NOS-2 mRNA expression was evaluated as markers of alternative (M2) and classical macrophage activation (M1), respectively, at different stages of the disease. Arg-1 mRNA was up-regulated in total lung 3 days after silica administration as compared with saline-treated mice. This early lung response to silica was accompanied by a marked up-regulation of NOS-2 mRNA. The expression of both markers returned to control values at the fibrotic stage of the disease (60 days; Fig. 2A and B ).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Arg-1 and NOS-2 mRNA are early but not persistently expressed after silica administration. At days 3, 30, and 60 after instillation, Arg-1 (A, C, and E) and NOS-2 (B, D, and F) expression was measured in mRNA isolated from total lung (A and B: n=5), BAL cells (C and D: pools of five mice measured in triplicate), and adherent BAL cells (E and F: n=3) of saline- or silica-treated C57BL/6 mice. Data were normalized to the expression of ß-actin. Bars represent means ± SEM. **, P< 0.01; and ***, P< 0.001, represent the level of significant differences in mean values measured in silica-treated mice compared with their corresponding saline-treated control, as analyzed by the Student-Newman-Keuls multiple comparison test.

To focus further on the leukocyte population, we performed the same measurements on mRNA isolated from BAL cells (Fig. 2C and 2D) . Quantification of Arg-1 and NOS-2 transcript levels at different time-points after instillation revealed similar patterns as in lung homogenates.

To assess whether these modifications in total BAL mRNA were related to modifications in macrophages, BAL cells were enriched for macrophages by in vitro adherence. The mRNA expression of Arg-1 and NOS-2 once again followed the same time-course as observed for total lung and BAL cells (Fig. 2E and 2F) : The early overexpression of both genes did not persist 2 months after treatment.

Early Arg-1 mRNA induction is associated with up-regulation of the protein in pulmonary macrophages
To determine whether early Arg-1 mRNA induction was associated with an up-regulation of the protein, arginase activity was quantified in lysates of adherent BAL cells from C57BL/6 mice (Fig. 3 ). Three days after instillation, cells from silica-treated animals exhibited increased arginase activity compared with the control situation. However, as previously observed at the mRNA level, no significant induction of arginase activity was noted at the later stages of the disease.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 3. Arginase activity is early but not persistently increased in adherent BAL cells after silica administration. At days 3, 30, and 60 after instillation, arginase activity of adherent BAL cell lysates was determined in saline- or silica-treated C57BL/6 mice. Bars represent means ± SEM (n=3). **, P< 0.01 represents the level of significant differences in mean values measured in silica-treated mice compared with their corresponding saline-treated control, as analyzed by the Student-Newman-Keuls multiple comparison test.

To identify the cellular type overexpressing Arg-1 at the early stage of silicosis, we performed an immunocytochemical analysis of BAL cells from saline- or silica-treated mice. As shown in Figure 4 , Arg-1 immunoreactivity was nearly undetectable in control BAL cells (Fig. 4B) . Three days after silica administration, a strong immunostaining was observed in BAL cells (Fig. 4D) . Although neutrophils were negative for Arg-1, positive cells were morphologically identified as macrophages.



View larger version (88K):
[in this window]
[in a new window]
 
Figure 4. Arg-1 immunostaining of BAL cells. Three days after instillation, BAL cells from saline (A and B)- or silica-treated C57BL/6 mice (C and D) were immunostained with (B and D) or without (A and C) anti-Arg-1 Ab. Specific staining for Arg-1 appears in brown. Positive cells in BAL from silica-treated mice were morphologically identified as macrophages (original magnification: x400).

Fizz1 and Arg-1 transcripts share similar expression patterns in pulmonary macrophages from silica-treated mice
Beside Arg-1, other markers are available for the identification of alternative macrophage activation. In particular, Fizz1, Ym1/2, and MR were shown to be strongly up-regulated in alternatively activated macrophages [3 15 16 ]. The expression of these markers was measured in adherent BAL cells of C57BL/6 mice treated with silica. As shown in Figure 5 , the expression of Fizz1 was highly up-regulated 3 days after silica instillation but returned to control values at the later stages of the disease. Although the expression of Ym1/2 and MR could be detected in alveolar macrophages from saline-treated animals, no up-regulation was observed after silica treatment at any time-point of the disease (3d, 30d, and 60d; data not shown).



View larger version (9K):
[in this window]
[in a new window]
 
Figure 5. Fizz1 mRNA is early but not persistently expressed after silica administration. At days 3, 30, and 60 after instillation, Fizz1 expression was measured in mRNA isolated from adherent BAL cells of saline- or silica-treated C57BL/6 mice (n=3). Data were normalized to the expression of ß-actin. Bars represent means ± SEM. ***, P < 0.001 represents the level of significant differences in mean values measured in silica-treated mice compared with their corresponding saline-treated control, as analyzed by the Student-Newman-Keuls multiple comparison test.

The amplitude of Arg-1 up-regulation is not proportional to the severity of the fibrotic response
It was recently reported in the literature that macrophages from different strains of mice can respond differently when confronted with the same stimuli [17 ]. To investigate whether strain differences could influence macrophage activation status during the development of silica-induced lung fibrosis, we compared Arg-1 mRNA expression in C57BL/6 (Th1-like strain) and BALB/c (Th2-like strain) mice at different times after instillation of silica particles. In comparison with C57BL/6 mice, BALB/c mice were characterized by a lower susceptibility to silica, as indicated by lower early inflammatory response (evaluated by measurement of lactate dehydrogenase and total protein levels in BAL fluid; data not shown) and significantly lower hydroxyproline lung content 2 months after instillation (Fig. 6 A ).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 6. The amplitude of Arg-1 mRNA up-regulation is not proportional to the severity of the fibrotic disease. (A) At day 60 after instillation, hydroxyproline was measured in the lung homogenates obtained from saline- or silica-treated (2.5 mg) C57BL/6 and BALB/c mice. Bars represent means ± SEM. ***, P < 0.001 represents the level of significant differences in mean values measured in silica-treated mice compared with their corresponding saline-treated control, as analyzed by the Student-Newman-Keuls multiple comparison test (n=5). (B) At days 3, 30, and 60 after instillation, Arg-1 expression was measured in mRNA isolated from total lung of saline- or silica-treated C57BL/6 (B6) and BALB/c mice. Data were normalized to the expression of ß-actin. Bars represent means ± SEM. **, P< 0.01 and ***, P< 0.001 represent the level of significant differences in mean values measured in silica-treated mice compared with their corresponding saline-treated control, as analyzed by the Student-Newman-Keuls multiple comparison test (n=5).

Quantification of mRNA indicated for C57BL/6 (4.6-fold) and BALB/c (4.3-fold) mice a nearly identical up-regulation of Arg-1 3 days after silica administration, which did not persist at the fibrotic stage of the disease (Fig. 6B) .

Arg-1 mRNA early up-regulation is not specific to a fibrogenic response
To address the question of whether early up-regulation of Arg-1 mRNA is related to inflammation and/or to the later development of the lung fibrotic process, we evaluated Arg-1 mRNA expression in a comparative mouse model described previously [18 ]. Intratracheal instillation of silica or MnO2 particles was used in NMRI mice to induce, respectively, a fibrosing (FA) or a resolving alveolitis (RA). Tungsten carbide particles served as innocuous control particles [noninflammatory response (NI)]. As observed in C57BL/6 mice, Arg-1 mRNA expression in total lung of silica-treated NMRI animals was significantly up-regulated 3 days after treatment and returned to control values at later stages (Fig. 7 ). Although administration of MnO2 did not lead to the development of lung fibrosis, Arg-1 mRNA was highly up-regulated 3 days after instillation. Consistent with the intense, inflammatory reaction induced by the administration of MnO2 particles, a strong up-regulation of NOS-2 mRNA was also observed (data not shown). These observations indicated that early Arg-1 mRNA overexpression was not specific to silica and thus, not necessarily associated with a later fibrotic response.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 7. Arg-1 mRNA early up-regulation is not specific to a fibrogenic response. At days 3, 30, and 120 after instillation, Arg-1 expression was measured in mRNA isolated from total lung of saline-, tungsten carbide (NI)-, MnO2 (RA)-, or silica-treated (FA) NMRI mice. Data were normalized to the expression of ß-actin. Bars represent means ± SEM. ***, P< 0.001 represents the level of significant differences in mean values measured in dust-treated mice compared with their corresponding saline-treated control, as analyzed by the Student-Newman-Keuls multiple comparison test (n=5).


arrow
DISCUSSION
 
This study examined the phenotype of pulmonary macrophages during the development of silica-induced lung fibrosis. The main finding in this report is that the fibrotic response is not related to alternative (M2) or classical (M1) macrophage activation during the development of silicosis.

Although the exact contribution of granulocytes and lymphocytes in the development of silicosis is still highly controversial, pulmonary macrophages seem to play a key role by secreting a wide range of mediators involved in the process leading to fibrosis. Macrophage-derived molecules such as cytokines, growth factors, oxygen reactive species, destructive proteolytic enzymes, and eicosanoid metabolites are involved in acute lung inflammation and injury, as well as in parenchymal and mesenchymal cell activation, leading to exaggerated production and deposition of extracellular matrix proteins [8 9 10 ].

It was suggested that the development of fibrosis, a pathogenic process often associated with Th2 polarization, goes paired with alternative macrophage activation. This hypothesis was consistent with the results of several experimental studies, which indicated a type-2 cytokine-dependent up-regulation of Arg-1 during the establishment of lung fibrosis in mice infected with Schistosoma mansoni [6 ]. The same authors demonstrated that shifting to a type-1 macrophage activation by administering IL-12 resulted in NOS-2 overexpression and a reduction of fibrosis severity [7 ]. In another experimental model, Endo et al. [19] reported that Arg-1 was up-regulated in pulmonary macrophages during the establishment of bleomycin-induced lung fibrosis.

It is interesting that Th2 cytokines such as IL-4 and IL-13, which provide the environment for alternative macrophage activation, have been shown to be strongly involved in the pathogenesis of lung fibrosis, supporting the hypothesis of a link between cytokine expression, M2 macrophage activation, and fibrosis development. Following bleomycin administration, IL-4–/– mice developed significantly less fibrosis compared with IL-4+/+ mice [20 ]. Using a transgenic mouse model, Elias and co-workers [21] demonstrated that pulmonary overexpression of IL-13 leads to the development of subepithelial and adventitial airway fibrosis, probably mediated by transforming growth factor-ß1 stimulation and activation. In humans, it was reported that Th2 inflammation could play a role in the pathogenesis of idiopathic pulmonary fibrosis, as the expression of IL-4 but not IFN-{gamma} was strongly up-regulated in this fibrotic disease [22 ].

By measuring Arg-1, Fizz1, Ym1/2, and MR expression in adherent pulmonary macrophages at different stages of murine silicosis, we evaluated the potential association between the development of lung fibrosis and alternative activation of macrophages. During the acute inflammatory phase following silica administration, we found that Arg-1 and NOS-2 were strongly overexpressed in pulmonary macrophages. Consistent with our data, Nelin et al. [23] observed an early Arg and NOS-2 induction in rat lungs following silica exposure. Similar Arg-1 up-regulation in two strains with contrasted fibrotic response to silica particles suggested that this change is not determinant for the later development of lung fibrosis. As previously observed with silica, Arg-1 mRNA was highly up-regulated early after MnO2 instillation (resolutive alveolitis model). We therefore concluded that this early Arg-1 overexpression is mainly dependent on the inflammatory reaction and not related to the fibrotic response. Similar observations of coinduction of Arg-1 and NOS-2 during the inflammatory reaction have been reported in the literature. In vitro and in vivo experiments about rat macrophages have shown that lipopolysaccharide (LPS) stimulation induced an early NOS-2 mRNA up-regulation rapidly followed by Arg-1 overexpression [24 ]. In the mouse, Salimuddin et al. [25] reported that LPS injection induced a marked pulmonary NOS-2 up-regulation associated with overexpression of both arginase isoforms. The mRNA expression of a second marker of alternative macrophage activation, Fizz1, a resistin-like molecule initially found in allergic inflammation [26 ], was also shown to be up-regulated early after silica instillation. Despite its expression in inflamed airways and in fibrotic bleomycin-treated lungs, the role of this protein in inflammation and/or fibrosis, if any, is still unknown. Recent in vitro data suggested that Fizz1 could activate fibroblast and myofibroblast differentiation directly, but further studies are necessary to confirm the importance of such an activity in vivo [27 ].

The absence of association between alternative macrophage activation and the establishment of silica-induced lung fibrosis is in contrast with the results of several studies performed in other models of fibrosis. Among the main elements that could explain such differences, type-1/type-2 polarization of the immune response during the development of the fibrotic disease is probably an important determinant. Although the involvement of type-2 cytokines in the regulation of fibrosis in experimental models such as S. mansoni-induced granulomas is well characterized, contradictory results have been reported about immune polarization during the development of silicosis. Whereas some authors described an overproduction of IFN-{gamma} by lung CD4+ T lymphocytes in mice with silicosis, other studies have led to opposite results [28 ]. Indeed, following SiO2 instillation in FVB mice, Arras et al. [29] reported that IL-4 levels in lung tissue were dose-dependently up-regulated, and IFN-{gamma} levels were reduced in an opposite manner. In addition, recent studies using IFN-{gamma}–/–, IL-4–/–, and wild-type C57BL/6 mice demonstrated that genetic deficiency for one of these cytokines did not alter morphometric parameters of silica-induced lung fibrosis, suggesting that the extension of the disease is not intimately associated with a Th1 or Th2 cytokine profile [30 ]. This was further supported by our results comparing the Arg-1 response in BALB/c and C57BL/6 mice. Although the former strain is commonly reported to be Th2-prone, it also exhibited the lowest fibrotic response to silica particles. Furthermore, in our model, mRNA/protein quantification by real-time PCR/enzyme-linked immunosorbent assay did not indicate in C57BL/6 or BALB/c mice any up-regulation of IL-4, IL-13, or IFN-{gamma} in BAL or lung homogenates 2 months after silica treatment (data not shown). This absence of clear type-1/type-2 immune polarization in lung silicosis is probably related to the apparent absence of M1/M2 polarization of silicotic pulmonary macrophages in the present study.

In summary, our data indicate that in this model of lung fibrosis orchestrated by pulmonary macrophages, the modifications of M1/M2 marker expression are limited to the early inflammatory stage of the disease and that the establishment of a fibrotic process is not necessarily associated with M2 polarization.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by the Belgian National Fund for Scientific Research. P. M. is Research Fellow, and F. H. is Postdoctoral Researcher of the Belgian National Fund for Scientific Research. We thank Youssof Yakoub and Johan Casters for their excellent technical assistance.

Received January 13, 2004; revised June 3, 2004; accepted July 7, 2004.


arrow
REFERENCES
 
    1
  1. MacMicking, J., Xie, Q. W., Nathan, C. (1997) Nitric oxide and macrophage function Annu. Rev. Immunol. 15,323-350[CrossRef][Medline]
  2. 2
  3. Hibbs, J. B. (2002) Infection and nitric oxide J. Infect. Dis. 185,S9-S17
  4. 3
  5. Stein, M., Keshav, S., Harris, N., Gordon, S. (1992) Interleukin-4 potently enhances murine macrophage mannose receptor activity—a marker of alternative immunological macrophage activation J. Exp. Med. 176,287-292[Abstract/Free Full Text]
  6. 4
  7. Doyle, A. G., Herbein, G., Montaner, L. J., Minty, A. J., Caput, D., Ferrara, P., Gordon, S. (1994) Interleukin-13 alters the activation state of murine macrophages in-vitro—comparison with interleukin-4 and interferon-{gamma} Eur. J. Immunol. 24,1441-1445[Medline]
  8. 5
  9. Shearer, J. D., Richards, J. R., Mills, C. D., Caldwell, M. D. (1997) Differential regulation of macrophage arginine metabolism: a proposed role in wound healing Am. J. Physiol. 272,E181-E190
  10. 6
  11. Hesse, M., Modolell, M., La Flamme, A. C., Schito, M., Fuentes, J. M., Cheever, A. W., Pearce, E. J., Wynn, T. A. (2001) Differential regulation of nitric oxide synthase-2 and arginase-1 by type 1/type 2 cytokines in vivo: granulomatous pathology is shaped by the pattern of L-arginine metabolism J. Immunol. 167,6533-6544[Abstract/Free Full Text]
  12. 7
  13. Hesse, M., Cheever, A. W., Jankovic, D., Wynn, T. A. (2000) NOS-2 mediates the protective anti-inflammatory and antifibrotic effects of the Th1-inducing adjuvant, IL-12, in a Th2 model of granulomatous disease Am. J. Pathol. 157,945-955[Abstract/Free Full Text]
  14. 8
  15. Driscoll, K. E., Lindenschmidt, R. C., Maurer, J. K., Higgins, J. M., Ridder, G. (1990) Pulmonary response to silica or titanium dioxide: inflammatory cells, alveolar macrophage-derived cytokines, and histopathology Am. J. Respir. Cell Mol. Biol. 2,381-390
  16. 9
  17. Vanhee, D., Gosset, P., Wallaert, B., Voisin, C., Tonnel, A. B. (1994) Mechanisms of fibrosis in coal workers’ pneumoconiosis. Increased production of platelet-derived growth factor, insulin-like growth factor type I, and transforming growth factor ß and relationship to disease severity Am. J. Respir. Crit. Care Med. 150,1049-1055[Abstract]
  18. 10
  19. Vanhee, D., Gosset, P., Boitelle, A., Wallaert, B., Tonnel, A. B. (1995) Cytokines and cytokine network in silicosis and coal workers’ pneumoconiosis Eur. Respir. J. 8,834-842[Abstract]
  20. 11
  21. Gordon, S. (2003) Alternative activation of macrophages Nat. Rev. Immunol. 3,23-35[CrossRef][Medline]
  22. 12
  23. Noel, W., Raes, G., Ghassabeh, G. H., De Baetselier, P., Beschin, A. (2004) Alternatively activated macrophages during parasite infections Trends Parasitol 20,126-133[CrossRef][Medline]
  24. 13
  25. Biondi, P. A., Chiesa, L. M., Storelli, M. R., Renon, P. (1997) A new procedure for the specific high-performance liquid chromatographic determination of hydroxyproline J. Chromatogr. Sci. 35,509-512[Medline]
  26. 14
  27. Munder, M., Eichmann, K., Modolell, M. (1998) Alternative metabolic states in murine macrophages reflected by the nitric oxide synthase arginase balance: competitive regulation by CD4(+) T cells correlates with Th1/Th2 phenotype J. Immunol. 160,5347-5354[Abstract/Free Full Text]
  28. 15
  29. Loke, P., Nair, M. G., Parkinson, J., Guiliano, D., Blaxter, M., Allen, J. E. (2002) IL-4-dependent alternatively activated macrophages have a distinctive in vivo gene expression phenotype BMC Immunol 3,7[CrossRef][Medline]
  30. 16
  31. Raes, G., De Baetselier, P., Noel, W., Beschin, A., Brombacher, F., Hassanzadeh, G. (2002) Differential expression of FIZZ1 and Ym1 in alternatively versus classically activated macrophages J. Leukoc. Biol. 71,597-602[Abstract/Free Full Text]
  32. 17
  33. Mills, C. D., Kincaid, K., Alt, J. M., Heilman, M. J., Hill, A. M. (2000) M-1/M-2 macrophages and the Th1/Th2 paradigm J. Immunol. 164,6166-6173[Abstract/Free Full Text]
  34. 18
  35. Huaux, F., Lardot, C., Arras, M., Delos, M., Many, M. C., Coutelier, J. P., Buchet, J. P., Renauld, J-C., Lison, D. (1999) Lung fibrosis induced by silica particles in NMRI mice is associated with an upregulation of the p40 subunit of interleukin-12 and Th-2 manifestations Am. J. Respir. Cell Mol. Biol. 20,561-572[Abstract/Free Full Text]
  36. 19
  37. Endo, M., Oyadomari, S., Terasaki, Y., Takeya, M., Suga, M., Mori, M., Gotoh, T. (2003) Induction of arginase I and II in bleomycin-induced fibrosis of mouse lung Am. J. Physiol. Lung Cell. Mol. Physiol. 285,L313-L321[Abstract/Free Full Text]
  38. 20
  39. Huaux, F., Liu, T., McGarry, B., Ullenbruch, M., Phan, S. H. (2003) Dual roles of IL-4 in lung injury and fibrosis J. Immunol. 170,2083-2092[Abstract/Free Full Text]
  40. 21
  41. Lee, C. G., Homer, R. J., Zhu, Z., Lanone, S., Wang, X., Koteliansky, V., Shipley, J. M., Gotwals, P., Noble, P., Chen, Q., Senior, R. M., Elias, J. A. (2001) Interleukin-13 induces tissue fibrosis by selectively stimulating and activating transforming growth factor ß(1) J. Exp. Med. 194,809-821[Abstract/Free Full Text]
  42. 22
  43. Wallace, W. A., Ramage, E. A., Lamb, D., Howie, S. E. (1995) A type 2 (Th2-like) pattern of immune response predominates in the pulmonary interstitium of patients with cryptogenic fibrosing alveolitis (CFA) Clin. Exp. Immunol. 101,436-441[Medline]
  44. 23
  45. Nelin, L. D., Krenz, G. S., Chicoine, L. G., Dawson, C. A., Schapira, R. M. (2002) L-arginine uptake and metabolism following in vivo silica exposure in rat lungs Am. J. Respir. Cell Mol. Biol. 26,348-355[Abstract/Free Full Text]
  46. 24
  47. Sonoki, T., Nagasaki, A., Gotoh, T., Takiguchi, M., Takeya, M., Matsuzaki, H., Mori, M. (1997) Coinduction of nitric-oxide synthase and arginase I in cultured rat peritoneal macrophages and rat tissues in vivo by lipopolysaccharide J. Biol. Chem. 272,3689-3693[Abstract/Free Full Text]
  48. 25
  49. Salimuddin, , Nagasaki, A., Gotoh, T., Isobe, H., Mori, M. (1999) Regulation of the genes for arginase isoforms and related enzymes in mouse macrophages by lipopolysaccharide Am. J. Physiol. Endocrinol. Metab. 277,E110-E117[Abstract/Free Full Text]
  50. 26
  51. Holcomb, I. N., Kabakoff, R. C., Chan, B., Baker, T. W., Gurney, A., Henzel, W., Nelson, C., Lowman, H. B., Wright, B. D., Skelton, N. J., Frantz, G. D., Tumas, D. B., Peale, F. V., Jr, Shelton, D. L., Hebert, C. C. (2000) FIZZ1, a novel cysteine-rich secreted protein associated with pulmonary inflammation, defines a new gene family EMBO J 19,4046-4055[CrossRef][Medline]
  52. 27
  53. Liu, T. J., Dhanasekaran, S. M., Jin, H., Hu, B., Tomlins, S. A., Chinnaiyan, A. M., Phan, S. H. (2004) FIZZ1 stimulation of myofibroblast differentiation Am. J. Pathol. 164,1315-1326[Abstract/Free Full Text]
  54. 28
  55. Davis, G. S., Pfeiffer, L. M., Hemenway, D. R. (1999) Expansion of interferon-{gamma}-producing lung lymphocytes in mouse silicosis Am. J. Respir. Cell Mol. Biol. 20,813-824[Abstract/Free Full Text]
  56. 29
  57. Arras, M., Huaux, F., Vink, A., Delos, M., Coutelier, J. P., Many, M. C., Barbarin, V., Renauld, J. C., Lison, D. (2001) Interleukin-9 reduces lung fibrosis and type 2 immune polarization induced by silica particles in a murine model Am. J. Respir. Cell Mol. Biol. 24,368-375[Abstract/Free Full Text]
  58. 30
  59. Desaki, M., Sugawara, I., Iwakura, Y., Yamamoto, K., Takizawa, H. (2002) Role of interferon-{gamma} in the development of murine bronchus-associated lymphoid tissues induced by silica in vivo Toxicol. Appl. Pharmacol. 185,1-7[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
R. Pasula, B. E. Britigan, J. Turner, and W. J. Martin II
Airway Delivery of Silica Increases Susceptibility to Mycobacterial Infection in Mice: Potential Role of Repopulating Macrophages
J. Immunol., June 1, 2009; 182(11): 7102 - 7109.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-Z. Yang, B. Cui, H.-Z. Liu, Z.-R. Chen, H.-M. Yan, F. Hua, and Z.-W. Hu
Targeting TLR2 Attenuates Pulmonary Inflammation and Fibrosis by Reversion of Suppressive Immune Microenvironment
J. Immunol., January 1, 2009; 182(1): 692 - 702.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Shimamura, T. Fujisawa, S. R. Husain, M. Kioi, A. Nakajima, and R. K. Puri
Novel Role of IL-13 in Fibrosis Induced by Nonalcoholic Steatohepatitis and Its Amelioration by IL-13R-Directed Cytotoxin in a Rat Model
J. Immunol., October 1, 2008; 181(7): 4656 - 4665.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
G. Trujillo, E. C. O'Connor, S. L. Kunkel, and C. M. Hogaboam
A Novel Mechanism for CCR4 in the Regulation of Macrophage Activation in Bleomycin-Induced Pulmonary Fibrosis
Am. J. Pathol., May 1, 2008; 172(5): 1209 - 1221.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. M. Brown, E. J. Swindle, N. M. Kushnir-Sukhov, A. Holian, and D. D. Metcalfe
Silica-Directed Mast Cell Activation Is Enhanced by Scavenger Receptors
Am. J. Respir. Cell Mol. Biol., January 1, 2007; 36(1): 43 - 52.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P. Misson, F. Brombacher, M. Delos, D. Lison, and F. Huaux
Type 2 immune response associated with silicosis is not instrumental in the development of the disease
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L107 - L113.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. L. Mora, E. Torres-Gonzalez, M. Rojas, C. Corredor, J. Ritzenthaler, J. Xu, J. Roman, K. Brigham, and A. Stecenko
Activation of Alveolar Macrophages via the Alternative Pathway in Herpesvirus-Induced Lung Fibrosis
Am. J. Respir. Cell Mol. Biol., October 1, 2006; 35(4): 466 - 473.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. J. Reece, M. C. Siracusa, and A. L. Scott
Innate Immune Responses to Lung-Stage Helminth Infection Induce Alternatively Activated Alveolar Macrophages
Infect. Immun., September 1, 2006; 74(9): 4970 - 4981.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. Erdely, D. Kepka-Lenhart, M. Clark, P. Zeidler-Erdely, M. Poljakovic, W. J. Calhoun, and S. M. Morris Jr
Inhibition of phosphodiesterase 4 amplifies cytokine-dependent induction of arginase in macrophages
Am J Physiol Lung Cell Mol Physiol, March 1, 2006; 290(3): L534 - L539.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0104019v1
76/5/926    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Misson, P.
Right arrow Articles by Huaux, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Misson, P.
Right arrow Articles by Huaux, F.