science pharmaceutical expo biotech jobs
Originally published online as doi:10.1189/jlb.0204100 on July 16, 2004

Published online before print July 16, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0204100v1
76/4/804    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blanco, J.
Right arrow Articles by Esté, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blanco, J.
Right arrow Articles by Esté, J. A.
(Journal of Leukocyte Biology. 2004;76:804-811.)
© 2004 by Society for Leukocyte Biology

R5 HIV gp120-mediated cellular contacts induce the death of single CCR5-expressing CD4 T cells by a gp41-dependent mechanism

Julià Blanco1, Jordi Barretina, Bonaventura Clotet and José A. Esté

Retrovirology Laboratory, Fundació irsiCaixa, Hospital Universitari Germans Trias i Pujol, Universitat Autònoma de Barcelona, Catalonia, Spain

1Correspondence: Fundació irsiCaixa, Hospital Universitari Germans Trias i Pujol, 08916 Badalona, Catalonia, Spain. E-mail: jblanco{at}ns.hugtip.scs.es


arrow
ABSTRACT
 
The use of CXC chemokine receptor 4 (CXCR4) and CC chemokine receptor 5 (CCR5) by X4 and R5 human immunodeficiency virus (HIV) envelopes (Env) influences HIV cytopathicity. Here, we have evaluated the role of CCR5 and gp41 in Env-induced cell death occurring during the contacts of uninfected, primary cells with MOLT cells infected with different R5 and X4 HIV isolates. As reported for X4-Env, R5 HIV-infected cells destroyed CD4 T cells expressing the appropriate coreceptor by inducing the formation of syncytia and the death of single target cells. Therefore, only the small (<10%) CCR5+ subset of primary CD4 T cells was sensitive to cellular presentation of R5-Env, and CCR5–CD4 T cells showed complete resistance to R5-Env-mediated cell death. X4- and R5-infected cells killed single primary cells by a common mechanism that was dependent on gp41 function and induced a rapid loss of mitochondrial membrane potential and plasma membrane integrity in target cells. Single-cell death was not affected by the blockade of HIV replication in target cells or G-protein signaling through CXCR4/CCR5. In contrast, caspase inhibition (Z-Val-Ala-Asp-fluoromethylketone) profoundly changed the outcome of cell-to-cell contacts by reducing the number of single dead CD4 T cells and increasing the rate of syncytium formation. In conclusion, X4 and R5 HIV Env share a common gp41-dependent mechanism to kill CD4 T cells during cellular contacts. Env tropism and coreceptor expression but not differential killing mechanisms seem to govern the extent of cytopathic effects induced by HIV infection.

Key Words: coreceptors • cell death • fusion • caspases • envelope


arrow
INTRODUCTION
 
The study of viral factors involved in human immunodeficiency virus (HIV)-induced CD4 T cell death has rendered controversial results concerning the mechanism of cell death, apoptosis or necrosis, and the nature of dying cells, infected or uninfected. Although several authors emphasize the nonapoptotic death of productively infected cells [1 2 3 ], others have shown that uninfected cells die during HIV infection in vitro [4 ] or in vivo [5 ].

The expression of the HIV envelope (Env; gp120/gp41) has been shown to contribute to CD4 T cell death [6 7 8 ] by several mechanisms involving the ability of Env to interact with cellular receptors in infected and uninfected cells [9 10 11 12 13 14 ]. HIV Env uses CD4 as a first receptor and then interacts with one of the HIV coreceptors CXC chemokine receptor 4 (CXCR4; X4-Env) or CC chemokine receptor 5 (CCR5; R5-Env) to activate gp41-mediated fusion [15 ]. In most cell-culture models of HIV infection, X4 HIV isolates appear to be more cytopathic than R5 HIV isolates [16 17 18 ], and in vivo, X4 viruses have been associated with a faster disease progression [19 ]. However, R5 isolates are also able to deplete CD4 T cells and cause AIDS in HIV-infected patients [20 ].

Quantitative differences in the cytopathic effect of X4 and R5 HIV isolates in vitro can be explained by the expression of CXCR4 and CCR5 on target cells [17 ]. However, it is not clear how CD4 [14 , 21 , 22 ] and coreceptor signaling [12 , 23 ] triggered by gp120 binding contributes to these differences. In this regard, it is controversial whether X4- or R5-Env may induce cell death by caspase-independent or -dependent mechanisms [24 25 26 ].

In addition to CD4 and coreceptor-related events, we have recently described the active role of gp41 in bystander CD4 T cell death induced by cells expressing X4-Env [27 , 28 ]. Here, we have studied the role of gp41 and CCR5 during cell-surface R5-Env-induced cell death.


arrow
MATERIALS AND METHODS
 
Cells
Peripheral blood mononuclear cells (PBMC) from healthy donors were purified by Ficoll-Hypaque sedimentation. CD4 T cells were immediately isolated from purified PBMC by negative selection (StemCell, Vancouver, Canada) and were used without stimulation. Primary cells and the CD4+/CXCR4+/CCR5+ cell line MOLT-4/CCR5 cells were cultured in RPMI. Other cells (HeLa-P4R5, U87.CD4/CXCR4, and U87.CD4/CCR5) were cultured in Dulbecco’s modified Eagle’s medium. Media were supplemented with 10% heat-inactivated fetal calf serum (FCS; Invitrogen, Barcelona, Spain) and selection antibiotics when required.

Viruses and chronically infected cells
Recombinant HIV carrying Env genes corresponding to the NL4-3 or BaL isolates were constructed in a HIVHXB2 backbone as described [18 ]. Chronically infected cells were obtained after infection of MOLT-4/CCR5 cells with NL4-3 and BaL recombinant viruses and the previously described primary isolates CI-1-SI and 168.1 [29 , 30 ]. NL4-3 and BaL are prototypic X4 and R5 laboratory-adapted HIV isolates, respectively. CI-1-SI is a highly pathogenic X4 primary isolate, described previously [29 , 30 ]. 168.1 is a cloned, clinical isolate obtained from a HIV-infected patient with a nonsyncytium-inducing (NSI, R5) viral phenotype [30 31 32 ].

Persistently infected cells recovered after acute infection were assayed for Env expression by flow cytometry using pooled serum from HIV+ individuals revealed with goat anti-human immunoglobulin G (IgG; Sigma, Madrid, Spain) [28 ]. Env function was determined in cocultures (ratio 1:1) with reporter HeLa-P4R5 cells in the presence of 2 µM azidothymidine (AZT; Sigma) to evaluate ß-galactosidase (ß-gal) activity induced by cell-to-cell fusion. Viral tropism was assayed by infecting U87.CD4/CXCR4 and U87.CD4/CCR5 with cell-free supernatants from uninfected and infected MOLT-4/CCR5. The production of HIV p24 antigen was evaluated 5 days after infection [30 ] using a commercial enzyme-linked immunosorbent assay (ELISA) kit (Innogenetics, Madrid, Spain).

Cocultures of infected and uninfected cells
Uninfected MOLT-4/CCR5 cells labeled with the fluorescent probe DiO [27 ], PBMC, or purified CD4 T cells (2x105 cells) were cultured in 96-well plates with uninfected or HIV-infected MOLT-4/CCR5 cells (2x105 cells) for 24 h in RPMI containing 10% FCS. The following inhibitors were used: 2 µM reverse transcriptase inhibitor AZT, 0.25 µg/ml anti-CD4 monoclonal antibody (mAb) Leu3a (BD, Madrid Spain), 1 µM CCR5 antagonist TAK-779 [33 ], 10 µg/ml anti-CCR5 mAb PRO 140 (Progenics, Tarrytown, NY) [34 ], 10 µg/ml chimeric CD4-Ig compound PRO 542 (Progenics) [35 ], 1 µM gp41 inhibitors C34 and T-20 (Enfuvirtide, Service of Peptide Synthesis, University of Barcelona, Spain), 50 µM caspase inhibitor Z-Val-Ala-Ala-Asp-fluoromethylketone (Z-VAD-fmk; Sigma), and 1 µg/ml pertussis toxin (PTX; Sigma).

To compare the apoptogenic potential of virus-expressed and cell-surface-expressed Env, target cells were cultured for 24 h with increasing amounts of infected (NL4-3 or BaL) or uninfected MOLT/CCR5 cells and with cell-free viral preparations harvested from cultures of these cells. Viral inputs were normalized by the amount of p24 assessed by a commercial ELISA kit (Innogenetics).

Evaluation of cell death
In cocultures of uninfected and infected MOLT cells, in which most cells die as a consequence of syncytium formation and subsequent apoptosis, total cell death was analyzed after hypotonic lysis of syncytia and staining of isolated nuclei with propidium iodide (PI; Sigma). As described previously [27 ], nuclei showing subdiploid DNA content were considered to be apoptotic.

Cell death occurring in single target cells was quantified by flow cytometry in a forward- versus side-scatter (FCS and SSC, respectively) plot as described [27 ] and by determining mitochondrial membrane potential and plasma membrane integrity after simultaneous staining (37°C, 15') with 40 nM mitochondrial probe 3,3'-dihexyloxacarbocyanine iodide (DiOC6; Molecular Probes, Leiden, The Netherlands) and 1 µg/ml PI (Sigma). Primary cells were easily identified by morphological parameters or by CD3 and CD4 staining as described below. Gated CD4 T cells (living or dead) were more than 98% single events as assessed by determining the presence of doublets or higher cellular concatenates in a dot plot of area and width of signals. Contaminating events (usually less than 2%) were probably debris from MOLT cells or syncytia, which usually appeared close to, but with higher SSC values than, CD4 T cells. For analysis of mitochondrial membrane potential and PI uptake, only single events were analyzed. Syncytium formation was visualized in a Nikon TE-200 Eclipse microscope equipped with a Kappa charge-coupled device camera.

Characterization of living and dead cells
After coculture, cells were stained with phycoerythrin-labeled anti-CD8 mAb, peridinin chlorophyll protein-labeled anti-CD3 mAb, and anti-CD4 mAb, fluorescein isothiocyanate (FITC)-labeled mAb Leu3a (BD), which recognizes the gp120-binding site in CD4, or mAb L120.3 (BD), which does not cross-compete with gp120. For L120.3 staining, cells were washed after incubation with this mAb, and bound antibodies were revealed with FITC-labeled goat anti-mouse IgG. Cells were washed again and then incubated with anti-CD3 and anti-CD8 mAb. Flow cytometry analysis was done after gating living or dead lymphocytes. In some experiments, cells were labeled with the FITC-labeled anti-CCR5 mAb 2D7, and target cells were gated as CCR5-positive or -negative.

Detection of proviral DNA
After coculture, cells were collected and DNA extracted (QIAamp blood kit, Qiagen, Hilden, Germany). Proviral DNA was amplified using the following primers: CCTAGCATTTCATCACGTGGC (275–295 of HXB2) and TTCTTGAAGTACTCCGGATGCAG (303–325 of HXB2). In parallel, RNase P gene was amplified to assess total DNA (TaqMan RNase P control reagent, Applied Biosystems, Madrid, Spain). Quantification was performed in an ABIPrism 7000 sequence detection system (Applied Biosystems). After fitting to standard curves, data were given as the ratio of HIV DNA and RNase P copies. As HIV-infected MOLT-4/CCR5 cells contain integrated proviral DNA, de novo synthesis occurring in CD4 T cells was evaluated by subtracting background values obtained in control cultures of HIV-infected MOLT-4/CCR5. This background was 0.54 ± 0.05 and 3.0 ± 0.7 copies HIV/copies RNase P (mean±SD) for NL4-3- and BaL-infected MOLT/CCR5 cells, respectively.

Statistical analysis
Statistical analysis was performed using the two-sided Student’s t-test. P values <0.05 were considered to indicate statistical significance.


arrow
RESULTS
 
Characterization of chronically infected cells
Chronically infected cells were established by infecting MOLT-4/CCR5 cells with recombinant viruses bearing the Env corresponding to the laboratory-adapted HIV isolates NL4-3 (X4) and BaL (R5). After acute infection, viable cells were p24+ and CD4– (data not shown) and expressed comparable levels of Env on their surface (Fig. 1a ). Infected cells showed similar fusogenic capacity against HeLa-P4R5 reporter cells (Fig. 1b) and induced similar cytopathic effects when cocultured with uninfected, labeled MOLT-4/CCR5 cells, as assessed by the presence of syncytia and the level of subdiploid (dead) nuclei [27 ] (Fig. 1c) . Coreceptor use of viruses harvested from infected cells confirmed the use of CXCR4 by NL4-3 and the use of CCR5 by recombinant BaL (Fig. 1d) .



View larger version (47K):
[in this window]
[in a new window]
  		Figure 1. Characterization of HIV Env-expressing cells. (a) Uninfected (UNINF) and NL4-3- and BaL-infected MOLT-4/CCR5 cells were assayed for Env expression (open peaks). Solid peaks indicate control antibody staining. (b and c) Cells were also assayed for their ability to induce cell-to-cell fusion in cocultures with HeLa-P4-R5 cells or uninfected MOLT-4/CCR5 cells. (b) The ß-gal activity induced in HeLa-P4-R5 in the absence (solid bars) or the presence (shaded bars) of AZT (to block virus-mediated ß-gal activation). (c) Syncytia formed after 24 h of coculture with green-labeled, uninfected MOLT-4/CCR5 cells. Values correspond to the level of subdiploid nuclei, which were monitored as a measure of cell death (mean±SD of two experiments). (d) The tropism of Env was confirmed by infecting U87.CD4 cells expressing CXCR4 (solid bars) or CCR5 (open bars) with supernatants from infected cells. Figure shows p24 production after 5 days of infection.

Env-dependent cell death in primary lymphocytes
Unstimulated PBMC showed high sensitivity to cell-surface-expressed X4-Env-induced cell death [27 ]. After coculture with different MOLT-4/CCR5 cells, primary lymphocytes can be easily gated by morphologic parameters, which in turn allow for the analysis of the living and dead lymphocyte populations (Fig. 2a ). As expected, MOLT-4/CCR5/NL4-3 induced a marked increase of dead cells, compared with uninfected MOLT-4/CCR5 cells (R2, Fig. 2a ). CD4 staining with the L120.3 mAb [36 ] revealed the specific death of single CD4+ T cells (Fig. 2b) . In contrast, MOLT-4/CCR5/BaL cells induced a slight increase of morphologically dead CD4 T cells (Fig. 2b) .



View larger version (44K):
[in this window]
[in a new window]
  		Figure 2. Death of primary lymphocytes exposed to X4 and R5 HIV Env-expressing cells. Analysis of PBMC cocultured with uninfected (UNINF) and NL4-3- and BaL-infected MOLT-4/CCR5 cells. (a) Primary cells were gated as living (R1) or dead (R2), according to FSC and SSC parameters. Changes in primary cells are shown in a magnified lymphocyte region (lower plots), indicating the percentage of morphologically dead cells (R2). (b) CD3+ cells within R1 (upper plots) or R2 (lower plots) regions were analyzed for CD4 (mAb L120.3) and CD8 expression. Values indicate the percentage of cells in each quadrant.

To confirm the death of CD4 T cells, we analyzed mitochondrial membrane potential and plasma membrane function using DiOC6 and PI staining. After 24 h coculture with X4 or R5 HIV-infected cells, most of single dead (DIOC low) CD4 T cells displayed a necrotic or late apoptotic phenotype, defined by PI uptake (upper left quadrants in Fig. 3a ). Loss of mitochondrial membrane potential and plasma membrane function was concomitant to morphological features of death (low FCS values, Fig. 3a ). Analysis of pulse area and width revealed a negligible (less than 2%) presence of contaminating small syncytia or debris in R1 or R2 gates (data not shown).



View larger version (32K):
[in this window]
[in a new window]
  		Figure 3. Death of primary CD4 T cells required full Env function and cellular contacts. (a) Analysis of plasma and mitochondrial membrane functions in negatively selected CD4 T cells cultured for 24 h with uninfected (UNINF) and NL43- and BaL-infected MOLT/CCR5 cells. Cells in morphologically living and dead lymphocyte gates (R1 and R2 in Fig. 2 ) were analyzed jointly after DiOC6 and PI staining. Values show the percentage of cells in each quadrant. Inserts in the upper right quadrants show morphological analysis of DIOCbright PIlow(living, lower right), DIOClow PIlow (dying, lower left), or DIOClow PIbright (dead, upper left). (b) Different MOLT-4/CCR5 cells were cocultured with purified CD4 T cells in the absence or the presence of the indicated drugs (see Materials and Methods for drug concentration). Cell death was analyzed as in a. Mean ± SD of three experiments. (c) Analysis of cell death occurring after virus-associated or cell-associated Env presentation. Purified CD4 T cells were cultured with increasing amounts of NL4-3- and BaL-infected MOLT/CCR5 cells (solid symbols) or cell-free supernatants from these cells (open symbols). The content of p24 gag protein served to assess viral input. Cell death was measured after 24 h of culture as in a. Mean ± SD of two experiments.

Consistent with morphological data, NL4-3-infected cells induced higher levels of single-cell death than BaL-infected cells. Despite strong quantitative differences, single-cell death induced by R5-Env reached low but significant values in cocultures of purified CD4 T cells with MOLT-4/CCR5/BaL cells (7±2% of dead cells compared with 2±1% in control cocultures, P<0.05). Agents targeting CD4 (PRO 542 or mAb Leu3a) inhibited X4- and R5-Env-induced death. In contrast, agents blocking CCR5 (PRO 140 and TAK-779) specifically inhibited R5- but not X4-Env-induced cell death. Fusion (gp41) inhibitors C34 and Enfuvirtide (T-20) blocked cell death induced by both Env irrespective of coreceptor use (Fig. 3b) , suggesting that in addition to CCR5 expression, BaL-induced cell death required gp41 function. Moreover, PTX treatment used to block G-protein-dependent signals through CXCR4 or CCR5 did not inhibit cell death (Fig. 3b) . No signs of CD4 T cell death were observed 24 h after incubation of CD4 T cells with supernatants of MOLT/CCR5 cells containing equivalent or higher amounts of p24 than cellular preparations (Fig. 3c) , suggesting that cell-to-cell contacts are a prerequisite for cell death to occur.

R5-Env selectively killed CCR5-expressing CD4 T cells
It is well established that few primary CD4 T cells express detectable levels of CCR5 [37 ]. Indeed, only 9 ± 2% (mean±SD, n=8) of CD4 T cells expressed CCR5 in our preparations, and CXCR4 was detected in 98 ± 2% of cells. Analysis of CCR5 expression (defined by 2D7 staining) in CD4 T cells cocultured with MOLT-4/CCR5/BaL cells revealed a specific loss of living CCR5+ cells, which was insensitive to AZT but was inhibited by blocking Env function at the coreceptor or the gp41 level (Fig. 4a ). The loss of CCR5+ cells was not only explained by syncytium formation but was also associated to a specific increase in the death (38±9%) of single CCR5+ CD4 T cells. Conversely, viability of CCR5– cells remained unchanged (Fig. 4b) . Cell death was insensitive to AZT but was completely inhibited by TAK-779 or C34 (Fig. 4b) . Despite these opposite effects on Env-induced cell death, AZT and C34 appeared to be equally efficient inhibiting the synthesis of proviral DNA in cocultures of CD4 T cells with NL4-3- or BaL-infected MOLT-4/CCR5 cells with PBMC, as both drugs returned proviral DNA content to background values (Fig. 4c) , suggesting that productive infection did not contribute to short-term (24 h) death occurring during cellular contacts.



View larger version (37K):
[in this window]
[in a new window]
  		Figure 4. R5-Env selectively killed CCR5+/CD4 T cells. (a) Analysis of CCR5 expression in gated CD4 T cells after coculture with uninfected (UNINF) or BaL-infected MOLT-4/CCR5 cells in the presence of the indicated drugs. (b) Analysis of cell death occurring in primary CD4 T cells cultured with uninfected (open bars) or BaL-infected (solid bars) MOLT-4/CCR5 cells in the presence of the indicated drugs; cells were stained with the anti-CCR5 mAb 2D7 and gated as CCR5– (left) or CCR5+ (right). Mean ± SD of three experiments. (c) The effect of AZT and C34 on the synthesis of proviral DNA in cocultures of PBMC with NL4-3- and BaL-infected MOLT-4/CCR5 cells. Data shown are values of specific de novo DNA synthesis (solid bars) calculated after subtraction of background values from NL4-3- or BaL-infected cells, 0.54 ± 0.05 and 3.0 ± 0.7 copies HIV/copies RNase P, respectively. Cell death is also shown (open bars). (d) Cell death occurring in long-term cultures of primary CD4 T cells with uninfected (open squares) or NL4-3 (solid squares)- or BaL-infected (shaded squares) MOLT-4/CCR5 cells. Mean ± SD of four experiments.

Prolonged cocultures of MOLT-4/CCR5/BaL cells with CD4 T cells confirmed the resistance of CCR5–/CD4 T cells to R5-Env-induced death. After 5 days, MOLT-4/CCR5/BaL cells induced only a modest increase in the number of dead CD4 T cells (Fig. 4d) , despite massive binding of gp120 to CD4, as measured by the blockade of the Leu3A epitope of CD4 (83±2%, data not shown) in living cells. Taken together, our data suggest that signaling elicited by BaL gp120 binding to CD4 was not sufficient to kill unstimulated CD4 T cells and that CCR5 expression is required for gp41-mediated R5-Env-induced single-cell death.

CD4 T cell death induced by primary HIV isolates
To extend our observations to primary HIV isolates, we infected MOLT-4/CCR5 cells with the virus strains 168.1 [30 31 32 ] and CI-1-SI [30 ], displaying R5 and X4 phenotype in U87 cells, respectively (Fig. 5a ). When cocultured with primary, unstimulated CD4 T cells from healthy donors, MOLT/CCR5 cells infected with the CI-1-SI isolate were more pathogenic than 168.1-infected cells (58±5% and 4.2±0.3% of single dead CD4 T cells, respectively, Fig. 5b ). However, both Env induced single-cell death by a mechanism that required CD4 and coreceptor expression and were inhibited by the gp41 inhibitor C34 (2±1 and 2.1±0.3% of dead target cells for CI-1-SI and 168.1 Env, respectively, Fig. 5c ), suggesting that the ability to kill coreceptor-expressing CD4 T cells is a general feature of HIV-infected cells.



View larger version (28K):
[in this window]
[in a new window]
  		Figure 5. Cell death induced by primary HIV isolates. (a) The tropism of 168.1 and CI-1-SI isolates was confirmed by infecting U87.CD4 cells expressing CXCR4 (solid bars) or CCR5 (open bars) with supernatants from infected cells. Figure shows p24 production after 5 days of infection. UNINF, Uninfected. (b) The indicated MOLT-4/CCR5-infected cells were cocultured with purified CD4 T cells. Cells in morphologically living and dead lymphocyte gates (R1 and R2 in Fig. 2 ) were analyzed jointly after DiOC6 and PI staining. Values show the percentage of cells in each quadrant. (c) The effect of AZT, AMD3100, PRO 140, PRO 542, or C34 (see Materials and Methods for drug concentration) on cell death occurring in these cocultures was also evaluated. Lymphocytes were analyzed as in Figure 3 . Mean ± SD of four experiments.

The effect of caspase inhibition on R5- and X4-Env-induced single-cell death
Blockade of gp41 function by C34 abrogated all signs of single-cell death and syncytium formation (Fig. 6a ). However, blockade of caspase activities by the pan-caspase inhibitor Z-VAD-fmk reduced the number of single dead cells, as measured by PI uptake and loss of mitochondrial membrane potential (Fig. 6a) with a concomitant increase in the size of syncytia (Fig. 6a) . To investigate the mode of action of Z-VAD-fmk, we performed kinetic analysis of cell death inhibition. Z-VAD-fmk was able to inhibit cell death induced by X4- and R5-Env-presenting cells at short (2–4 h) time-points (Fig. 6b) . As syncytia die after a caspase-independent loss of mitochondrial membrane potential [9 ], no effect of Z-VAD-fmk on syncytium survival is expected at these short times, suggesting that the increase in syncytium formation observed in the presence of Z-VAD-fmk may be a result of fusion of cells that otherwise would die during cellular contacts. Consistently, Z-VAD-fmk failed to significantly increase the recovery of single living CD4 T cells after 24 h coculture with X4- and R5-Env-presenting cells, contrasting with the complete protection induced by C34 (Fig. 6c) .



View larger version (40K):
[in this window]
[in a new window]
  		Figure 6. The effect of caspase inhibition on CD4 T cell death. (a) Analysis of mitochondrial and plasma membrane function in gated CD4 T cells cocultured with NL4-3-infected MOLT-4/CCR5 in the absence or the presence of C34 and Z-VAD-fmk. Lymphocytes were gated by cell morphology (top panels). Cells in R1 and R2 were analyzed jointly after DIOC and PI staining (middle panels). Cocultures were microphotographed after 12 h of incubation (bottom panels). (b) PBMC were cultured with NL4-3 (left)- and BaL-infected (right) MOLT-4/CCR5 cells in the absence or the presence of the indicated inhibitors. For each coculture, single-cell death was assessed at the indicated times as in a. A representative experiment is shown. UNINF, Uninfected. (c) The percentage of single living CD4 T cells in cocultures of PBMC with uninfected (open bars) or NL4-3 (solid bars)- or BaL-infected cells (shaded bars) in the absence or the presence of C34 and Z-VAD-fmk was analyzed. Results are mean ± SD of two different experiments and are given as percent of uninfected coculture.


arrow
DISCUSSION
 
We have reported that the death of single CD4 T cells induced by cell-surface-expressed X4 HIV Env completely depends on gp120 interaction with CD4/CXCR4 and on gp41 function [12 , 27 , 28 ]. Here, we extend these observations to persistently infected cells expressing R5-Env from laboratory and primary HIV isolates. In all cases, cell death was independent of the productive infection of target cells (Fig. 4c) but required gp120 and gp41 functions and cellular presentation, as it was not observed after short-term (24 h) incubation with cell-free virus particles (Fig. 3c) [12 , 27 , 28 ]. Although several authors have reported an apoptogenic activity of recombinant or virus-expressed X4 and R5 gp120 [10 , 21 , 25 , 38 ], this effect seems to require long incubation times (more than 24 h) and to reach low levels in primary T cells [39 ], which have been described as resistant to cell death induced by free viruses [26 ]. In agreement with this latter report, we were able to detect CD4 T cell death exclusively after presentation of Env by persistently infected cells. In these settings, we were unable to assign an active role to CD4 or CCR5 signals in R5-Env-induced cell death, which was completely dependent on gp41 activity (Fig. 3b) , as described for X4-Env [12 , 14 ]. Cytopathicity of gp41-dependent events has been described during syncytium formation [40 , 41 ] or self-destruction of Env-expressing CD4+ cells [26 ]. Here, we show that during cellular contacts, X4- and R5-Env-induced cell death could be defined by morphological changes, PI staining, loss of mitochondrial membrane potential, independence of G-protein signals, sensitivity to Z-VAD-fmk, and gp41 dependence. Thus, X4- and R5-Env-expressing cells appear to kill coreceptor-expressing cells via a similar mechanism.

The absence of the appropriate coreceptor prevents the activation of gp41 function, rendering cells lacking CCR5 completely resistant to short-term (24 h, Fig. 4b ) or long-term (5 days, Fig. 4d ) R5-Env-induced killing. Moreover, stimulation with phytohemagglutinin, interleukin (IL)-2, IL-4, or IL-7 failed to sensitize CD4+/CCR5– cells to R5-Env presentation (data not shown). Therefore, massive cytopathic effects induced by R5-Env should not be expected in experimental models of HIV infection (tonsil or thymus), where the expression of CCR5 is low [16 ]. In contrast, irreversible depletion of gut lymphocytes by R5 viruses has been reported in primary HIV infection [42 ]. In fact, PBMC from HIV-infected patients [43 ] or specific CD4 T cell subsets, such as the above-mentioned gut or lung lymphocytes, express high levels of CCR5 [44 , 45 ] and are potential targets for R5-Env (gp41)-induced death. Thus, the use of CCR5- or CD4-blocking agents such as PRO 140 or PRO 542, whose anti-HIV activity in vivo has been recently described [46 ], may be relevant in AIDS clinical practice beyond their blockade of HIV replication at the entry level.

Cell-to-cell HIV transmission, single-cell death, and effective cell-to-cell fusion (syncytium formation) are possible outcomes for the contact between HIV-infected and uninfected cells. Single-cell death and syncytium formation result in the loss of single living CD4 T cells and assuming that dead cells are unable to support fusion and that syncytium formation is an irreversible process [47 ], are mutually excluding processes. Thus, our data suggest the sequence of events shown in Figure 7 . Cellular synaptic junctions involving HIV Env, CD4, and coreceptor [48 ] result in a high number of gp41 activation events, which can result in single-cell death or cell fusion (Fig. 7) . Rescuing cellular conjugates from death with caspase inhibitors would increase the success of the cell-to-cell fusion process. Therefore, despite little quantitative effects on remaining CD4 T cells after coculture, Z-VAD-fmk has a strong, qualitative impact on the loss of CD4 T cells (Fig. 6) , which may help to explain controversial results concerning the role of caspase activation during HIV Env-induced cell death [24 , 25 ].



View larger version (14K):
[in this window]
[in a new window]
  		Figure 7. Model for cytopathic effects during contacts between uninfected and HIV-infected cells. In the absence of coreceptor, infected (upper dark) and uninfected (lower) cell-to-cell contacts fail to trigger apoptotic signals. However, expression of the appropriate receptors allows for the activation of fusogenic activity of gp41 that can lead to a fusion event (syncytium formation) or to the death of target cell before irreversible fusion occurs. Caspase inhibitor (Z-VAD-fmk) modulates the balance between these outcomes.

As for other viral infections, it is not in the interest of HIV to trigger premature target cell death, which would result in reduced viral progeny [49 ]. However, HIV Env-induced cell death is restricted to cellular contacts (Fig. 3c) , which are known to increase 100- to 1000-fold the infectivity of HIV as compared with cell-free viral preparations [50 ]. Therefore, one can speculate that death of some target cells may be the price that HIV pays for increasing the efficiency of infection. A better characterization of the role of cell-to-cell contacts in HIV pathogenesis and the identification of factors increasing or inhibiting cell death during these contacts will help to understand the relevance of this process in vivo.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by the Fondo de Investigaciones Sanitarias (FIS), Projects 02/0798 and Red Cooperativa de Investigación en SIDA (RIS), Ministerio de Ciencia y Tecnologia, Project BFI 03-00405, Fundació Marató de TV3, Project 020930, and the European Comission Project LSHG-CT-2003-503480. J. Blanco is a researcher of the Fundació IGTP, FIS 98/3047. We thank Arantxa Gutiérrez for technical assistance, Dr. Bryan O’Hara from Progenics for providing PRO 542 and PRO 140, Takeda Chemical Industries, Drs. Masanori Baba, Bruce Chesebro, and Quentin Sattentau, as well as NIH and NIBSC AIDS Reagent Programs for cells and reagents.

Received February 20, 2004; revised June 1, 2004; accepted June 13, 2004.


arrow
REFERENCES
 
    1
  1. Bolton, D. L., Hahn, B. I., Park, E. A., Lehnhoff, L. L., Hornung, F., Lenardo, M. J. (2002) Death of CD4(+) T-cell lines caused by human immunodeficiency virus type 1 does not depend on caspases or apoptosis J. Virol. 76,5094-5107[Abstract/Free Full Text]
    2. 2
  2. Lenardo, M. J., Angleman, S. B., Bounkeua, V., Dimas, J., Duvall, M. G., Graubard, M. B., Hornung, F., Selkirk, M. C., Speirs, C. K., Trageser, C., Orenstein, J. O., Bolton, D. L. (2002) Cytopathic killing of peripheral blood CD4(+) T lymphocytes by human immunodeficiency virus type 1 appears necrotic rather than apoptotic and does not require env J. Virol. 76,5082-5093[Abstract/Free Full Text]
    3. 3
  3. LaBonte, J. A., Patel, T., Hofmann, W., Sodroski, J. (2000) Importance of membrane fusion mediated by human immunodeficiency virus envelope glycoproteins for lysis of primary CD4-positive T cells J. Virol. 74,10690-10698[Abstract/Free Full Text]
    4. 4
  4. Rapaport, E., Casella, C. R., Ikl,, Mustafa, F., Isaak, D., Finkel, T. H. (1998) Mapping of HIV-1 determinants of apoptosis in infected T cells Virology 252,407-417[CrossRef][Medline]
    5. 5
  5. Finkel, T. H., Tudor-Williams, G., Banda, N. K., Cotton, M. F., Curiel, T., Monks, C., Baba, T. W., Ruprecht, R. M., Kupfer, A. (1995) Apoptosis occurs predominantly in bystander cells and not in productively infected cells of HIV- and SIV-infected lymph nodes Nat. Med. 1,129-134[CrossRef][Medline]
    6. 6
  6. Grossman, Z., Meier-Schellersheim, M., Sousa, A. E., Victorino, R. M., Paul, W. E. (2002) CD4+ T-cell depletion in HIV infection: are we closer to understanding the cause? Nat. Med. 8,319-323[CrossRef][Medline]
    7. 7
  7. McCune, J. M. (2001) The dynamics of CD4+ T-cell depletion in HIV disease Nature 410,974-979[CrossRef][Medline]
    8. 8
  8. Badley, A. D., Pilon, A. A., Landay, A., Lynch, D. H. (2000) Mechanisms of HIV-associated lymphocyte apoptosis Blood 96,2951-2964[Abstract/Free Full Text]
    9. 9
  9. Ferri, K. F., Jacotot, E., Blanco, J., Este, J. A., Zamzami, N., Susin, S. A., Xie, Z., Brothers, G., Reed, J. C., Penninger, J. M., Kroemer, G. (2000) Apoptosis control in syncytia induced by the HIV type 1-envelope glycoprotein complex: role of mitochondria and caspases J. Exp. Med. 192,1081-1092[Abstract/Free Full Text]
    10. 10
  10. Vlahakis, S. R., Algeciras-Schimnich, A., Bou, G., Heppelmann, C. J., Villasis-Keever, A., Collman, R. C., Paya, C. V. (2001) Chemokine-receptor activation by env determines the mechanism of death in HIV-infected and uninfected T lymphocytes J. Clin. Invest. 107,207-215[Medline]
    11. 11
  11. Ferri, K. F., Jacotot, E., Blanco, J., Este, J. A., Kroemer, G. (2000) Mitochondrial control of cell death induced by HIV-1-encoded proteins Ann. N. Y. Acad. Sci. 926,149-164[Medline]
    12. 12
  12. Blanco, J., Jacotot, E., Cabrera, C., Cardona, A., Clotet, B., De Clercq, E., Este, J. A. (1999) The implication of the chemokine receptor CXCR4 in HIV-1 envelope protein-induced apoptosis is independent of the G protein-mediated signalling AIDS 13,909-917[CrossRef][Medline]
    13. 13
  13. Blanco, J., Barretina, J., Henson, G., Bridger, G., De Clercq, E., Clotet, B., Este, J. A. (2000) The CXCR4 antagonist AMD3100 efficiently inhibits cell-surface-expressed human immunodeficiency virus type 1 envelope-induced apoptosis Antimicrob. Agents Chemother. 44,51-56[Abstract/Free Full Text]
    14. 14
  14. Roggero, R., Robert-Hebmann, V., Harrington, S., Roland, J., Vergne, L., Jaleco, S., Devaux, C., Biard-Piechaczyk, M. (2001) Binding of human immunodeficiency virus type 1 gp120 to CXCR4 induces mitochondrial transmembrane depolarization and cytochrome c-mediated apoptosis independently of Fas signaling J. Virol. 75,7637-7650[Abstract/Free Full Text]
    15. 15
  15. Berger, E. A., Murphy, P. M., Farber, J. M. (1999) Chemokine receptors as HIV-1 coreceptors: roles in viral entry, tropism, and disease Annu. Rev. Immunol. 17,657-700[CrossRef][Medline]
    16. 16
  16. Glushakova, S., Grivel, J. C., Fitzgerald, W., Sylwester, A., Zimmerberg, J., Margolis, L. B. (1998) Evidence for the HIV-1 phenotype switch as a causal factor in acquired immunodeficiency Nat. Med. 4,346-349[CrossRef][Medline]
    17. 17
  17. Grivel, J. C., Margolis, L. B. (1999) CCR5- and CXCR4-tropic HIV-1 are equally cytopathic for their T-cell targets in human lymphoid tissue Nat. Med. 5,344-346[CrossRef][Medline]
    18. 18
  18. Blanco, J., Barretina, J., Cabrera, C., Gutierrez, A., Clotet, B., Este, J. A. (2001) CD4(+) and CD8(+) T cell death during human immunodeficiency virus infection in vitro Virology 285,356-365[CrossRef][Medline]
    19. 19
  19. Hazenberg, M. D., Otto, S. A., Hamann, D., Roos, M. T., Schuitemaker, H., De Boer, R. J., Miedema, F. (2003) Depletion of naive CD4 T cells by CXCR4-using HIV-1 variants occurs mainly through increased T-cell death and activation AIDS 17,1419-1424[CrossRef][Medline]
    20. 20
  20. Saag, M. S., Hammer, S. M., Lange, J. M. (1994) Pathogenicity and diversity of HIV and implications for clinical management: a review J. Acquir. Immune Defic. Syndr. 7(Suppl. 2),S2-S10
    21. 21
  21. Arthos, J., Cicala, C., Selig, S. M., White, A. A., Ravindranath, H. M., Van Ryk, D., Steenbeke, T. D., Machado, E., Khazanie, P., Hanback, M. S., Hanback, D. B., Rabin, R. L., Fauci, A. S. (2002) The role of the CD4 receptor versus HIV coreceptors in envelope-mediated apoptosis in peripheral blood mononuclear cells Virology 292,98-106[CrossRef][Medline]
    22. 22
  22. Moutouh, L., Estaquier, J., Richman, D. D., Corbeil, J. (1998) Molecular and cellular analysis of human immunodeficiency virus-induced apoptosis in lymphoblastoid T-cell-line-expressing wild-type and mutated CD4 receptors J. Virol. 72,8061-8072[Abstract/Free Full Text]
    23. 23
  23. Berndt, C., Mopps, B., Angermuller, S., Gierschik, P., Krammer, P. H. (1998) CXCR4 and CD4 mediate a rapid CD95-independent cell death in CD4(+) T cells Proc. Natl. Acad. Sci. USA 95,12556-12561[Abstract/Free Full Text]
    24. 24
  24. Ohnimus, H., Heinkelein, M., Jassoy, C. (1997) Apoptotic cell death upon contact of CD4+ T lymphocytes with HIV glycoprotein-expressing cells is mediated by caspases but bypasses CD95 (Fas/Apo-1) and TNF receptor 1 J. Immunol. 159,5246-5252[Abstract]
    25. 25
  25. Algeciras-Schimnich, A., Vlahakis, S. R., Villasis-Keever, A., Gomez, T., Heppelmann, C. J., Bou, G., Paya, C. V. (2002) CCR5 mediates Fas- and caspase-8-dependent apoptosis of both uninfected and HIV infected primary human CD4 T cells AIDS 16,1467-1478[CrossRef][Medline]
    26. 26
  26. LaBonte, J. A., Madani, N., Sodroski, J. (2003) Cytolysis by CCR5-using human immunodeficiency virus type 1 envelope glycoproteins is dependent on membrane fusion and can be inhibited by high levels of CD4 expression J. Virol. 77,6645-6659[Abstract/Free Full Text]
    27. 27
  27. Blanco, J., Barretina, J., Ferri, K. F., Jacotot, E., Gutierrez, A., Armand-Ugon, M., Cabrera, C., Kroemer, G., Clotet, B., Este, J. A. (2003) Cell-surface-expressed HIV-1 envelope induces the death of CD4 T cells during GP41-mediated hemifusion-like events Virology 305,318-329[CrossRef][Medline]
    28. 28
  28. Barretina, J., Blanco, J., Armand-Ugón, M., Gutiérrez, A., Clotet, B., Este, J. A. (2003) Anti-HIV-1 activity of enfuvirtide (T-20) by inhibition of bystander cell death Antivir. Ther. 8,155-161[Medline]
    29. 29
  29. Armand-Ugon, M., Quinones-Mateu, M. E., Gutierez, A., Barretina, J., Blanco, J., Schols, D., De Clercq, E., Clotet, B., Este, J. A. (2003) Reduced fitness of HIV-1 resistant to CXCR4 antagonists Antivir. Ther. 8,1-8[Medline]
    30. 30
  30. Este, J. A., Cabrera, C., Blanco, J., Gutierrez, A., Bridger, G., Henson, G., Clotet, B., Schols, D., De Clercq, E. (1999) Shift of clinical human immunodeficiency virus type 1 isolates from X4 to R5 and prevention of emergence of the syncytium-inducing phenotype by blockade of CXCR4 J. Virol. 73,5577-5585[Abstract/Free Full Text]
    31. 31
  31. De Jong, J. J., De Ronde, A., Keulen, W., Tersmette, M., Goudsmit, J. (1992) Minimal requirements for the human immunodeficiency virus type 1 V3 domain to support the syncytium-inducing phenotype: analysis by single amino acid substitution J. Virol. 66,6777-6780[Abstract/Free Full Text]
    32. 32
  32. De Jong, J. J., De Ronde, A., Keulen, W., Tersmette, M., Goudsmit, J. (1992) Minimal requirements for the human immunodeficiency virus type 1 V3 domain to support the syncytium-inducing phenotype: analysis by single amino acid substitution J. Virol. 66,6777-6780
    33. 33
  33. Baba, M., Nishimura, O., Kanzaki, N., Okamoto, M., Sawada, H., Iizawa, Y., Shiraishi, M., Aramaki, Y., Okonogi, K., Ogawa, Y., Meguro, K., Fujino, M. (1999) A small-molecule, nonpeptide CCR5 antagonist with highly potent and selective anti-HIV-1 activity Proc. Natl. Acad. Sci. USA 96,5698-5703[Abstract/Free Full Text]
    34. 34
  34. Trkola, A., Ketas, T. J., Nagashima, K. A., Zhao, L., Cilliers, T., Morris, L., Moore, J. P., Maddon, P. J., Olson, W. C. (2001) Potent, broad-spectrum inhibition of human immunodeficiency virus type 1 by the CCR5 monoclonal antibody PRO 140 J. Virol. 75,579-588[Abstract/Free Full Text]
    35. 35
  35. Jacobson, J. M., Lowy, I., Fletcher, C. V., O’Neill, T. J., Tran, D. N., Ketas, T. J., Trkola, A., Klotman, M. E., Maddon, P. J., Olson, W. C., Israel, R. J. (2000) Single-dose safety, pharmacology, and antiviral activity of the human immunodeficiency virus (HIV) type 1 entry inhibitor PRO 542 in HIV-infected adults J. Infect. Dis. 182,326-329[CrossRef][Medline]
    36. 36
  36. Healey, D., Dianda, L., Moore, J. P., McDougal, J. S., Moore, M. J., Estess, P., Buck, D., Kwong, P. D., Beverley, P. C., Sattentau, Q. J. (1990) Novel anti-CD4 monoclonal antibodies separate human immunodeficiency virus infection and fusion of CD4+ cells from virus binding J. Exp. Med. 172,1233-1242[Abstract/Free Full Text]
    37. 37
  37. Bleul, C. C., Wu, L., Hoxie, J. A., Springer, T. A., Mackay, C. R. (1997) The HIV coreceptors CXCR4 and CCR5 are differentially expressed and regulated on human T lymphocytes Proc. Natl. Acad. Sci. USA 94,1925-1930[Abstract/Free Full Text]
    38. 38
  38. Jekle, A., Keppler, O. T., De Clercq, E., Schols, D., Weinstein, M., Goldsmith, M. A. (2003) In vivo evolution of human immunodeficiency virus type 1 toward increased pathogenicity through CXCR4-mediated killing of uninfected CD4 T cells J. Virol. 77,5846-5854[Abstract/Free Full Text]
    39. 39
  39. Holm, G. H., Zhang, C., Gorry, P. R., Peden, K., Schols, D., De Clercq, E., Gabuzda, D. (2004) Apoptosis of bystander T cells induced by human immunodeficiency virus type 1 with increased envelope/receptor affinity and coreceptor binding site exposure J. Virol. 78,4541-4551[Abstract/Free Full Text]
    40. 40
  40. Sodroski, J., Goh, W. C., Rosen, C., Campbell, K., Haseltine, W. A. (1986) Role of the HTLV-III/LAV envelope in syncytium formation and cytopathicity Nature 322,470-474[CrossRef][Medline]
    41. 41
  41. Stocker, H., Scheller, C., Jassoy, C. (2000) Destruction of primary CD4(+) T cells by cell-cell interaction in human immunodeficiency virus type 1 infection in vitro J. Gen. Virol. 81,1907-1911[Abstract/Free Full Text]
    42. 42
  42. Krzysiek, R., Rudent, A., Bouchet-Delbos, L., Foussat, A., Boutillon, C., Portier, A., Ingrand, D., Sereni, D., Galanaud, P., Grangeot-Keros, L., Emilie, D. (2001) Preferential and persistent depletion of CCR5+ T-helper lymphocytes with nonlymphoid homing potential despite early treatment of primary HIV infection Blood 98,3169-3171[Abstract/Free Full Text]
    43. 43
  43. Ostrowski, M. A., Justement, S. J., Catanzaro, A., Hallahan, C. A., Ehler, L. A., Mizell, S. B., Kumar, P. N., Mican, J. A., Chun, T. W., Fauci, A. S. (1998) Expression of chemokine receptors CXCR4 and CCR5 in HIV-1-infected and uninfected individuals J. Immunol. 161,3195-3201[Abstract/Free Full Text]
    44. 44
  44. Kunkel, E. J., Boisvert, J., Murphy, K., Vierra, M. A., Genovese, M. C., Wardlaw, A. J., Greenberg, H. B., Hodge, M. R., Wu, L., Butcher, E. C., Campbell, J. J. (2002) Expression of the chemokine receptors CCR4, CCR5, and CXCR3 by human tissue-infiltrating lymphocytes Am. J. Pathol. 160,347-355[Abstract/Free Full Text]
    45. 45
  45. Campbell, J. J., Brightling, C. E., Symon, F. A., Qin, S., Murphy, K. E., Hodge, M., Andrew, D. P., Wu, L., Butcher, E. C., Wardlaw, A. J. (2001) Expression of chemokine receptors by lung T cells from normal and asthmatic subjects J. Immunol. 166,2842-2848[Abstract/Free Full Text]
    46. 46
  46. Jacobson, J. M., Israel, R. J., Lowy, I., Ostrow, N. A., Vassilatos, L. S., Barish, M., Tran, D. N., Sullivan, B. M., Ketas, T. J., O’Neill, T. J., Nagashima, K. A., Huang, W., Petropoulos, C. J., Moore, J. P., Maddon, P. J., Olson, W. C. (2004) Treatment of advanced human immunodeficiency virus type 1 disease with the viral entry inhibitor PRO 542 Antimicrob. Agents Chemother. 48,423-429[Abstract/Free Full Text]
    47. 47
  47. Leikina, E., Chernomordik, L. V. (2000) Reversible merger of membranes at the early stage of influenza hemagglutinin-mediated fusion Mol. Biol. Cell 11,2359-2371[Abstract/Free Full Text]
    48. 48
  48. Jolly, C., Kashefi, K., Hollinshead, M., Sattentau, Q. J. (2004) HIV-1 cell to cell transfer across an Env-induced, actin-dependent synapse J. Exp. Med. 199,283-293[Abstract/Free Full Text]
    49. 49
  49. Hay, S., Kannourakis, G. (2002) A time to kill: viral manipulation of the cell death program J. Gen. Virol. 83,1547-1564[Abstract/Free Full Text]
    50. 50
  50. Dimitrov, D. S., Willey, R. L., Sato, H., Chang, L. J., Blumenthal, R., Martin, M. A. (1993) Quantitation of human immunodeficiency virus type 1 infection kinetics J. Virol. 67,2182-2190[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Virol.Home page
N. Izquierdo-Useros, J. Blanco, I. Erkizia, M. T. Fernandez-Figueras, F. E. Borras, M. Naranjo-Gomez, M. Bofill, L. Ruiz, B. Clotet, and J. Martinez-Picado
Maturation of Blood-Derived Dendritic Cells Enhances Human Immunodeficiency Virus Type 1 Capture and Transmission
J. Virol., July 15, 2007; 81(14): 7559 - 7570.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
E. Pauls, J. Senserrich, B. Clotet, and J. A. Este
Inhibition of HIV-1 replication by RNA interference of p53 expression
J. Leukoc. Biol., September 1, 2006; 80(3): 659 - 667.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
H. Garg and R. Blumenthal
HIV gp41-induced apoptosis is mediated by caspase-3-dependent mitochondrial depolarization, which is inhibited by HIV protease inhibitor nelfinavir
J. Leukoc. Biol., February 1, 2006; 79(2): 351 - 362.
[Abstract] [Full Text] [PDF]

Home page
 Antimicrob. Agents Chemother.Home page
B. Bosch, J. Blanco, E. Pauls, I. Clotet-Codina, M. Armand-Ugon, B. Grigorov, D. Muriaux, B. Clotet, J.-L. Darlix, and J. A. Este
Inhibition of Coreceptor-Independent Cell-to-Cell Human Immunodeficiency Virus Type 1 Transmission by a CD4-Immunoglobulin G2 Fusion Protein
Antimicrob. Agents Chemother., October 1, 2005; 49(10): 4296 - 4304.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
Y. Raviv, M. Viard, J. W Bess Jr., E. Chertova, and R. Blumenthal
Inactivation of Retroviruses with Preservation of Structural Integrity by Targeting the Hydrophobic Domain of the Viral Envelope
J. Virol., October 1, 2005; 79(19): 12394 - 12400.
[Abstract] [Full Text] [PDF]

Home page
 Antimicrob. Agents Chemother.Home page
J. Blanco, I. Clotet-Codina, B. Bosch, M. Armand-Ugon, B. Clotet, and J. A. Este
Multiparametric Assay To Screen and Dissect the Mode of Action of Anti-Human Immunodeficiency Virus Envelope Drugs
Antimicrob. Agents Chemother., September 1, 2005; 49(9): 3926 - 3929.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Blanco, B. Bosch, M. T. Fernandez-Figueras, J. Barretina, B. Clotet, and J. A. Este
High Level of Coreceptor-independent HIV Transfer Induced by Contacts between Primary CD4 T Cells
J. Biol. Chem., December 3, 2004; 279(49): 51305 - 51314.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0204100v1
76/4/804    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blanco, J.
Right arrow Articles by Esté, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blanco, J.
Right arrow Articles by Esté, J. A.