Accuri C6 Flow Cytometer System
Originally published online as doi:10.1189/jlb.1003481 on April 9, 2004

Published online before print April 9, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.1003481v1
76/1/77    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruffini, P. A.
Right arrow Articles by Kwak, L. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruffini, P. A.
Right arrow Articles by Kwak, L. W.
(Journal of Leukocyte Biology. 2004;76:77-85.)
© 2004 by Society for Leukocyte Biology

Genetic fusions with viral chemokines target delivery of nonimmunogenic antigen to trigger antitumor immunity independent of chemotaxis

Pier Adelchi Ruffini*, Arya Biragyn{dagger},1, Marta Coscia{ddagger},§, Linda K. Harvey{ddagger}, Soung-Chul Cha{ddagger}, Bjarne Bogen and Larry W. Kwak||

{dagger} Laboratory of Immunology, National Institute on Aging, Baltimore, Maryland;
|| Experimental Transplantation and Immunology Branch, National Cancer Institute, Frederick, Maryland;
{ddagger} Intramural Research Support Program, Science Applications International Corporation-Frederick, Maryland;
Institute of Immunology, University of Oslo, National Hospital, Norway;
* Divisione di Oncologia Medica Falck, Ospedale Niguarda Ca’ Granda, Milan, Italy (on leave of absence); and
§ Divisione di Ematologia dell’Universita’ di Torino, Laboratorio di Ematologia Oncologica, CeRMS, Azienda Ospedaliera San Giovanni Battista, Torino, Italy (on leave of absence)

1Correspondence: Laboratory of Immunology, National Institute on Aging, Baltimore, MD 21224. E-mail: biragyna{at}grc.nia.nih.gov


arrow
ABSTRACT
 
The ideal vaccine carrier should be able to target antigen delivery and possibly recruit antigen-presenting cells (APC) and deliver an activation signal to promote adaptive immune responses. Ligands for chemokine receptors expressed on APC may be attractive candidates, as they can both target and attract APC. To investigate the requirement for APC recruitment, we used a pair of viral chemokines, agonist herpes simplex virus 8-derived macrophage inflammatory protein–I (vMIP-I) and antagonist MC148, which induce and suppress chemotaxis, respectively. Chemokine-antigen fusions efficiently delivered a model nonimmunogenic tumor antigen to APC for processing and presentation to antigen-specific T cells in vitro. Physical linkage of chemokine and antigen and specific binding of chemokine receptor by the fusion protein were required. Mice immunized with vMIP-I or MC148 fusion DNA vaccines elicited protection against tumor challenge. Therefore, vaccine efficacy depends primarily on the ability of the carrier to target antigen delivery to APC for subsequent processing and presentation, and chemotaxis directly induced by the chemokine moiety in the fusion may not be necessary.

Key Words: MC148 • vMIP-I • viral chemokine antagonist • APC targeting • vaccine carrier • lymphoma


arrow
INTRODUCTION
 
The effectiveness of vaccines against infectious pathogens and tumors depends in large part on the efficiency with which relevant antigens are delivered to antigen-presenting cells (APC), particularly dendritic cells (DC), for processing into immunogenic peptides and presentation to T cells. To this end, immunity can be elicited by targeting antigens to APC via ligands for cell-surface receptors, such as mannose receptor [1 ], FcR [2 ], and DEC205 [3 ], which enable internalization and processing of the antigen. However, the optimal vaccine strategy might not only target antigen delivery but also recruit immune cells to the vaccine site and induce maturation of DC. Targeting receptors which regulate chemotaxis may have the potential to fulfill all three requirements.

For example, the trafficking of professional APC, including DC, is regulated by chemokines, a group of small, secreted proteins that act via heterotrimeric, G-protein-coupled, seven-transmembrane domain chemokine receptors [4 ], differentially expressed on immature and mature DC [5 6 7 ], respectively, as well as on cells of the monocyte-macrophage lineage [8 ]. Previously, we have reported that targeting chemokine receptors on professional APC, particularly immature DC (iDC) with genetic fusions of inflammatory chemokines and weakly immunogenic tumor or human immunodeficiency virus (HIV) antigens, efficiently elicited protective immunity [9 10 11 ]. In vivo administration of fusion proteins was followed by a substantial infiltration of poly- and mononuclear cells at the site of injection [9 ]. However, the relative requirements for receptor targeting and induction of chemotaxis have not been clarified.

In addition to host chemokines, several virus-encoded chemokines have been identified, which bind to the same receptors, sometimes with antagonistic activities. In fact, some viruses use chemokine receptors to affect immune responses, suppressing infiltration and inflammation or preferentially attracting specific subsets of immune cells [12 ]. For example, a highly selective viral ligand of chemokine receptor (CCR)8, a receptor expressed on monocyte/macrophages [13 14 15 16 17 ], the molluscum contagiosum virus (MCV) chemokine MC148, acts as a receptor antagonist and fails to induce chemotaxis [18 19 20 ]. We took advantage of the receptor antagonistic activity of MC148 and compared it with a highly selective CCR8 agonist, the herpes simplex virus 8-derived chemokine macrophage inflammatory protein–I (vMIP-I) [18 , 21 ], to elucidate whether induction of immune cell recruitment is necessary for chemokine fusion-elicited immunity. Specifically, we compared two DNA vaccine constructs encoding a model nonimmunogenic tumor antigen, fused with vMIP-I or MC148, for their ability to protect against lethal tumor challenge. Our data suggest that it is sufficient to target this antigen to APC to elicit specific immunity in vivo. Moreover, we demonstrate directly that this chemokine receptor antagonist is capable of delivering antigen to DC for processing and presentation to antigen-specific T cells in vitro.


arrow
MATERIALS AND METHODS
 
Fusion gene cloning and plasmid constructions
Cloning strategy was described previously [9 ]. In brief, cloning and arrangement of lymphoma-specific immunoglobulin (Ig) variable region fragments from 38C-13 [22 ] cells as sFv38, a single polypeptide consisting solely of VH and VL domains linked by a short amino acid sequence, were described previously [9 ]. The same strategy was applied to clone VH and VL fragments from MOPC-315 plasmacytoma [American Type Culture Collection (ATCC), Manassas, VA] and arrange them as sFv315 using the following primers: for VH chain, PRMOPC315VH-1, AAACATATGCTCGAGGACGTGCAGCTGCAGGAGTCT, and PRMOPC315VH-R1, TGTCGACGCCGCCGCCAGAACCACCACCACCTGAGGAGACTGTGAGAGT; for VL chain, PRMOPC315VL-2, AAACTCGAGGGTGGCGGTGGGAGCCAGGCTGTTGTGACTCAGGAA, and PRMOPC315VL-R2, ATAAGATCTTCCCGGGCCTAGGACAGTGACCTTGGT. DNA fragment corresponding to vMIP-I (GenBank #U74585) was cloned by reverse transcriptase-polymerase chain reaction (RT-PCR) from total RNA extracted from a human herpesvirus-8-infected cell line [body cavity-based lymphoma (BCBL)-1], and MC148 (GenBank #U60315) was recloned from the plasmid, kindly provided by Bernard Moss [National Institutes of Health (NIH), Bethesda, MD]. The following pairs of primers were used for vMIP-I, PRvMIP1L-1, TAAGCTTCCACCATGGCCCCCGTCCACGTTTTATGCT, and PRvMIP1-R1, TGAATTCAGCTATGGCAGGCAGCCGCTGCATCAGCTGCCT; for MC148, PRMC148-L1, AAAGCTAGCACCATGAGGGGCGGAGACGTCTTC, and PRMC148-R1, AAAGAATTCCAGAGACTCGCACCCGGACCATAT. For bacterial expression, vMIP-I and MC148 were cloned without signal sequences using the following pairs of primers: PRvMIP1M-2, ACCATGGCGGGGTCACTCGTGTCGTACA, and PRvMIPI-R1; PRMC148M-2, AACATATGCTCGCGAGACGGAAATGTTGTTTGAAT, and PRMC148-R1, respectively. Point-mutated vMIP-I and MC148 genes were generated by PCR, replacing the first Cys with a Ser to abrogate receptor binding [23 ]. All constructs were verified by the DNA dideoxy-sequencing method (Amersham, Arlington Heights, IL) and purified using a plasmid purification kit (Qiagen, Valencia, CA).

Recombinant fusion proteins production
Recombinant fusion proteins were purified as inclusion bodies after overnight induction in SuperBroth (Digene Diagnostics, Beltsville, MD) with 0.8 mM isopropyl ß-D-thiogalactoside as described previously [9 ] and refolded according to Buchner et al. [24 ]. In brief, the refolded fusion proteins were purified by heparin-Sepharose chromatography (Pharmacia Biotech, Uppsala, Sweden). For vMIP-IsFv38 protein, optimal purity was achieved after loading fusions purified from inclusion bodies onto a column with a monoclonal antibody (mAb) specific for 38C-13 Id, SIC-5, coupled with cyanogen bromide-activated Sepharose 4b (Pharmacia Biotech). The integrity and purity (>90%) of recombinant proteins were tested by sodium dodecyl sulfate-polyacrylamide gel electrophoresis under reducing conditions and Western blot hybridization with 9E10 anti c-myc mAb (Sigma Chemical Co., St. Louis, MO). Correct folding of purified sFv38 proteins was determined by the ability to inhibit binding of anti-idiotypic (Id) sera from mice immunized with Ig38–keyhole limpet hemocyanin (KLH) to native 38C-13 Ig protein in enzyme-linked immunosorbent assay (ELISA) inhibition assays, as described previously [9 ]. Briefly, serial dilutions of fusion proteins were incubated with polyclonal sera from immunized mice and then transferred into plates previously coated with 38C-13 Ig. 38c-13Ig and chemokine fusions with an irrelevant sFv were used as positive and negative control, respectively. After addition of anti-mouse Ig (Fc{gamma}) horseradish peroxidase (HRP)-conjugated mAb (Jackson ImmunoResearch Laboratory, Bar Harbor, ME) and development with 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid disodium salt; ABTS) peroxidase substrate (Kirkegaard and Perry Laboratories, Gaithersburg, MD), absorbance at 405 nm was measured. For endotoxin removal, endotoxin removal gel (Acticlean Etox, Sterogene Bioseparations Inc., Carlsbad, CA) was used according to the manufacturer’s instructions for three consecutive rounds. The endotoxin content of fusion proteins was assessed by limulus amebocyte lysate assay using a commercially available kit (BioWhittaker Inc., Walkersville, MD), according to the manufacturer’s recommendations. Fusion proteins were comparable for purity and endotoxin content (≤0.1 EU/µg protein).

Cell lines
The carcinogen-induced C3H 38C-13 B cell lymphoma [22 ] was a gift from Dr. Ronald Levy (Stanford University, CA). Human CCR8-expressing human embryo kidney 293 cells (hCCR8/HEK 293) were a gift from Dr. Zack Howard [Science Applications International Corporation (SAIC)-Frederick, MD]. Murine CCR8-expressing HEK 293 cells (mCCR8/HEK 293) were a gift from Dr. Gabriel Marquez (Universidad Autonoma de Madrid, Madrid, Spain). Dr. Akira Takashima (University of Texas Southwestern Medical Center, Dallas, TX) kindly provided the murine epidermis-derived DC lines XS52 [26 ] and XS106 [25 ], displaying an immature and a more mature phenotype, respectively.

In vitro chemotaxis assay
Cell migration in vitro was assessed by a 48-well microchemotaxis chamber (NeuroProbe, Gaithersburg, MD) technique as described previously [27 ]. For parental or stably transfected HEK 293 cells, a 10-µm polycarbonate filter (Osmonics, Livermore, CA), pretreated for 2 h at 37°C with 50 µg/mL rat-tail collagen type I (Collaborative Biomedical Products, Bedford, MA), was used. For BW5147 cells, splenocytes, and DC, a 5-µm polycarbonate filter, pretreated overnight at 4°C with 10 µg/mL fibronectin (Sigma Chemical Co.) or untreated, was used, respectively. Cells were incubated at 37°C in humidified air with 5% CO2 for 5 h (HEK 293), 3 h (BW5147 and splenocytes), and 1.5 h (DC). Cells migrating across the filter were counted using a Bioquant semiautomatic counting system (Bioquant, Nashville, TN). The results (mean±SD of triplicate samples) are presented as migrated cells per field. Recombinant vMIP-I, I-309/chemokine ligand (CCL)1, and MC148 were obtained from R&D Systems (Minneapolis, MN).

Murine DC isolation and culture
Isolation and culture of murine bone marrow (BM)-derived iDC were described previously [10 ]. Briefly, BM was collected from tibias and femurs of 4- to 6-month-old BALB/c mice. Erythrocytes were lysed with acetate kinase lysis buffer (BioWhittaker). CD8+, CD4+, B220+, and I-Ad+ cells were depleted using a mixture of mAb and rabbit complement. The mAb were TIB-146 (anti-B220), TIB-150 (anti-CD8), TIB-207 (anti-CD4), and TIB-229 (anti-I-Ab,d), obtained from ATCC. Low-toxicity rabbit complement was purchased from Cedarlane Laboratories Ltd. (Hornby, Ontario, Canada). Cells were cultured in DC medium (RPMI 1640 containing 5% heat-inactivated fetal bovine serum, 1% penicillin/streptomycin, 1% L-glutamine, and 5 x 105 2-mercaptoethanol), supplemented with 10 ng/mL each murine interleukin-4 and granulocyte macrophage-colony stimulating factor (PeproTech, Rocky Hill, NJ). Nonadherent and weakly adherent cells were harvested by pipetting on day 4 and were used in receptor-binding and chemotaxis assays. On day 4 of culture, the CD11c+ cells contained B7.2-ve/IAd–ve (30–40%), B7.2-ve/I-Ad + ve (30–40%), and B7.2 + ve/IAd + ve cells (20–30%) consistently. CD11c+ cells were positively selected using anti-mouse CD11c-coated magnetic cell sorter colloidal super-paramagnetic microbeads (Miltenyi Biotech, Auburn, CA), according to the manufacturer’s instructions.

Chemokine receptor-binding assays
Cells were washed with phosphate-buffered saline (PBS), containing 2% bovine serum albumin and 0.1% NaN3 (PBSst), and were blocked with human AB serum (30 µL/well). The whole assay was performed on ice to prevent receptor internalization. Cells were first incubated with fusion proteins at concentrations ranging from 50 to 5 µg/mL for 30 min, washed twice with PBSst, and incubated with anti c-myc mAb or isotype-matched, purified mouse IgG1 for 20 min. After two washings with PBSst, cells were incubated with anti-mouse IgG (Fc) fluorescein isothiocyanate (FITC)-conjugated mAb (Jackson ImmunoResearch Laboratory) for 20 min, washed, and fixed with 1% paraformaldehyde. Receptor binding was assessed by flow cytometry on a FACSCalibur (Becton Dickinson, Franklin Lakes, NJ) using CellQuest software.

MOPC-315 Id-specific T cell clone stimulation
The BALB/c mouse CD4+ T cell clone 7A10B2 specifically recognizes an Id peptide from the light chain of the murine plasmacytoma MOPC-315 Ig (amino acids 91–101), presented by the major histocompatibility complex (MHC) class II molecule I-Ed [28 ]. For Id-specific T cell clone stimulation experiments, BALB/c, BM-derived iDC, generated as described above, on day 4 of culture were incubated with endotoxin-free fusion proteins overnight, then washed three times with cold PBS, irradiated (2000 R), and placed in culture with 7A10B2 T cells in 96-well, round-bottom plates at a 1:1 ratio (2x104 cells each) for 48 h. Irradiated DC were pulsed with 91–101-specific peptide at 0.2 µg/ml or an irrelevant peptide at 10 µg/ml as positive and negative control, respectively. At the end of the culture period, interferon-{gamma} (IFN-{gamma}) production was assessed by ELISA in culture supernatants.

Assessment of CCR8 expression by mouse DC
Total RNA was extracted by conventional methods from CD11c-selected mouse, BM-derived DC. cDNA was synthesized using the Superscript preamplification system (Invitrogen, Carlsbad, CA), according to the manufacturer’s recommendations. PCR reactions were done using the following primers for CCR8: PRmCCR8-L1, ATGACCGACTACTACCCTGATTTCT, and PR mCCR8-R1, ACGCTGGCCGTCCTCACCTTGATGG. Amplification from HEK 293 and BW5147 cell lines served as negative and positive control, respectively. PCR amplification was performed with 30 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 30 s, followed by a final 5-min extension at 72°C. Products were cloned into the pCR2.1 vector (Invitrogen) and sequenced. For cell-surface detection of mCCR8, after blocking with 30 µg/tube purified mouse IgG (Sigma Chemical Co.), murine cells were incubated for 30 min on ice with 8F4 [29 ], a rat mAb specifically recognizing mCCR8, kindly provided by Dr. Gabriel Marquez (Universidad Autonoma de Madrid, Madrid, Spain), or purified rat IgG (Jackson ImmunoResearch Laboratory) at a final concentration of 10 µg/ml. After washing, cells were incubated with mouse anti-rat IgG (Fc) FITC-conjugated mAb (Jackson ImmunoResearch Laboratory) for 20 min on ice, washed, and then fixed with 1% paraformaldehyde. Parental HEK 293 and BW5147 and 293/mCCR8/HEK293 served as negative and positive controls, respectively. Samples were analyzed on a FACSCalibur (Becton Dickinson) using CellQuest software.

In vivo immunizations and assessment of humoral responses and anti-tumor protection
Animal care was provided in accordance with the procedures outlined in a guide for the Care and Use of Laboratory Animals (NIH Publication 86-23, 1985). Six- to 12-week-old female C3H/HeN-CrlBR mice (Charles River Laboratories, Frederick, MD) were used. Ten mice per group were immunized with the Helios gene gun system (Bio-Rad, Hercules, CA) with 1–2 µg plasmid DNA three times at biweekly intervals, as described previously [10 ]. Serum anti-Id antibody levels were determined by ELISA 2 weeks after the last immunization. Microtiter plates coated with 10 µg/ml Ig38 were incubated with serially diluted immune sera. Bound antibodies were detected with goat anti-mouse IgG (Fc) HRP mAb (Jackson ImmunoResearch Laboratory). The reaction was developed with ABTS peroxidase substrate (KPL, Gaithersburg, MD), and absorbance at 405 nm was measured. Specificity for Id was shown by the absence of binding on a control, isotype-matched IgM (TEPC-183, Sigma Chemical Co.; data not shown). Two weeks after the last immunization, mice were challenged intraperitoneally (i.p.) with a ten- to 20-fold lethal (1x103–2x103) dose of 38C-13 lymphoma cells and were followed for survival. Differences in survival between groups were determined by nonparametric log-rank test (BMDP Statistical Software, Los Angeles, CA). The P values refer to comparisons with the group immunized with DNA expressing sFv fused with point-mutated chemokine.


arrow
RESULTS
 
Functional characterization of viral chemokine–sFv fusion proteins
Variable region sequences on the Ig receptor expressed by clonal B cell malignancies can serve as potential tumor-specific antigens [30 ]. However, a major obstacle is that syngeneic lymphoma Ig protein or its single chain Ig (sFv), consisting solely of linked VH and VL domains, which retain the conformation of the native Ig [31 ], is nonimmunogenic. Cloning of Ig variable region fragments from two different tumors, 38C-13 and MOPC-315, and construction of their respective sFv tumor antigens, single polypeptides consisting of tumor-specific VH and VL fragments linked with a conserved 15 amino acid peptide linker (sFv38 and sFv315, respectively), were performed as described previously [9 ]. Then, MC148 and vMIP-I genes were cloned by RT-PCR and fused in-frame with sFv or VL alone (Fig. 1 ). sFv38 and VL315 fusion constructs with viral chemokine vMIP-I and MC148 were designated MC148sFv38, vMIP-IsFv38, or MC148VL315 as recombinant proteins purified from bacterial inclusion bodies (Fig. 1) . Similarly, control proteins encoding sFv38 or VL315 fusion with point-mutated (Cys/Ser) MC148 or vMIP-I to disrupt chemokine receptor binding were designated MC148MsFv38, vMIP-IMsFv38, and MC148MVL315 (Fig. 1) .



View larger version (43K):
[in this window]
[in a new window]
 
Figure 1. Viral chemokine fusion with tumor-derived Id constructs. Genes encoding vMIP-I or MC148 or their point-mutated controls, generated by replacing the first Cys residue with Ser (solid inset), were fused in-frame with DNA encoding sFv from 38C-13 (top panel) or VL from MOPC-315 (bottom panel) mouse B cell tumors. Chemokine signal sequences were deleted in bacterial expression plasmids, while naked DNA vaccine constructs contained intact signal sequences of viral chemokines (SL) to enable their secretion in vivo. Proteins were expressed in pET11 vectors, and DNA vaccines were cloned into pcDNA3.1 or modified p cytomegalovirus encephalitis vectors (pCHVE) containing the signal sequence from IFN-inducible protein 10 (SL10). Note: Expression and immune responses were not affected by use of SL or SL10 [9 , 10 ].

38C-13 tumor-derived fusion proteins retained proper Id folding, as detected by the ability to inhibit binding of anti-Id sera to native Ig protein [9 ] (data not shown). The functional integrity of fused chemokine was also retained, as MC148 (Fig. 2a ) and vMIP-I fusion proteins (not shown) were able to bind hCCR8-transfected (hCCR8/HEK 293) but not parental HEK 293 cells (data not shown). In contrast, no binding was detected when point-mutated chemokine-containing fusion protein was used (MC148MsFv38, Fig. 2a ). As expected, vMIP-I- but not antagonist MC148-containing fusion proteins chemoattracted hCCR8/HEK 293 cells (Fig. 2b) and mouse thymic lymphoma cell line BW5147 (Fig. 2c) , which also expresses large amounts of CCR8 [32 , 33 ]. The proteins did not elicit chemotaxis of CCR8-negative parental HEK 293 cells (not shown). Similarly, fusion proteins with point-mutated vMIP-I (vMIP1MsFV38, Fig. 2b and 2c ) failed to induce chemotaxis of any cells tested, including murine splenocytes (not shown). These data are in concordance with our previous observations that chemokine–sFv fusion proteins were properly folded and retained functional activity of other chemokine moieties [9 ].



View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Integrity of fused viral chemokine moieties. (a) MC148sFv38 fusion protein (bold line), but not its point-mutated control MC148MsFv38 (thin line), binds to hCCR8/HEK 293 cells, as detected by anti-c-myc staining (dotted line=isotype control). Histogram of gated cells (R1 in forward-scatter/side-scatter plot) is shown. Data presented are representative of 10 independent experiments. (b and c) vMIP-IsFv38, but not its point-mutated control vMIP-IMsFv38 or antagonist MC148 fusions, chemoattracts hCCR8/HEK 293 (b) and mCCR8-expressing BW5147 cells (c). Recombinant I-309/CCL1 (100 ng/ml) and medium alone (CM) were used as positive and negative controls, respectively. vMIP-IsFv38 (1 µg/ml) equals ~25 nM protein. The results are shown as migrated cells per field ± SD (triplicate wells). Similar results were obtained from three separate experiments for each cell line.

Expression of CCR8 on murine BM-derived DC and on an epidermis-derived DC line
We have hypothesized that chemokine–sFv vaccines act by targeting sFv antigen delivery to chemokine receptors expressed by APC, particularly iDC [9 , 10 ]. Although others suggested expression of CCR8 on murine APC [13 14 15 ], we wanted to establish that CCR8 is a valid target on murine APC, particularly DC. First, we tested for mCCR8 mRNA expression in purified mouse CD11c+ BM-derived iDC (Fig. 3a , purity ~90%) using RT-PCR. As shown in Figure 3a , CCR8 transcripts, verified by DNA sequencing (not shown), were clearly detected in cDNA samples from CD11c+ iDC and control BW5147 cells. Then, although CCR8 surface expression was not clearly detected on iDC by use of specific 8F4 mAb, the 8F4 mAb specifically reacted, albeit weakly, with murine epidermis-derived iDC line XS52 [26 ] (Fig. 3b) . 8F4 staining was clearly negative on another epidermis-derived DC line XS-106, which had more mature phenotype [25 ], control RAW264.7, a CCR8-negative macrophage cell line [32 ], and murine B cell lymphoma cell lines 38C13, A20, and LIG18 (not shown). Finally, purified MC148 fusion proteins (MC148sFv38, Fig. 3c and 3e , and MC148VL315, Fig. 3d and 3f ) were able to bind specifically to murine BM-derived iDC (Fig. 3c and 3d) and XS52 cells (Fig. 3e and 3f) . In contrast, control sFv315 protein alone (not shown) or fusion proteins with point-mutated MC148 could not bind either of these cells (MC148MsFv38, Fig. 3c and 3e , and MC148MVL315, Fig. 3d and 3f ). Therefore, these data suggest that murine APC, particularly iDC, express CCR8 and that MC148 fusion proteins specifically bind these cells. Next, we tested whether binding to chemokine receptor was sufficient for antigen uptake and processing.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 3. CCR8 is expressed by murine BM-derived DC and epidermis-derived DC line XS-52; MC148 fusion proteins bind to the same cells. (a) mCCR8 was amplified by RT-PCR from cDNA prepared from ~90% pure, CD11c-selected, BM-derived DC (left panel). CCR8 transcript (411-bp band) was detected in BW5147 cells (positive control) and DC. Amplification of CCR8 from DC total RNA was included as a negative procedural control. (b) XS-52 cell line was stained with 10 µg/ml purified rat IgG (thin line) or 8F4, a rat IgG2b mAb specifically recognizing mCCR8 (bold line). Bound antibodies were detected with FITC-conjugated mouse anti-rat IgG (Fc). (c–f) MC148sFv38 (c and e) and MC148VL315 (d and f) fusion proteins (left histograms), but not their corresponding, point-mutated controls MC148MsFv38 and MC148MVL315 (right histograms), bind to BM-derived iDC (c and d) and XS52 cells (e and f), as detected by anti-c-myc staining (thin line=isotype control). Histogram of gated cells (R1 in forward-scatter/side-scatter plot) is shown. Results shown are representative of three and six independent experiments for cell type, respectively.

Ability of MC148 fusion proteins to target delivery of antigen to APC in vitro
The chemokine receptor-mediated antigen (sFv) uptake and subsequent processing and presentation were tested by the ability of BM-derived DC pulsed with chemokine fusion proteins to stimulate T cell responses. T cell immunity to 38C-13 tumor is less well defined; therefore, we selected the MOPC-315 model for these experiments, as it is a well defined model of T cell-dependent immunity against Fv-derived Id peptide presented by MHC class II molecules on APC. Specifically, I-Ed-restricted CD4+ T cell clones, recognizing residues 91–101 from the variable region of the mouse Ig light-chain expressed by the MOPC-315 plasmacytoma ({lambda}2315) [28 ], were isolated from syngeneic mice, which had been immunized with MOPC-315 light-chain protein in complete Freund’s adjuvant [34 ].

BM-derived iDC were incubated overnight with recombinant proteins containing the relevant VL, sFv315 alone or VL chain fused with MC148 (MC148VL315) or with point-mutated MC148 control (MC148MVL315). Cells were washed extensively, irradiated, and then mixed with T cells for 48 h. Significant amounts of IFN-{gamma} were released by T cells stimulated by iDC which had been pulsed with as little as 100 ng/ml MC148VL315 (Fig. 4a and 4b ). The response was specific to MC148 fusion, as no or only small amounts of IFN-{gamma} were produced by T cells stimulated by APC treated with MC148MVL315, sFv315 alone, MC148 alone, or control MC148 fusion with an irrelevant sFv (MC148sFv38; not shown). Furthermore, T cells were stimulated only when iDC had been treated with the antigen physically linked with MC148, as no response was elicited when iDC had been incubated with a mixture of free MC148 and sFv315 proteins (Fig. 4a and 4b) . Therefore, although MC148 fusion proteins do not induce chemotaxis, they are able to specifically target antigen delivery to iDC for receptor-mediated internalization and processing to elicit peptide-specific T cell responses. Next, we tested whether a DNA vaccine encoding MC148 fusions with sFv antigen could elicit protective antitumor immunity in vivo and compared it with a vaccine based on agonist chemokine vMIP-I.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. MC148-Id fusion protein delivers Id to DC in vitro via chemokine receptor. Mouse BM-derived iDC on day 4 of culture were incubated overnight with VL315-containing fusion protein (MC148VL315 or MC148MVL315) at doses ranging from 250 to 1 ng/ml. Unfused sFv315 and MC148 proteins alone were used as controls, as was a mixture of free, unlinked MC148 and sFv315 (each 0.1 µg/ml). DC were then washed, irradiated, and placed in culture with the Id-specific T cells. Specificity of the T cell clone was validated by recognition of the specific (amino acids 91–101 from MOPC-315 Ig VL, 0.2 µg/ml) versus an irrelevant (10 µg/ml) peptide pulsed on DC. After 48 h, IFN-{gamma} production was assayed in culture supernatants. Results are presented as pg/ml IFN-{gamma}SD in case of duplicate wells). Two independent experiments out of a total of five consecutive experiments performed in duplicate wells or in case of an insufficient number of iDC or 7A10B2 T cell clone in single wells are shown (a and b, respectively).

Vaccine efficacy of agonist and antagonist chemokine fusion constructs in vivo
The 38C-13 lymphoma model (syngeneic in C3H mice) was selected for these in vivo experiments, as it expresses nonimmunogenic tumor antigen (IgM) on the cell surface, and as we have previously reported, DNA immunization with tumor-derived sFv alone does not induce protection [9 ]. Moreover, injection of as few as 100 cells is sufficient to kill a recipient mouse in 2 weeks. Ten mice per group were immunized three times at biweekly intervals with 1–2 µg DNA constructs expressing 38C-13 lymphoma-derived sFv fused with MC148 (pMC148sFv38) or vMIP-I (pvMIP-IsFV38; Fig. 1 ). Control mice were immunized with DNA expressing sFv fused with point-mutated MC148 (pMC148MsFv38) or vMIP-I (pvMIP-IMsFv38; Fig. 1 ). Sera obtained from mice 2 weeks after the last immunization were tested for the presence of Ab specific for 38C-13 tumor Ig. Both groups of mice immunized with plasmids encoding agonist (pvMIP1sFv38) or antagonist (pMC148sFv38) fusion proteins generated substantial Id-specific antibodies (Fig. 5a ). Furthermore, the levels of anti-Id Ab were comparable with that from mice immunized with prototypic, carrier-conjugated Ig protein (Ig38–KLH), and MC148 constructs repeatedly (four of four experiments) elicited somewhat higher anti-Id Ab than the latter (Fig. 5a) . Antibody response was quite homogeneous among mice of the same treatment group (data not shown). Isotypes of antibodies were predominantly IgG1 for viral chemokine and Ig38–KLH, and no significant IgG2a was detected (data not shown) [9 ]. In contrast, control mice immunized with constructs encoding sFv38 fusion with point-mutated agonist (pvMIP-IMsFv38; Fig. 5a ) or antagonist (pMC148MsFv38; not shown) failed to elicit any anti-Id Ab. The lack of anti-Id Ab in these mice was not a result of improper Id folding of sFv, as Id-folding was comparable in all fusion proteins (not shown), or inadequate expression, as all constructs expressed comparable levels of proteins in transiently transfected HEK 293 cells (not shown).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. Agonist and antagonist viral chemokine–sFv fusion DNA vaccines induce comparable anti-Id humoral response and protective antitumor immunity. Ten C3H/HeN mice per group were immunized three times biweekly by gene gun with DNA constructs encoding sFv fused with vMIP-I or MC148. Control groups of mice received PBS or were immunized with DNA constructs in which sFv is fused with point-mutated vMIP-I or MC148. As positive control, mice were immunized with whole tumor-specific Ig conjugated to KLH (Ig38–KLH), 50 µg i.p. [9 , 10 ]. (a) Anti-Id antibody levels of pooled sera from five mice per group 2 weeks after the last immunization were determined by ELISA. (b) In the same experiment, mice were challenged i.p. with a 20-fold lethal dose of 38C-13 tumor cells (2x103) 2 weeks after the last immunization and followed up for survival. A survival plot of 10 mice/group is shown. The log-rank Pvalue is for comparison with control pvMIP-IMsFv38. Similar results were obtained in four independent experiments. (C) To test effects of chemokine coadministration, 10 mice per group were immunized with pMC148sFv38 alone or mixed with DNA encoding wild-type MC148 construct (pMC148sFv38+pMC148) or point-mutated, inactive MC148 (pMC148sFv38+pMC148M). Control mice were immunized with sFv38 fusion with inactive MC148 (pMC148MsFv38). Mice were challenged with 38C-13 cells and followed up for survival. The log-rank P value is for comparison between coadministered pMC148 and pMC148M. OD, Optical density.

Two weeks after the last immunization, mice were challenged with a ten- to 20-fold lethal dose of tumor cells. No or anecdotal (one out of 80 mice) survival was observed in control mice immunized with PBS or DNA expressing sFv fused with point-mutated vMIP-I (pvMIP-IMsFv38; Fig. 5b ) or MC148 (pMC148MsFv38; not shown), respectively. In contrast, significant protection was detected in mice immunized with agonist (pvMIP-IsFv38) or antagonist (pMC148sFv38) chemokine fusion constructs (log rank Pvalue <0.006 for both vs. control; Fig. 5b ). Overall, pooled data from four independent experiments demonstrated no significant difference in long-term survival between mice immunized with pMC148sFv38 or pvMIP-IsFv38. Moreover, data suggest that MC148 fusion vaccine targeted in vivo chemokine receptor to elicit antitumor protection, as the potency of the vaccine could be suppressed by coinjection of competing construct which expressed wild-type, but not point-mutated and inactive, MC148, and vaccine constructs bearing point mutation in MC148 (to affect CCR8 binding) did not elicit any responses (Fig. 5c) . These data suggest that chemokine receptor-mediated delivery of this model antigen to APC is sufficient to elicit protective immunity in the absence of chemotaxis, even for a poorly immunogenic and very aggressive lymphoma.


arrow
DISCUSSION
 
Herein, we expand our observations that a model nonimmunogenic self tumor antigen, lymphoma Id, is rendered immunogenic by genetic fusion with chemokines [9 , 10 ] by dissecting the relative roles of receptor targeting and induction of chemotaxis and demonstrating that both agonist and antagonist viral chemokines can convert Id into an immunogen. vMIP-I and MC148 were selected for their apparent monogamous relationship with CCR8, to which they bind with comparable high affinity as agonist and antagonist, respectively [18 19 20 21 , 35 ].

Targeting antigen delivery to chemokine receptors on APC, such as iDC, is an attractive vaccine strategy. In addition to targeted antigen delivery, chemokine receptor ligands induce chemotaxis in vitro and in vivo [9 , 10 ], augmenting local inflammation at the vaccine injection site, thus potentially activating APC. For example, the importance of inflammation and DC activation in induction of adaptive immune responses was recently suggested by a similar observation that linkage with anti-DEC205 mAb facilitated antigen uptake and processing by DC, yet this induced tolerance unless DC were first activated by CD40 engagement [3 ]. In our hands, MC148 and vMIP-I fusion constructs with sFv tumor antigen elicited comparable antitumor immunity in vivo, suggesting that APC targeting alone may be sufficient to induce immunity. However, it is tempting to speculate that vaccine-induced chemotaxis may still be advantageous to initiate a local inflammatory response by recruited immune cells expressing the relevant chemokine receptor. For example, binding of the MC148 fusion protein may induce expression of costimulatory molecules and production of proinflammatory cytokines by various subsets of iDC in vivo; thus, the possibility of a "secondary" in vivo recruitment of immune cells at the site of vaccine administration cannot be formally excluded. Nonetheless, the remarkable lack of inflammatory infiltrates in MCV lesions [20 ] seems to contradict this possibility. Our results further demonstrate that despite being a receptor antagonist, MC148 fusion protein clearly targeted delivery of MOPC-315-derived VL to iDC for processing and presentation to VL peptide-specific T cells in a specific manner in vitro (Fig. 4a and 4b) . This result contrasted with inability of unfused antigen, which failed to stimulate the same T cells in the range of protein concentrations tested. The mixture of free antigen and MC148 also failed to stimulate T cells, providing additional support for a targeting mechanism. Moreover, we have previously demonstrated that no immunity was elicited in mice immunized with DNA expressing a free, unlinked mixture of antigen and chemoattractants, suggesting that simple cell infiltration to the site of vaccine administration without specific targeting was not sufficient to break unresponsiveness to sFv or HIV antigens [9 10 11 ]. All activities of MC148 fusions were abolished in vitro and in vivo by a single point mutation in the chemokine receptor binding domain of MC148 [23 ], and the immune response in vivo was inhibited by coadministration of competing ligand, suggesting that the MC148 fusion vaccine uses a chemokine receptor-mediated targeting mechanism. These results are in concordance with our previous reports that similar mutations also abrogated chemokine receptor binding and antitumor immune responses of antigens fused with other chemokines [9 , 10 ]. This conclusion is also supported by independent experiments in which mouse mAb, devoid of agonistic activity, directed against a number of human chemokine receptors, were efficiently processed and presented to a C{kappa}/DR4-specific T cell clone [36 , 37 ].

CCR8 expression, although mostly associated with thymocytes [29 ], differentiated T helper type 2 cells [38 ], and endothelial cells [39 ], has also been reported for murine and human cells of the monocytic/macrophage lineage [13 14 15 16 17 ]. In additional support for an in vivo targeting of antigen delivery to APC as the key mechanism underlying immunization, we demonstrate that some subsets of DC, particularly murine BM-derived iDC and epidermis-derived iDC cell line XS-52, express CCR8. This latter finding is of particular relevance to our results, as the vaccine was delivered to the mouse epidermis. Theoretically, skin-resident macrophages or peripheral DC expressing CCR8 may have been taking up the fusion protein expressed in the host skin.

Overall, our data suggest that the chimeric chemokine-antigen vaccines function similarly to native chemokines, i.e., targeting and possibly chemoattracting [9 ] APC by binding respective chemokine receptors, which in turn allows internalization of the fused antigen for subsequent processing and presentation. The data presented suggest that it is sufficient to target antigen delivery to chemokine receptors on APC in vivo but do not exclude that establishing a true chemotactic gradient in vivo may improve the induction of immunity.

Finally, relevant to future clinical translation, our data also provide proof of principle that viral chemokines can replace native chemokines as vaccine carrier, which would circumvent the potential risk of autoimmunity against native chemokines [40 ]. In fact, viral chemokines show only partial sequence similarity with human homologues and retain the ability to bind chemokine receptors [12 ].


arrow
ACKNOWLEDGEMENTS
 
We are grateful to Munhsuren Surenhu, Elena Klyushnenkova, Bryan Haines, and Orville C. Bowersox (SAIC-Frederick, MD) for technical assistance, to Bernard Moss (NIH, Bethesda, MD) for the gift of the MC148-encoding plasmid, to Zack Howard (SAIC-Frederick) for the gift of hCCR8/HEK 293, to Gabriel Marquez (Madrid, Spain) for providing mCCR8/HEK 293 and anti-mCCR8 mAb 8F4, to Akira Takashima (Dallas, TX) for the gift of DC lines XS106 and XS52, and to Judy Mikovits (SAIC-Frederick) for the gift of total RNA from BCBL-1 cell line.

Received October 16, 2003; revised March 3, 2004; accepted March 9, 2004.


arrow
REFERENCES
 
    1
  1. Engering, A. J., Cella, M., Fluitsma, D., Brockhaus, M., Hoefsmit, E. C., Lanzavecchia, A., Pieters, J. (1997) The mannose receptor functions as a high capacity and broad specificity antigen receptor in human dendritic cells Eur. J. Immunol. 27,2417-2425[Medline]
  2. 2
  3. Guyre, P. M., Graziano, R. F., Goldstein, J., Wallace, P. K., Morganelli, P. M., Wardwell, K., Howell, A. L. (1997) Increased potency of Fc-receptor-targeted antigens Cancer Immunol. Immunother. 45,146-148[CrossRef][Medline]
  4. 3
  5. Hawiger, D., Inaba, K., Dorsett, Y., Guo, M., Mahnke, K., Rivera, M., Ravetch, J. V., Steinman, R. M., Nussenzweig, M. C. (2001) Dendritic cells induce peripheral T cell unresponsiveness under steady state conditions in vivo J. Exp. Med. 194,769-779[Abstract/Free Full Text]
  6. 4
  7. Lanzavecchia, A., Sallusto, F. (2001) The instructive role of dendritic cells on T cell responses: lineages, plasticity and kinetics Curr. Opin. Immunol. 13,291-298[CrossRef][Medline]
  8. 5
  9. Sallusto, F., Schaerli, P., Loetscher, P., Schaniel, C., Lenig, D., Mackay, C. R., Qin, S., Lanzavecchia, A. (1998) Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation Eur. J. Immunol. 28,2760-2769[CrossRef][Medline]
  10. 6
  11. Dieu, M. C., Vanbervliet, B., Vicari, A., Bridon, J. M., Oldham, E., Ait-Yahia, S., Briere, F., Zlotnik, A., Lebecque, S., Caux, C. (1998) Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites J. Exp. Med. 188,373-386[Abstract/Free Full Text]
  12. 7
  13. Homey, B., Muller, A., Zlotnik, A. (2002) Chemokines: agents for the immunotherapy of cancer? Nat. Rev. Immunol. 2,175-184[CrossRef][Medline]
  14. 8
  15. Mantovani, A., Sozzani, S., Locati, M., Allavena, P., Sica, A. (2002) Macrophage polarization: tumor-associated macrophages as a paradigm for polarized M2 mononuclear phagocytes Trends Immunol. 23,549-555[CrossRef][Medline]
  16. 9
  17. Biragyn, A., Tani, K., Grimm, M. C., Weeks, S. D., Kwak, L. W. (1999) Genetic fusion of chemokines to a self tumor antigen induces protective, T-cell dependent antitumor immunity Nat. Biotechnol. 17,253-258[CrossRef][Medline]
  18. 10
  19. Biragyn, A., Surenhu, M., Yang, D., Ruffini, P. A., Haines, B. A., Klyushnenkova, E., Oppenheim, J. J., Kwak, L. W. (2001) Mediators of innate immunity that target immature, but not mature, dendritic cells induce antitumor immunity when genetically fused with nonimmunogenic tumor antigens J. Immunol. 167,6644-6653[Abstract/Free Full Text]
  20. 11
  21. Biragyn, A., Belyakov, I. M., Chow, Y. H., Dimitrov, D. S., Berzofsky, J. A., Kwak, L. W. (2002) DNA vaccines encoding HIV-1 gp120 fusions with proinflammatory chemoattractants induce systemic and mucosal immune responses Blood 100,1153-1159
  22. 12
  23. Murphy, P. M. (2001) Viral exploitation and subversion of the immune system through chemokine mimicry Nat. Immunol. 2,116-122[CrossRef][Medline]
  24. 13
  25. Luo, Y., Dorf, M. E. (1996) ß-Chemokine TCA3 binds to mesangial cells and induces adhesion, chemotaxis, and proliferation J. Immunol. 156,742-748[Abstract]
  26. 14
  27. Luo, Y., Laning, J., Devi, S., Mak, J., Schall, T. J., Dorf, M. E. (1994) Biologic activities of the murine ß-chemokine TCA3 J. Immunol. 153,4616-4624[Abstract]
  28. 15
  29. Laning, J., Kawasaki, H., Tanaka, E., Luo, Y., Dorf, M. E. (1994) Inhibition of in vivo tumor growth by the ß chemokine, TCA3 J. Immunol. 153,4625-4635[Abstract]
  30. 16
  31. Tiffany, H. L., Lautens, L. L., Gao, J. L., Pease, J., Locati, M., Combadiere, C., Modi, W., Bonner, T. I., Murphy, P. M. (1997) Identification of CCR8: a human monocyte and thymus receptor for the CC chemokine I-309 J. Exp. Med. 186,165-170[Abstract/Free Full Text]
  32. 17
  33. Trebst, C., Staugaitis, S. M., Kivisakk, P., Mahad, D., Cathcart, M. K., Tucky, B., Wei, T., Rani, M. R., Horuk, R., Aldape, K. D., Pardo, C. A., Lucchinetti, C. F., Lassmann, H., Ransohoff, R. M. (2003) CC chemokine receptor 8 in the central nervous system is associated with phagocytic macrophages Am. J. Pathol. 162,427-438[Abstract/Free Full Text]
  34. 18
  35. Dairaghi, D. J., Fan, R. A., McMaster, B. E., Hanley, M. R., Schall, T. J. (1999) HHV8-encoded vMIP-I selectively engages chemokine receptor CCR8. Agonist and antagonist profiles of viral chemokines J. Biol. Chem. 274,21569-21574[Abstract/Free Full Text]
  36. 19
  37. Luttichau, H. R., Stine, J., Boesen, T. P., Johnsen, A. H., Chantry, D., Gerstoft, J., Schwartz, T. W. (2000) A highly selective CC chemokine receptor (CCR)8 antagonist encoded by the poxvirus molluscum contagiosum J. Exp. Med. 191,171-180[Abstract/Free Full Text]
  38. 20
  39. Luttichau, H. R., Lewis, I. C., Gerstoft, J., Schwartz, T. W. (2001) The herpesvirus 8-encoded chemokine vMIP-II, but not the poxvirus-encoded chemokine MC148, inhibits the CCR10 receptor Eur. J. Immunol. 31,1217-1220[CrossRef][Medline]
  40. 21
  41. Endres, M. J., Garlisi, C. G., Xiao, H., Shan, L., Hedrick, J. A. (1999) The Kaposi’s sarcoma-related herpesvirus (KSHV)-encoded chemokine vMIP-I is a specific agonist for the CC chemokine receptor (CCR)8 J. Exp. Med. 189,1993-1998[Abstract/Free Full Text]
  42. 22
  43. Bergman, Y., Haimovich, J. (1977) Characterization of a carcinogen-induced murine B lymphocyte cell line of C3H/eB origin Eur. J. Immunol. 7,413-417[Medline]
  44. 23
  45. Clark-Lewis, I., Kim, K. S., Rajarathnam, K., Gong, J. H., Dewald, B., Moser, B., Baggiolini, M., Sykes, B. D. (1995) Structure-activity relationships of chemokines J. Leukoc. Biol. 57,703-711[Abstract]
  46. 24
  47. Buchner, J., Pastan, I., Brinkmann, U. (1992) A method for increasing the yield of properly folded recombinant fusion proteins: single-chain immunotoxins from renaturation of bacterial inclusion bodies Anal. Biochem. 205,263-270[CrossRef][Medline]
  48. 25
  49. Xu, S., Ariizumi, K., Caceres-Dittmar, G., Edelbaum, D., Hashimoto, K., Bergstresser, P. R., Takashima, A. (1995) Successive generation of antigen-presenting, dendritic cell lines from murine epidermis J. Immunol. 154,2697-2705[Abstract]
  50. 26
  51. Timares, L., Takashima, A., Johnston, S. A. (1998) Quantitative analysis of the immunopotency of genetically transfected dendritic cells Proc. Natl. Acad. Sci. USA 95,13147-13152[Abstract/Free Full Text]
  52. 27
  53. Falk, W., Goodwin, R. H. J., Leonard, E. J. (1980) A 48-well micro chemotaxis assembly for rapid and accurate measurement of leukocyte migration J. Immunol. Methods 33,239-247[CrossRef][Medline]
  54. 28
  55. Bogen, B., Lambris, J. D. (1989) Minimum length of an idiotypic peptide and a model for its binding to a major histocompatibility complex class II molecule EMBO J. 8,1947-1952[Medline]
  56. 29
  57. Kremer, L., Carramolino, L., Goya, I., Zaballos, A., Gutierrez, J., Moreno-Ortiz, M. d. C., Martinez-A, C., Marquez, G. (2001) The transient expression of C–C chemokine receptor 8 in thymus identifies a thymocyte subset committed to become CD4+ single-positive T cells J. Immunol. 166,218-225[Abstract/Free Full Text]
  58. 30
  59. Stevenson, G. T., Stevenson, F. K. (1975) Antibody to a molecularly defined antigen confined to a tumour cell surface Nature 254,714-716[CrossRef][Medline]
  60. 31
  61. Huston, J. S., Levinson, D., Mudgett-Hunter, M., Tai, M. S., Novotny, J., Margolies, M. N., Ridge, P. J., Bruccoleri, R. E., Haber, E., Crea, R., Oppermann, H. (1988) Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli Proc. Natl. Acad. Sci. USA 85,5879-5883[Abstract/Free Full Text]
  62. 32
  63. Zingoni, A., Soto, H., Hedrick, J. A., Stoppacciaro, A., Storlazzi, C. T., Sinigaglia, F., D’Ambrosio, D., O’Garra, A., Robinson, D., Rocchi, M., Santoni, A., Zlotnik, A., Napolitano, M. (1998) The chemokine receptor CCR8 is preferentially expressed in Th2 but not Th1 cells J. Immunol. 161,547-551[Abstract/Free Full Text]
  64. 33
  65. Goya, I., Gutierrez, J., Varona, R., Kremer, L., Zaballos, A., Marquez, G. (1998) Identification of CCR8 as the specific receptor for the human ß-chemokine I-309: cloning and molecular characterization of murine CCR8 as the receptor for TCA-3 J. Immunol. 160,1975-1981[Abstract/Free Full Text]
  66. 34
  67. Bogen, B., Malissen, B., Haas, W. (1986) Idiotope-specific T cell clones that recognize syngeneic immunoglobulin fragments in the context of class II molecules Eur. J. Immunol. 16,1373-1378[Medline]
  68. 35
  69. Spinetti, G., Bernardini, G., Camarda, G., Mangoni, A., Santoni, A., Capogrossi, M. C., Napolitano, M. (2003) The chemokine receptor CCR8 mediates rescue from dexamethasone-induced apoptosis via an ERK-dependent pathway J. Leukoc. Biol. 73,201-207[Abstract/Free Full Text]
  70. 36
  71. Schjetne, K. W., Thompson, K. M., Aarvak, T., Fleckenstein, B., Sollid, L. M., Bogen, B. (2002) A mouse C({kappa})-specific T cell clone indicates that DC-SIGN is an efficient target for antibody-mediated delivery of T cell epitopes for MHC class II presentation Int. Immunol. 14,1423-1430[Abstract/Free Full Text]
  72. 37
  73. Schjetne, K. W., Gundersen, H. T., Iversen, J. G., Thompson, K. M., Bogen, B. (2003) Antibody-mediated delivery of antigen to chemokine receptors on antigen-presenting cells results in enhanced CD4+ T cell responses Eur. J. Immunol. 33,3101-3108[CrossRef][Medline]
  74. 38
  75. Colantonio, L., Recalde, H., Sinigaglia, F., D’Ambrosio, D. (2002) Modulation of chemokine receptor expression and chemotactic responsiveness during differentiation of human naive T cells into Th1 or Th2 cells Eur. J. Immunol. 32,1264-1273[CrossRef][Medline]
  76. 39
  77. Haque, N. S., Fallon, J. T., Taubman, M. B., Harpel, P. C. (2001) The chemokine receptor CCR8 mediates human endothelial cell chemotaxis induced by I-309 and Kaposi sarcoma herpesvirus-encoded vMIP-I and by lipoprotein(a)-stimulated endothelial cell conditioned medium Blood 97,39-45[Abstract/Free Full Text]
  78. 40
  79. Chen, T. T., Levy, R. (1995) Induction of autoantibody responses to GM-CSF by hyperimmunization with an Id-GM-CSF fusion protein J. Immunol. 154,3105-3117[Abstract]



This article has been cited by other articles:


Home page
BloodHome page
A. B. Fredriksen and B. Bogen
Chemokine-idiotype fusion DNA vaccines are potentiated by bivalency and xenogeneic sequences
Blood, September 15, 2007; 110(6): 1797 - 1805.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Baatar, P. Olkhanud, D. Newton, K. Sumitomo, and A. Biragyn
CCR4-Expressing T Cell Tumors Can Be Specifically Controlled via Delivery of Toxins to Chemokine Receptors
J. Immunol., August 1, 2007; 179(3): 1996 - 2004.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Biragyn, R. Schiavo, P. Olkhanud, K. Sumitomo, A. King, M. McCain, F. E. Indig, G. Almanzar, and D. Baatar
Tumor-Associated Embryonic Antigen-Expressing Vaccines that Target CCR6 Elicit Potent CD8+ T Cell-Mediated Protective and Therapeutic Antitumor Immunity
J. Immunol., July 15, 2007; 179(2): 1381 - 1388.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Schiavo, D. Baatar, P. Olkhanud, F. E. Indig, N. Restifo, D. Taub, and A. Biragyn
Chemokine receptor targeting efficiently directs antigens to MHC class I pathways and elicits antigen-specific CD8+ T-cell responses
Blood, June 15, 2006; 107(12): 4597 - 4605.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Biragyn, P. A. Ruffini, M. Coscia, L. K. Harvey, S. S. Neelapu, S. Baskar, J.-M. Wang, and L. W. Kwak
Chemokine receptor-mediated delivery directs self-tumor antigen efficiently into the class II processing pathway in vitro and induces protective immunity in vivo
Blood, October 1, 2004; 104(7): 1961 - 1969.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.1003481v1
76/1/77    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruffini, P. A.
Right arrow Articles by Kwak, L. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruffini, P. A.
Right arrow Articles by Kwak, L. W.