Journal of Leukocyte Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published online as doi:10.1189/jlb.0204068 on April 9, 2004

Published online before print April 9, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0204068v1
76/1/145    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reddy, K. V.
Right arrow Articles by Mackman, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reddy, K. V.
Right arrow Articles by Mackman, N.
(Journal of Leukocyte Biology. 2004;76:145-151.)
© 2004 by Society for Leukocyte Biology

Dexamethasone enhances LPS induction of tissue factor expression in human monocytic cells by increasing tissue factor mRNA stability

K. Veera Reddy*, Gourab Bhattacharjee*, Gernot Schabbauer*, Angela Hollis*, Kevin Kempf*, Michael Tencati*, Maria O’Connell{dagger}, Mausumee Guha{ddagger} and Nigel Mackman*,1

* Departments of Immunology and Cell Biology, The Scripps Research Institute, La Jolla, California;
{dagger} MRC Human Nutrition Research, Elsie Widdowson Laboratory, Cambridge, United Kingdom; and
{ddagger} Isis Pharmaceuticals, Inc., Carlsbad Research Center, California

1Correspondence: The Scripps Research Institute, Departments of Immunology & Cell Biology, 10550 North Torrey Pines Road, CVN-18, La Jolla, CA 92037. E-mail: nmackman{at}scripps.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Glucocorticoids, such as dexamethasone (Dex), are used clinically in the treatment of various inflammatory diseases. Dex acts by inhibiting the expression of inflammatory mediators, such as tumor necrosis factor {alpha} (TNF-{alpha}) and monocyte chemoattractant protein-1 (MCP-1). It is surprising that Dex enhances bacterial lipopolysaccharide (LPS) induction of tissue factor (TF) expression in human monocytic cells. TF is a transmembrane glycoprotein that activates the coagulation protease cascade. In this study, we analyze the mechanism by which Dex enhances LPS-induced TF expression in human monocytic cells. We found that Dex reduced LPS-induced TF gene transcription but increased the stability of TF mRNA. Dex decreased the stability of MCP-1 mRNA and did not affect TNF-{alpha} mRNA stability. Finally, we showed that Dex increased the stability of a transcript consisting of the final 297 nucleotides of the TF mRNA in in vitro decay assays. This region contains AU-rich elements that regulate mRNA stability and may mediate the Dex response. Therefore, despite an inhibition of TF gene transcription, Dex enhances TF expression in human monocytic cells by increasing the stability of TF mRNA.

Key Words: gene regulation • coagulation • glucocorticoid


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue factor (TF) is a 47-kDa transmembrane glycoprotein that initiates the coagulation protease cascades [1 ]. Bacterial lipopolysaccharide (LPS) induces the transient expression of TF in human monocytes and monocytic cells, which is mediated at the transcriptional level by the transcription factors activated protein-1 (AP-1), nuclear factor (NF)-{kappa}B, and Egr-1 and at the post-transcriptional level, by a transient stabilization of TF mRNA [2 3 4 5 ]. Aberrant TF expression contributes to thrombosis in patients with atherosclerosis, cancer, and sepsis [6 , 7 ].

Glucocorticoids are widely used as anti-inflammatory drugs to treat various inflammatory diseases [8 , 9 ]. These drugs suppress the expression of proinflammatory mediators, such as cytokines, chemokines, inducible nitric oxide synthase (iNOS), and adhesion molecules [8 , 10 ]. The glucocorticoid dexamethasone (Dex) has been shown to inhibit LPS induction of inflammatory genes in monocytic cells, such as tumor necrosis factor {alpha} (TNF-{alpha}), by blocking the activation of the transcription factors NF-{kappa}B and AP-1 [11 , 12 ]. Dex also inhibits the expression of inflammatory mediators by decreasing the stability of interleukin (IL)-1ß, iNOS, cyclooxygenase-2, and monocyte chemoattractant protein-1 (MCP-1) mRNAs [13 14 15 16 17 ]. In contrast, Dex enhances LPS induction of TF expression in human monocytes and monocytic THP-1 cells [18 ]. Similarly, leukocytes isolated from rabbits presensitized with glucocorticoids before injection with LPS expressed higher levels of procoagulant activity than leukocytes from rabbits given LPS alone [19 , 20 ]. However, unlike monocytic cells, Dex did not enhance LPS induction of TF expression in endothelial cells [18 ].

The transient expression of TF and inflammatory mediators in monocytic cells is controlled, in part, by the rapid turnover of their mRNAs. AU-rich elements (AREs) present in the 3'-untranslated region (UTR) of these mRNAs bind various proteins that increase or decrease their stability [21 22 23 24 25 ]. A common regulatory element within AREs is the pentamer AUUUA [22 , 26 ]. The human TF mRNA contains several AREs in the 3'-UTR, which include AUUUA pentamers, poly U tracts, and a UUAUUUAAU nanomer [27 ]. These AREs in the human TF mRNA are functional, as the last 600 nucleotides (nt) of TF 3'-UTR conferred instability to a ß-globin transcript [28 ]. Indeed, TF mRNA has been assigned to the group III cluster (WAUUU AUUUA UUUAW) of the ARE–mRNA database (ARED) [29 ].

In this study, we examined the mechanism by which Dex enhances LPS induction of TF expression in human monocytic THP-1 cells. We found that Dex enhanced LPS induction of TF activity and TF mRNA expression by increasing the stability of TF mRNA.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell culture
THP-1 monocytic cells were obtained from American Type Culture Collection (Manassas, VA) and were cultured in RPMI 1640 (Gibco-BRL Life Technologies, Gaithersburg, MD) with 8% fetal calf serum (Omega Scientific, Tarzana, CA), 2 mM L-glutamine (Irvine Scientific, Santa Ana, CA), 10 mM HEPES (Gibco-BRL Life Technologies), and 2-mercaptoethanol (50 µM). Cells were stimulated with vehicle (dimethyl sulfoxide), Dex alone (0.01–1 µM; Sigma Chemical Co., St. Louis, MO), and LPS alone (1 µg/ml; Escherichia coli 0111:B4, Calbiochem, San Diego, CA) or were preincubated for 30 min with Dex before LPS stimulation.

Measurement of TF, TNF-{alpha}, and MCP-1 expression
Levels of TNF-{alpha} and MCP-1 in the cell-culture supernatant were measured using commercial enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN). For TF activity, cell pellets were solubilized at 37°C for 15 min in n-octyl-ß-D-glucopyranoside (15 mM; Calbiochem). TF activity was assayed using a one-stage clotting with human plasma [30 ]. Clotting times were converted to TF activity by comparison with a standard curve established with affinity-purified TF from human brain tissue [30 ].

Northern blotting
Total cellular RNA was extracted using Trizol (Gibco-BRL Life Technologies), and Northern blotting was performed [3 ]. A 641-base pair (bp) human TF cDNA fragment, an 800-bp human TNF-{alpha} cDNA fragment, and a 550-bp human MCP-1 cDNA fragment were labeled with [{alpha}32P] deoxycytidine triphosphate (dCTP; ICN Biomedicals, Costa Mesa, CA) using a Prime-It-KitTM (Stratagene Cloning Systems, San Diego, CA) and were used as probes. The housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (G3PDH; Clontech Laboratories, Palo Alto, CA), served as a loading control. Bands were visualized by autoradiography.

Plasmids and transfections
Plasmid TF (pTF)–luciferase (LUC) contains –2106 bp of the human TF promoter [4 ], pTNF-{alpha}–LUC contains –615 bp of the human TNF-{alpha} promoter [31 ], pMCP-1–LUC contains –515 bp of the human MCP-1 promoter [32 ], and p({kappa}B)4LUC contains four copies of a NF-{kappa}B site [33 ]. These promoters were cloned upstream of the firefly LUC reporter gene in pGL2-basic (Promega, Madison, WI). Transfections were performed using diethylaminoethyl dextran [4 ]. After transfection, cells were incubated in complete media for 46 h at 37°C before LPS stimulation for 5 h. Firefly LUC activity was measured in cell lysates, as described in the manufacturer’s protocol (Promega) using a Monolight 2010 luminometer (Analytical Luminescence Laboratory, San Diego, CA). Cells were cotransfected with Renilla LUC-thymidine kinase (RL-TK; Promega), which expresses RL (Promega) to normalize the firefly LUC activity.

Nuclear run-on experiments
Nuclear run-on experiments were performed as described [3 ]. For run-on reactions, nuclei were mixed with an equal volume of the reaction buffer [10 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 0.3 M KCl, 1 mM each adenosine 5'-triphosphate (ATP), CTP, and guanosine 5'-triphosphate, 5 mM dithiothreitol (DTT), 25 U RNasin (Promega) per ml, 10 mM creatine phosphate, 20 U creatine phosphokinase per ml, 0.1 mM phenylmethylsulfonyl fluoride (PMSF)] containing 100 µCi [{alpha}-32P] uridine 5'-triphosphate (UTP; 3000 Ci/mmol, Amersham, Little Chalfont, UK) and incubated for 30 min at 30°C. Radiolabeled RNA was hybridized with a 3705-bp EcoRI–PstI genomic TF fragment (nt –377—+3328 [34 ]) and a G3PDH gene fragment.

Measurement of the stability of TF, TNF-{alpha}, and MCP-1 mRNAs in THP-1 cells
The effect of Dex on the stability of TF, TNF-{alpha}, and MCP-1 mRNAs was evaluated using the transcriptional inhibitor, actinomycin D (10 µg/ml; Gibco-BRL Life Technologies), as described [3 ]. Actinomycin D was added 30 min after LPS stimulation with or without Dex. Cells were harvested at various time-points (0–3 h) following actinomycin D treatment, and RNA was isolated. Northern blotting was performed to determine the levels of TF, TNF-{alpha}, and MCP-1 mRNAs. G3PDH was used to monitor loading.

Preparation of protein extracts
Cytoplasmic extracts were prepared as described [35 ] from unstimulated THP-1 cells or cells treated with Dex alone (90 min), LPS alone (60 min), or 30 min preincubation with Dex before LPS stimulation for 60 min. Cells were harvested and washed with phosphate-buffered saline followed by ice-cold buffer A (25 mM HEPES, pH 7.6, 5 mM MgCl2, 1.5 mM KCl, 0.1% Nonidet P-40, 2 mM DTT) containing protease inhibitors (1 mM PMSF) and complete protease inhibitors (Boehringer Mannheim, Lewes, UK). Cells were resuspended in 1 ml buffer A and lysed with 25 strokes in a dounce homogenizer. The nuclei were pelleted by centrifugation at 12,000 g for 15 min, and the supernatant containing the cytoplasmic proteins was stored at –80°C.

In vitro transcription
Polymerase chain reaction (PCR) generated a DNA fragment containing the final 297-bp of the 3'-UTR region (+1855–+2152 bp) [27 ] of the human TF mRNA using sense (5' CGGGATCCCGGTGCAGGAGACATTGGTATT 3') and antisense (5' CCGCTCGAGCGGAACAATTCCCAGTCACCTTT 3') primers. Underlined sequences indicate the cloning sites. The PCR fragment was subcloned into the BamHI and XhoI sites of pBluescript KS+ (Stratagene Cloning Systems). A synthetic 60-bp poly A tail was ligated at the 3' end of the 297-bp fragment. The plasmid was linearized with KpnI and used as a template for the generation of a 357-nt (297nt+60 nt) RNA transcript using T7 RNA polymerase (Riboprobe system, Promega). A control 210-nt transcript was generated by adding a synthetic 60-bp poly A tail to the end of the polylinker in pBluescript KS+. Transcripts were labeled with 50 µCi [{alpha}-32P] UTP (25 Ci/mmol, ICN Biomedicals) and m7G5'pppG (cap) for 1 h at 37°C followed by 15 min of DNA digestion with DNase I. The transcribed RNA was purified on 6% Tris boric acid-EDTA buffer–urea polyacrylamide gels.

In vitro RNA decay assays
Transcripts were incubated with cytoplasmic extracts that were diluted to 1 µg protein/µl in a buffer containing 20 mM HEPES (pH 7.0), 20% glycerol, 100 mM KCl, 0.2 mM EDTA, 1 mM DTT, and 1 mM PMSF. The reaction mixture contained 10 µg protein, 1 µg synthetic poly A RNA, 2.6% poly vinyl alcohol, 1 mM ATP, 13 mM creatine phosphate, and RNA transcript (50,000 cpm). Aliquots were removed at different time-points and placed in 100 µl stop solution containing 25 mM Tris, pH 7.6, 400 mM NaCl, 0.1% sodium dodecyl sulfate, and 10 µg tRNA. For zero time (input) reaction, stop solution was added before the addition of RNA transcript. Samples were extracted with phenol-chloroform, ethanol-precipitated, and separated by electrophoresis using 5% polyacrylamide gels containing 7 M urea. Bands were visualized by autoradiography.

Data analysis
Band intensities were quantified by densitometric analyses using a personal densitometer (Molecular Dynamics, Sunnyvale, CA) and ImageQuant software. Statistical analysis was performed using the two-tailed, unpaired Student’s t-test, and differences were determined to be statistically significant at a P value <0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Dex enhances LPS induction of TF mRNA and activity in human monocytic THP-1 cells
We used human monocytic THP-1 cells to examine the mechanism by which Dex enhances LPS-induced TF expression in monocytes. We also analyzed TNF-{alpha} and MCP-1 expression as controls, as Dex inhibits LPS induction of these inflammatory mediators. LPS alone induced TF activity 8.8-fold (Fig. 1A ). Pretreatment of the cells with Dex (0.01, 0.1, and 1 µM) strongly enhanced LPS-induced TF expression (Fig. 1A) . In contrast, Dex dose-dependently inhibited LPS-induced TNF-{alpha} expression (Fig. 1B) . Dex also reduced LPS-induced MCP-1 expression (Fig. 1C) . Dex alone weakly induced TF activity (<twofold) but had no effect on TNF-{alpha} and MCP-1 expression (Fig. 1) . Based on these results, we chose to use 1 µM Dex for the study, as this concentration strongly enhanced TF expression and maximally inhibited TNF-{alpha} expression.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. Effect of Dex on LPS induction of TF, TNF-{alpha}, and MCP-1 expression. (A) THP-1 cells were incubated for 5 h with vehicle, LPS (10 µg/ml) alone, and Dex (0.01–1 µM) alone or were preincubated with Dex (0.01–1 µM) for 30 min before LPS stimulation for 5 h. TF activity in cell lysates was measured in a single-step clotting assay. Results are shown as mean ± SEM (n=3). TNF-{alpha} and MCP-1 levels in culture supernatants were measured by ELISA. Results are shown as mean ± SD (n=4). Asterisks indicate values that were statistically different from the LPS-stimulated cells (P<0.05).

 
Next, we evaluated the effect of Dex on steady-state levels of TF mRNA to determine if Dex also enhances LPS-induced TF mRNA expression. LPS alone induced TF mRNA levels 13.5 ± eightfold (mean±SE, n=3), which was enhanced 4.2-fold by Dex (Fig. 2 ). In contrast, Dex reduced LPS-induced TNF-{alpha} and MCP-1 mRNA expression. Dex alone weakly induced TF mRNA 2.5 ± onefold but had no effect on TNF-{alpha} and MCP-1 mRNA levels (Fig. 2) . These data demonstrate that Dex synergistically enhances LPS-induced TF activity and mRNA expression in monocytic cells but reduces LPS-induced TNF-{alpha} and MCP-1 mRNA expression.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 2. Effect of Dex on LPS induction of TF, TNF-{alpha}, and MCP-1 mRNA expression. THP-1 cells were incubated for 2 h with vehicle, LPS (10 µg/ml) alone, and Dex (1 µM) alone or were preincubated with Dex for 30 min before LPS stimulation for 2 h. Steady-state levels of TF, TNF-{alpha}, and MCP-1 mRNAs were determined by Northern blotting. G3PDH was used to monitor RNA loading. Data are shown from a representative experiment of three independent experiments.

 
Dex inhibits LPS induction of TF gene transcription
We analyzed the effect of Dex on LPS-induced TF gene transcription to determine if Dex enhances TF expression by increasing transcription. THP-1 cells were transfected with the reporter plasmids pTF–LUC, pTNF-{alpha}–LUC, and pMCP-1–LUC and were stimulated with LPS in the presence and absence of Dex. LPS induced TF promoter activity 11.7-fold (Fig. 3A ). In contrast to Dex enhancement of LPS-induced TF mRNA and activity, Dex inhibited LPS-induced TF promoter activity by 58% (Fig. 3A) . Dex also inhibited LPS induction of the TNF-{alpha} and MCP-1 promoters (Fig. 3A) . Dex alone had no effect on the basal activities of any of these promoters. Further studies showed that Dex inhibited LPS induction of NF-{kappa}B-dependent LUC expression from p({kappa}B)4LUC by 38% (not shown).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Effect of Dex on LPS induction of TF, TNF-{alpha}, and MCP-1 gene expression. (A) THP-1 cells were transfected with pTF–LUC, pTNF-{alpha}–LUC, and pMCP-1–LUC and were cotransfected with pRL-TK (Promega), which expresses RL. Transfected cells were incubated for 5 h with vehicle, LPS (10 µg/ml) alone, and Dex (1 µM) alone or were preincubated with Dex for 30 min before stimulation with LPS for 5 h. Levels of firefly LUC were normalized to the expression of RL and were shown as mean ± SEM (n=3). The asterisks indicate that Dex treatment produced a statistically significant reduction (P<0.05) in LPS-induced TF and TNF-{alpha} promoter expression compared with cells treated with LPS alone. (B) Nuclear run-on experiments were performed using nuclei from THP-1 cells incubated for 1 h with vehicle alone, LPS (10 µg/ml) alone, and Dex (1 µM) alone or were preincubated with Dex for 30 min before stimulation with LPS for 1 h. Data normalized to G3PDH from a representative experiment of two experiments are shown.

 
To exclude the possibility that a positively acting Dex response element was located outside the cloned TF promoter, we performed nuclear run-on experiments. LPS increased the rate of TF gene transcription 2.5-fold, which was reduced by 36% in the presence of Dex (Fig. 3B) . These results indicate that Dex enhancement of LPS-induced expression of TF is not a result of an enhancement of TF gene transcription.

Dex increases the stability of TF mRNA
Our studies suggested that Dex enhancement of LPS-induced TF mRNA expression was mediated by a post-transcriptional mechanism. Therefore, we measured the stability of LPS-induced TF mRNA in the presence and absence of Dex using actinomycin D to inhibit TF gene transcription. We found that Dex increased the half-life of TF mRNA from 35 to 105 min (Fig. 4A ). Dex did not affect the stability of TNF-{alpha} mRNA but decreased the stability of MCP-1 mRNA (Fig. 4B and 4C) . These data indicate that Dex increases the stability of TF mRNA in LPS-stimulated THP-1 cells.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4. Effect of Dex on the stability of TF, TNF-{alpha}, and MCP-1 mRNAs. THP-1 cells were incubated for 30 min with LPS (10 µg/ml) with or without a 30-min preincubation with Dex (1 µM) before actinomycin D (10 µg/ml) was added. Samples were taken between 0 and 3 h. The decay of TF (A), TNF-{alpha} (B), and MCP-1 (C) mRNAs was monitored by Northern blotting. Data from a representative experiment of three independent experiments are shown. TF, TNF-{alpha}, and MCP-1 mRNA levels were normalized using G3PDH and were shown as mean ± SEM (n=3).

 
Dex increases the stability of a TF transcript in in vitro decay assays
We performed in vitro decay assays to confirm the effect of Dex on the stability of TF mRNA and to localize the Dex-responsive region within the TF transcript. We focused our study on the last 297 nt of the TF 3'-UTR, as this region contains five AREs and is the most likely target of Dex-mediated stabilization (Fig. 5A ). A transcript containing 297 nt of the TF 3'-UTR and a poly A tail was incubated with cytoplasmic extracts from untreated THP-1 cells or cells treated with Dex alone, LPS alone, or Dex and LPS. The stability of the TF transcript was increased slightly when incubated with cytoplasmic extracts from cells treated with LPS or Dex alone compared with cytoplasmic extracts from unstimulated cells (Fig. 5B) . However, the TF transcript was most stable when incubated with cytoplasmic extracts from cells stimulated with Dex and LPS. A control transcript derived from pBluescript was stable for 60 min when incubated with the different cytoplasmic extracts (Fig. 5C) . The relative instability of the TF 3'-UTR transcript compared with the control transcript indicates that the TF 3'-UTR contains elements that mediate instability. These studies support our conclusion that Dex enhancement of LPS-induced TF mRNA expression in THP-1 cells is mediated by an increase in TF mRNA stability.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 5. Effect of Dex on the stability of a TF transcript. (A) Sequence of the last 297 nt of human TF mRNA (numbering from ref. [27 ]). The position of five AREs (underlined) is shown, which includes AUUUA pentamers, poly U tracts, and a UUAUUUAAU nanomer. (B) Decay of a radiolabeled TF transcript in the presence of cytoplasmic extracts from THP-1 cells incubated for 60 min with vehicle, LPS (10 µg/ml) alone, and Dex (1 µM) alone or preincubated with Dex for 30 min before stimulation with LPS for 60 min. Samples were incubated at 37°C, and aliquots were taken between 0 and 60 min and analyzed on 5% polyacrylamide gels containing 7 M urea. A representative experiment is shown. Quantitation of the decay of the TF transcript from three experiments is shown (mean±SEM, n=3). Data are expressed as a percentage of the T0 sample. (C) Decay of a control transcript.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we showed that Dex dramatically enhanced the LPS induction of TF mRNA and activity in human monocytic cells. Analysis of the mechanism revealed that Dex inhibited LPS-induced TF gene transcription but enhanced TF mRNA stability. These results indicate that the post-transcriptional enhancement of TF mRNA stability by Dex in monocytic cells overcomes the inhibition of TF gene transcription, leading to a net enhancement of TF mRNA and protein expression.

We found that Dex inhibited LPS induction of TF gene expression in THP-1 cells in nuclear run-on experiments and in transient transfection experiments using a plasmid containing the human TF promoter. Dex also inhibited LPS induction of the TNF-{alpha} and MCP-1 promoters and NF-{kappa}B-dependent gene expression. The TF, TNF-{alpha}, and MCP-1 promoters are regulated by NF-{kappa}B and AP-1 in monocytic and endothelial cells [4 , 31 , 32 ]. Thus, our studies are consistent with previous studies showing that Dex inhibits genes regulated by the transcription factors NF-{kappa}B and AP-1 [12 , 36 ].

Analysis of TF mRNA stability in LPS-stimulated THP-1 cells in the presence and absence of Dex demonstrated that Dex enhancement of TF expression is mediated by a post-transcriptional mechanism. Measurement of TF mRNA stability showed that Dex increased the half-life of TF mRNA from 35 min to 105 min. The Dex-dependent stabilization of TF mRNA explains how Dex enhances LPS-induced TF mRNA and protein expression in THP-1 cells. This post-transcriptional mechanism would also explain why Dex alone weakly increases TF mRNA and activity without inducing TF gene transcription.

To further analyze the Dex-dependent stabilization of TF mRNA, we used in vitro decay assays. We focused on the last 297 nt of the TF 3'-UTR, as this region contains several AREs that include AUUUA pentamers, poly U tracks, and a UUAUUUAAU nanomer, all of which have been shown to regulate the stability of various mRNAs [21 22 23 24 ]. Indeed, this TF 3'-UTR transcript was unstable compared with a control transcript, which is consistent with a previous study showing that the TF 3'-UTR conferred instability to a ß-globin transcript [28 ]. We found that the stability of the TF transcript was increased when incubated with cytoplasmic extracts from cells stimulated with LPS alone or Dex alone compared with cytoplasmic extracts from unstimulated cells. LPS activation of the p38 mitogen-activated protein kinase (MAPK) pathway in THP-1 cells has been shown to increase the stability of a variety of ARE-containing mRNAs [37 ]. We previously demonstrated that LPS transiently stabilizes TF mRNA in THP-1 cells [3 ]. The current study extends this observation and shows that LPS-dependent stabilization is mediated by the last 297 nt of the TF transcript. At present, the mechanism by which LPS stabilizes TF mRNA has not been defined. It is important that the TF transcript was most stable when incubated with cytoplasmic extracts from cells stimulated with Dex and LPS. These results indicate that Dex enhancement of the stability of TF mRNA is mediated by a region(s) within the last 297 nt of the TF transcript.

Dex is used clinically in the treatment of various inflammatory diseases. Dex inhibits the expression of a variety of proinflammatory mediators at the transcriptional level by blocking NF-{kappa}B and AP-1 activity. Dex enhancement of the LPS induction of TF in human monocytic cells is rather unusual. The only other examples of Dex enhancement of LPS-induced gene expression are the expression of soluble type II IL receptor expression by peripheral blood mononuclear cells and the expression of sialoadhesin by rat macrophages [38 , 39 ]. In addition, treatment of mice with Dex enhanced neutrophil accumulation and macrophage-inflammatory protein-2 expression in the lungs of endotoxemic mice [40 ]. Further studies are required to determine if Dex enhancement of the LPS-induced expression of these genes is mediated via a common mechanism.

AREs in the 3'-UTRs of many inflammatory mediators are known to promote rapid mRNA degradation [21 22 23 24 25 ]. Other studies have shown that rates of mRNA decay can be modified in response to extracellular stimuli, such as LPS and IL-1{alpha}. For example, we have shown that LPS stimulation of THP-1 cells transiently stabilizes TF mRNA [3 ]. A more recent study showed that LPS activation of the p38 MAPK pathway in monocytic THP-1 cells mediated the increased stability of a variety of ARE-containing mRNAs [37 ]. In addition, IL-1{alpha} enhancement of the stability of a variety of cytokine and chemokine mRNAs is dependent on the presence of ARE motifs in the 3'-UTRs [41 42 43 44 ]. We speculate that Dex may induce the expression or function of a protein that stabilizes TF mRNA, such as Hu antigen R and ARE/poly(U)-binding/degradation factor-1 [45 , 46 ], or inhibit the expression or function of a protein that destabilizes TF mRNA, such as tristetrapolin [47 ]. The differential effects of Dex on the stability of TF, TNF-{alpha}, and MCP-1 mRNAs in LPS-stimulated THP-1 cells may be a result of the different affinities of the stabilizing and destabilizing proteins for the AREs within these different mRNAs. Further studies are required to characterize the proteins that bind to the AREs and other sites in the TF 3'-UTR and to define the precise mechanism by which Dex enhances TF mRNA stability in human monocytic cells.


    ACKNOWLEDGEMENTS
 
Grant Number HL48872 (N. M.) from the National Institutes of Health supported this work. We acknowledge C. Johnson for preparing the manuscript.

Received February 3, 2004; revised March 1, 2004; accepted March 9, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bach, R. R. (1988) Initiation of coagulation by tissue factor CRC Crit. Rev. Biochem. 23,339-368[Medline]
  2. Gregory, S. A., Morrissey, J. H., Edgington, T. S. (1989) Regulation of tissue factor gene expression in the monocyte procoagulant response to endotoxin Mol. Cell. Biol. 9,2752-2755[Abstract/Free Full Text]
  3. Brand, K., Fowler, B. J., Edgington, T. S., Mackman, N. (1991) Tissue factor mRNA in THP-1 monocytic cells is regulated at both transcriptional and posttranscriptional levels in response to lipopolysaccharide Mol. Cell. Biol. 11,4732-4738[Abstract/Free Full Text]
  4. Mackman, N., Brand, K., Edgington, T. S. (1991) Lipopolysaccharide-mediated transcriptional activation of the human tissue factor gene in THP-1 monocytic cells requires both activator protein 1 and nuclear factor {kappa}B binding sites J. Exp. Med. 174,1517-1526[Abstract/Free Full Text]
  5. Guha, M., O’Connell, M. A., Pawlinski, R., Yan, S. F., Stern, D., Mackman, N. (2001) Lipopolysaccharide activation of the MEK-ERK1/2 pathway in human monocytic cells mediates tissue factor and tumor necrosis factor {alpha} expression by inducing Elk-1 phosphorylation and Egr-1 expression Blood 98,1429-1439[Abstract/Free Full Text]
  6. Edgington, T. S., Mackman, N., Brand, K., Ruf, W. (1991) The structural biology of expression and function of tissue factor Thromb. Haemost. 66,67-79[Medline]
  7. Camerer, E., Kolsto, A. B., Prydz, H. (1996) Cell biology of tissue factor, the principal initiator of blood coagulation Thromb. Res. 81,1-41[CrossRef][Medline]
  8. Barnes, P. J., Adcock, I. (1993) Anti-inflammatory actions of steroids: molecular mechanisms Trends Pharmacol. Sci. 14,436-441[CrossRef][Medline]
  9. Adcock, I. M., Brown, C. R., Gelder, C. M., Shirasaki, H., Peters, M. J., Barnes, P. J. (1995) Effects of glucocorticoids on transcription factor activation in human peripheral blood mononuclear cells Am. J. Physiol. 268,C331-C338
  10. Joyce, D. A., Steer, J. H., Abraham, L. J. (1997) Glucocorticoid modulation of human monocyte/macrophage function: control of TNF-{alpha} secretion Inflamm. Res. 46,447-451[CrossRef][Medline]
  11. Steer, J. H., Kroeger, K. M., Abraham, L. J., Joyce, D. A. (2000) Glucocorticoids suppress tumor necrosis factor-{alpha} expression by human monocytic THP-1 cells by suppressing transactivation through adjacent NF-{kappa} B and c-Jun-activating transcription factor-2 binding sites in the promoter J. Biol. Chem. 275,18432-18440[Abstract/Free Full Text]
  12. Jeon, Y. J., Han, S. H., Lee, Y. W., Lee, M., Yang, K. H., Kim, H. M. (2000) Dexamethasone inhibits IL-1ß gene expression in LPS-stimulated RAW 264.7 cells by blocking NF-{kappa}B/Rel and AP-1 activation Immunopharmacology 48,173-183[CrossRef][Medline]
  13. Poon, M., Liu, B., Taubman, M. B. (1999) Identification of a novel dexamethasone-sensitive RNA-destabilizing region on rat monocyte chemoattractant protein 1 mRNA Mol. Cell. Biol. 19,6471-6478[Abstract/Free Full Text]
  14. Korhonen, R., Lahti, A., Hämäläinen, M., Kankaanranta, H., Moilanen, E. (2002) Dexamethasone inhibits nitric-oxide synthase expression and nitric oxide production by destabilizing mRNA in lipopolysaccharide-treated macrophages Mol. Pharmacol. 62,698-704[Abstract/Free Full Text]
  15. Lasa, M., Brook, M., Saklatvala, J., Clark, A. R. (2001) Dexamethasone destabilizes cyclooxygenase 2 mRNA by inhibiting mitogen-activated protein kinase p38 Mol. Cell. Biol. 21,771-780[Abstract/Free Full Text]
  16. Amano, Y., Lee, S. W., Allison, A. C. (1993) Inhibition by glucocorticoids of the formation of interleukin-1{alpha}, interleukin-1ß, and interleukin-6: mediation by decreased mRNA stability Mol. Pharmacol. 43,176-182[Abstract]
  17. Ristimäki, A., Narko, K., Hla, T. (1996) Down-regulation of cytokine-induced cyclo-oxygenase-2 transcript isoforms by dexamethasone: evidence for post-transcriptional regulation Biochem. J. 318,325-331
  18. Bottles, K. D., Morrissey, J. H. (1993) Dexamethasone enhances agonist induction of tissue factor in monocytes but not in endothelial cells Blood Coagul. Fibrinolysis 4,405-414[Medline]
  19. Robinson, A. J., Rapaport, S. I., Brown, S. F. (1978) Procoagulant activity of peritoneal leukocytes: effects of cortisone and endotoxin Am. J. Physiol.. 235,H333-H337
  20. Osterud, B., Tindall, A., Olsen, J. O. (1989) Effect of steroids during Escherichia coli endotoxinaemia in rabbits Haemostasis 19,292-299[Medline]
  21. Caput, D., Beutler, B., Hartog, K., Thayer, R., Brown-Shimer, S., Cerami, A. (1986) Identification of a common nucleotide sequence in the 3'-untranslated region of mRNA molecules specifying inflammatory mediators Proc. Natl. Acad. Sci. USA 83,1670-1674[Abstract/Free Full Text]
  22. Guhaniyogi, J., Brewer, G. (2001) Regulation of mRNA stability in mammalian cells Gene 265,11-23[CrossRef][Medline]
  23. Dixon, D. A., Kaplan, C. D., McIntyre, T. M., Zimmerman, G. A., Prescott, S. M. (2000) Post-transcriptional control of cyclooxygenase-2 gene expression. The role of the 3'-untranslated region J. Biol. Chem. 275,11750-11757[Abstract/Free Full Text]
  24. Lewis, T., Gueydan, C., Huez, G., Toulmé, J-J., Kruys, V. (1998) Mapping of a minimal AU-rich sequence required for lipopolysaccharide-induced binding of a 55-kDa protein on tumor necrosis factor-{alpha} mRNA J. Biol. Chem. 273,13781-13786[Abstract/Free Full Text]
  25. Chen, C. Y., Shyu, A. B. (1995) AU-rich elements: characterization and importance in mRNA degradation Trends Biochem. Sci. 20,465-470[CrossRef][Medline]
  26. Malter, J. S. (1989) Identification of an AUUUA-specific messenger RNA binding protein Science 246,664-666[Abstract/Free Full Text]
  27. Morrissey, J. H., Gregory, S. A., Mackman, N., Edgington, T. S. (1989) Tissue factor regulation and gene organization Oxf. Surv. Eukaryot. Genes 6,67-84[Medline]
  28. Ahern, S. M., Miyata, T., Sadler, J. E. (1993) Regulation of human tissue factor expression by mRNA turnover J. Biol. Chem. 268,2154-2159[Abstract/Free Full Text]
  29. Bakheet, T., Frevel, M., Williams, B. R., Greer, W., Khabar, K. S. (2001) ARED: human AU-rich element-containing mRNA database reveals an unexpectedly diverse functional repertoire of encoded proteins Nucleic Acids Res. 29,246-254[Abstract/Free Full Text]
  30. Morrissey, J. H., Fair, D. S., Edgington, T. S. (1988) Monoclonal antibody analysis of purified and cell-associated tissue factor Thromb. Res. 52,247-261[CrossRef][Medline]
  31. Yao, J., Mackman, N., Edgington, T. S., Fan, S-T. (1997) Lipopolysaccharide induction of the tumor necrosis factor-{alpha} promoter in human monocytic cells: regulation by Egr-1, c-Jun and NF-{kappa}B transcription factors J. Biol. Chem. 272,17795-17801[Abstract/Free Full Text]
  32. Parry, G. C., Martin, T., Felts, K. A., Cobb, R. R. (1998) IL-1ß-induced monocyte chemoattractant protein-1 gene expression in endothelial cells is blocked by proteasome inhibitors Arterioscler. Thromb. Vasc. Biol. 18,934-940[Abstract/Free Full Text]
  33. Oeth, P. A., Parry, G. C. N., Kunsch, C., Nantermet, P., Rosen, C. A., Mackman, N. (1994) Lipopolysaccharide induction of tissue factor gene expression in monocytic cells is mediated by binding of c-Rel/p65 heterodimers to a {kappa}B-like site Mol. Cell. Biol. 14,3772-3781[Abstract/Free Full Text]
  34. Mackman, N., Morrissey, J. H., Fowler, B., Edgington, T. S. (1989) Complete sequence of the human tissue factor gene, a highly regulated cellular receptor that initiates the coagulation protease cascade Biochemistry 28,1755-1762[CrossRef][Medline]
  35. Di Marco, S., Hel, Z., Lachance, C., Furneaux, H., Radzioch, D. (2001) Polymorphism in the 3'-untranslated region of TNF{alpha} mRNA impairs binding of the post-transcriptional regulatory protein HuR to TNF{alpha} mRNA Nucleic Acids Res 29,863-871[Abstract/Free Full Text]
  36. Almus, F. E., Rao, L. V. M., Pendurthi, U. R., Quattrochi, L., Rapaport, S. I. (1991) Mechanism for diminished tissue factor expression by endothelial cells cultured with heparin binding growth factor-1 and heparin Blood 77,1256-1262[Abstract/Free Full Text]
  37. Frevel, M. A., Bakheet, T., Silva, A. M., Hissong, J. G., Khabar, K. S., Williams, B. R. (2003) p38 mitogen-activated protein kinase-dependent and -independent signaling of mRNA stability of AU-rich element-containing transcripts Mol. Cell. Biol. 23,425-436[Abstract/Free Full Text]
  38. Brown, E. A., Dare, H. A., Marsh, C. B., Wewers, M. D. (1996) The combination of endotoxin and dexamethasone induces type II interleukin 1 receptor (IL-1r II) in monocytes: a comparison to interleukin 1 ß (IL-1 ß) and interleukin 1 receptor antagonist (IL-1ra) Cytokine 8,828-836[Medline]
  39. van den Berg, T. K., van Die, I., de Lavalette, C. R., Dopp, E. A., Smit, L. D., van der Meide, P. H., Tilders, F. J., Crocker, P. R., Dijkstra, C. D. (1996) Regulation of sialoadhesin expression on rat macrophages. Induction by glucocorticoids and enhancement by IFN-ß, IFN-{gamma}, IL-4, and lipopolysaccharide J. Immunol. 157,3130-3138[Abstract]
  40. Aoki, K., Ishida, Y., Kikuta, N., Kawai, H., Kuroiwa, M., Sato, H. (2002) Role of CXC chemokines in the enhancement of LPS-induced neutrophil accumulation in the lung of mice by dexamethasone Biochem. Biophys. Res. Commun. 294,1101-1108[CrossRef][Medline]
  41. Lasa, M., Mahtani, K. R., Finch, A., Brewer, G., Saklatvala, J., Clark, A. R. (2000) Regulation of cyclooxygenase 2 mRNA stability by the mitogen-activated protein kinase p38 signaling cascade Mol. Cell. Biol. 20,4265-4274[Abstract/Free Full Text]
  42. Stoeckle, M. Y. (1991) Post-transcriptional regulation of gro {alpha}, ß, {gamma}, and IL-8 mRNAs by IL-1 beta Nucleic Acids Res 19,917-920[Abstract/Free Full Text]
  43. Holtmann, H., Winzen, R., Holland, P., Eickemeier, S., Hoffmann, E., Wallach, D., Malinin, N. L., Cooper, J. A., Resch, K., Kracht, M. (1999) Induction of interleukin-8 synthesis integrates effects on transcription and mRNA degradation from at least three different cytokine- or stress-activated signal transduction pathways Mol. Cell. Biol. 19,6742-6753[Abstract/Free Full Text]
  44. Tebo, J., Der, S., Frevel, M., Khabar, K. S., Williams, B. R., Hamilton, T. A. (2003) Heterogeneity in control of mRNA stability by AU rich elements J. Biol. Chem. 278,12085-12093[Abstract/Free Full Text]
  45. Sengupta, S., Jang, B. C., Wu, M. T., Paik, J. H., Furneaux, H., Hla, T. (2003) The RNA-binding protein HuR regulates the expression of cyclooxygenase-2 J. Biol. Chem. 278,25227-25233[Abstract/Free Full Text]
  46. Blaxall, B. C., Pende, A., Wu, S. C., Port, J. D. (2002) Correlation between intrinsic mRNA stability and the affinity of AUF1 (hnRNP D) and HuR for A+U-rich mRNAs Mol. Cell. Biochem. 232,1-11[CrossRef][Medline]
  47. Blackshear, P. J., Lai, W. S., Kennington, E. A., Brewer, G., Wilson, G. M., Guan, X., Zhou, P. (2003) Characteristics of the interaction of a synthetic human tristetraprolin tandem zinc finger peptide with AU-rich element-containing RNA substrates J. Biol. Chem. 278,19947-19955[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Physiol.Home page
V. Douard, H.-I. Choi, S. Elshenawy, D. Lagunoff, and R. P. Ferraris
Developmental reprogramming of rat GLUT5 requires glucocorticoid receptor translocation to the nucleus
J. Physiol., August 1, 2008; 586(15): 3657 - 3673.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. H. Mogensen, R. S. Berg, S. R. Paludan, and L. Ostergaard
Mechanisms of Dexamethasone-Mediated Inhibition of Toll-Like Receptor Signaling Induced by Neisseria meningitidis and Streptococcus pneumoniae
Infect. Immun., January 1, 2008; 76(1): 189 - 197.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. D. de Kruif, L. C. Lemaire, I. A. Giebelen, M. A. D. van Zoelen, J. M. Pater, P. S. van den Pangaart, A. P. Groot, A. F. de Vos, P. J. Elliott, J. C. M. Meijers, et al.
Prednisolone Dose-Dependently Influences Inflammation and Coagulation during Human Endotoxemia
J. Immunol., February 1, 2007; 178(3): 1845 - 1851.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Cai, C. Song, I. Endoh, J. Goyette, W. Jessup, S. B. Freedman, H. P. McNeil, and C. L. Geczy
Serum Amyloid A Induces Monocyte Tissue Factor
J. Immunol., February 1, 2007; 178(3): 1852 - 1860.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. S. BelAiba, T. Djordjevic, S. Bonello, F. Artunc, F. Lang, J. Hess, and A. Gorlach
The Serum- and Glucocorticoid-Inducible Kinase Sgk-1 Is Involved in Pulmonary Vascular Remodeling: Role in Redox-Sensitive Regulation of Tissue Factor by Thrombin
Circ. Res., March 31, 2006; 98(6): 828 - 836.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0204068v1
76/1/145    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reddy, K. V.
Right arrow Articles by Mackman, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reddy, K. V.
Right arrow Articles by Mackman, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS