Published online before print April 9, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


* Departments of Immunology and Cell Biology, The Scripps Research Institute, La Jolla, California;
MRC Human Nutrition Research, Elsie Widdowson Laboratory, Cambridge, United Kingdom; and
Isis Pharmaceuticals, Inc., Carlsbad Research Center, California
1Correspondence: The Scripps Research Institute, Departments of Immunology & Cell Biology, 10550 North Torrey Pines Road, CVN-18, La Jolla, CA 92037. E-mail: nmackman{at}scripps.edu
|
|
|---|
(TNF-
) and monocyte chemoattractant protein-1 (MCP-1). It is surprising that Dex enhances bacterial lipopolysaccharide (LPS) induction of tissue factor (TF) expression in human monocytic cells. TF is a transmembrane glycoprotein that activates the coagulation protease cascade. In this study, we analyze the mechanism by which Dex enhances LPS-induced TF expression in human monocytic cells. We found that Dex reduced LPS-induced TF gene transcription but increased the stability of TF mRNA. Dex decreased the stability of MCP-1 mRNA and did not affect TNF-
mRNA stability. Finally, we showed that Dex increased the stability of a transcript consisting of the final 297 nucleotides of the TF mRNA in in vitro decay assays. This region contains AU-rich elements that regulate mRNA stability and may mediate the Dex response. Therefore, despite an inhibition of TF gene transcription, Dex enhances TF expression in human monocytic cells by increasing the stability of TF mRNA.
Key Words: gene regulation coagulation glucocorticoid
|
|
|---|
B, and Egr-1 and at the post-transcriptional level, by a transient stabilization of TF mRNA [2
3
4
5
]. Aberrant TF expression contributes to thrombosis in patients with atherosclerosis, cancer, and sepsis [6
, 7
].
Glucocorticoids are widely used as anti-inflammatory drugs to treat various inflammatory diseases [8
, 9
]. These drugs suppress the expression of proinflammatory mediators, such as cytokines, chemokines, inducible nitric oxide synthase (iNOS), and adhesion molecules [8
, 10
]. The glucocorticoid dexamethasone (Dex) has been shown to inhibit LPS induction of inflammatory genes in monocytic cells, such as tumor necrosis factor
(TNF-
), by blocking the activation of the transcription factors NF-
B and AP-1 [11
, 12
]. Dex also inhibits the expression of inflammatory mediators by decreasing the stability of interleukin (IL)-1ß, iNOS, cyclooxygenase-2, and monocyte chemoattractant protein-1 (MCP-1) mRNAs [13
14
15
16
17
]. In contrast, Dex enhances LPS induction of TF expression in human monocytes and monocytic THP-1 cells [18
]. Similarly, leukocytes isolated from rabbits presensitized with glucocorticoids before injection with LPS expressed higher levels of procoagulant activity than leukocytes from rabbits given LPS alone [19
, 20
]. However, unlike monocytic cells, Dex did not enhance LPS induction of TF expression in endothelial cells [18
].
The transient expression of TF and inflammatory mediators in monocytic cells is controlled, in part, by the rapid turnover of their mRNAs. AU-rich elements (AREs) present in the 3'-untranslated region (UTR) of these mRNAs bind various proteins that increase or decrease their stability [21 22 23 24 25 ]. A common regulatory element within AREs is the pentamer AUUUA [22 , 26 ]. The human TF mRNA contains several AREs in the 3'-UTR, which include AUUUA pentamers, poly U tracts, and a UUAUUUAAU nanomer [27 ]. These AREs in the human TF mRNA are functional, as the last 600 nucleotides (nt) of TF 3'-UTR conferred instability to a ß-globin transcript [28 ]. Indeed, TF mRNA has been assigned to the group III cluster (WAUUU AUUUA UUUAW) of the AREmRNA database (ARED) [29 ].
In this study, we examined the mechanism by which Dex enhances LPS induction of TF expression in human monocytic THP-1 cells. We found that Dex enhanced LPS induction of TF activity and TF mRNA expression by increasing the stability of TF mRNA.
|
|
|---|
Measurement of TF, TNF-
, and MCP-1 expression
Levels of TNF-
and MCP-1 in the cell-culture supernatant were measured using commercial enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN). For TF activity, cell pellets were solubilized at 37°C for 15 min in n-octyl-ß-D-glucopyranoside (15 mM; Calbiochem). TF activity was assayed using a one-stage clotting with human plasma [30
]. Clotting times were converted to TF activity by comparison with a standard curve established with affinity-purified TF from human brain tissue [30
].
Northern blotting
Total cellular RNA was extracted using Trizol (Gibco-BRL Life Technologies), and Northern blotting was performed [3
]. A 641-base pair (bp) human TF cDNA fragment, an 800-bp human TNF-
cDNA fragment, and a 550-bp human MCP-1 cDNA fragment were labeled with [
32P] deoxycytidine triphosphate (dCTP; ICN Biomedicals, Costa Mesa, CA) using a Prime-It-KitTM (Stratagene Cloning Systems, San Diego, CA) and were used as probes. The housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (G3PDH; Clontech Laboratories, Palo Alto, CA), served as a loading control. Bands were visualized by autoradiography.
Plasmids and transfections
Plasmid TF (pTF)luciferase (LUC) contains 2106 bp of the human TF promoter [4
], pTNF-
LUC contains 615 bp of the human TNF-
promoter [31
], pMCP-1LUC contains 515 bp of the human MCP-1 promoter [32
], and p(
B)4LUC contains four copies of a NF-
B site [33
]. These promoters were cloned upstream of the firefly LUC reporter gene in pGL2-basic (Promega, Madison, WI). Transfections were performed using diethylaminoethyl dextran [4
]. After transfection, cells were incubated in complete media for 46 h at 37°C before LPS stimulation for 5 h. Firefly LUC activity was measured in cell lysates, as described in the manufacturers protocol (Promega) using a Monolight 2010 luminometer (Analytical Luminescence Laboratory, San Diego, CA). Cells were cotransfected with Renilla LUC-thymidine kinase (RL-TK; Promega), which expresses RL (Promega) to normalize the firefly LUC activity.
Nuclear run-on experiments
Nuclear run-on experiments were performed as described [3
]. For run-on reactions, nuclei were mixed with an equal volume of the reaction buffer [10 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 0.3 M KCl, 1 mM each adenosine 5'-triphosphate (ATP), CTP, and guanosine 5'-triphosphate, 5 mM dithiothreitol (DTT), 25 U RNasin (Promega) per ml, 10 mM creatine phosphate, 20 U creatine phosphokinase per ml, 0.1 mM phenylmethylsulfonyl fluoride (PMSF)] containing 100 µCi [
-32P] uridine 5'-triphosphate (UTP; 3000 Ci/mmol, Amersham, Little Chalfont, UK) and incubated for 30 min at 30°C. Radiolabeled RNA was hybridized with a 3705-bp EcoRIPstI genomic TF fragment (nt 377+3328 [34
]) and a G3PDH gene fragment.
Measurement of the stability of TF, TNF-
, and MCP-1 mRNAs in THP-1 cells
The effect of Dex on the stability of TF, TNF-
, and MCP-1 mRNAs was evaluated using the transcriptional inhibitor, actinomycin D (10 µg/ml; Gibco-BRL Life Technologies), as described [3
]. Actinomycin D was added 30 min after LPS stimulation with or without Dex. Cells were harvested at various time-points (03 h) following actinomycin D treatment, and RNA was isolated. Northern blotting was performed to determine the levels of TF, TNF-
, and MCP-1 mRNAs. G3PDH was used to monitor loading.
Preparation of protein extracts
Cytoplasmic extracts were prepared as described [35
] from unstimulated THP-1 cells or cells treated with Dex alone (90 min), LPS alone (60 min), or 30 min preincubation with Dex before LPS stimulation for 60 min. Cells were harvested and washed with phosphate-buffered saline followed by ice-cold buffer A (25 mM HEPES, pH 7.6, 5 mM MgCl2, 1.5 mM KCl, 0.1% Nonidet P-40, 2 mM DTT) containing protease inhibitors (1 mM PMSF) and complete protease inhibitors (Boehringer Mannheim, Lewes, UK). Cells were resuspended in 1 ml buffer A and lysed with 25 strokes in a dounce homogenizer. The nuclei were pelleted by centrifugation at 12,000 g for 15 min, and the supernatant containing the cytoplasmic proteins was stored at 80°C.
In vitro transcription
Polymerase chain reaction (PCR) generated a DNA fragment containing the final 297-bp of the 3'-UTR region (+1855+2152 bp) [27
] of the human TF mRNA using sense (5' CGGGATCCCGGTGCAGGAGACATTGGTATT 3') and antisense (5' CCGCTCGAGCGGAACAATTCCCAGTCACCTTT 3') primers. Underlined sequences indicate the cloning sites. The PCR fragment was subcloned into the BamHI and XhoI sites of pBluescript KS+ (Stratagene Cloning Systems). A synthetic 60-bp poly A tail was ligated at the 3' end of the 297-bp fragment. The plasmid was linearized with KpnI and used as a template for the generation of a 357-nt (297nt+60 nt) RNA transcript using T7 RNA polymerase (Riboprobe system, Promega). A control 210-nt transcript was generated by adding a synthetic 60-bp poly A tail to the end of the polylinker in pBluescript KS+. Transcripts were labeled with 50 µCi [
-32P] UTP (25 Ci/mmol, ICN Biomedicals) and m7G5'pppG (cap) for 1 h at 37°C followed by 15 min of DNA digestion with DNase I. The transcribed RNA was purified on 6% Tris boric acid-EDTA bufferurea polyacrylamide gels.
In vitro RNA decay assays
Transcripts were incubated with cytoplasmic extracts that were diluted to 1 µg protein/µl in a buffer containing 20 mM HEPES (pH 7.0), 20% glycerol, 100 mM KCl, 0.2 mM EDTA, 1 mM DTT, and 1 mM PMSF. The reaction mixture contained 10 µg protein, 1 µg synthetic poly A RNA, 2.6% poly vinyl alcohol, 1 mM ATP, 13 mM creatine phosphate, and RNA transcript (50,000 cpm). Aliquots were removed at different time-points and placed in 100 µl stop solution containing 25 mM Tris, pH 7.6, 400 mM NaCl, 0.1% sodium dodecyl sulfate, and 10 µg tRNA. For zero time (input) reaction, stop solution was added before the addition of RNA transcript. Samples were extracted with phenol-chloroform, ethanol-precipitated, and separated by electrophoresis using 5% polyacrylamide gels containing 7 M urea. Bands were visualized by autoradiography.
Data analysis
Band intensities were quantified by densitometric analyses using a personal densitometer (Molecular Dynamics, Sunnyvale, CA) and ImageQuant software. Statistical analysis was performed using the two-tailed, unpaired Students t-test, and differences were determined to be statistically significant at a P value <0.05.
|
|
|---|
and MCP-1 expression as controls, as Dex inhibits LPS induction of these inflammatory mediators. LPS alone induced TF activity 8.8-fold (Fig. 1A
). Pretreatment of the cells with Dex (0.01, 0.1, and 1 µM) strongly enhanced LPS-induced TF expression (Fig. 1A)
. In contrast, Dex dose-dependently inhibited LPS-induced TNF-
expression (Fig. 1B)
. Dex also reduced LPS-induced MCP-1 expression (Fig. 1C)
. Dex alone weakly induced TF activity (<twofold) but had no effect on TNF-
and MCP-1 expression (Fig. 1)
. Based on these results, we chose to use 1 µM Dex for the study, as this concentration strongly enhanced TF expression and maximally inhibited TNF-
expression.
![]() View larger version (17K): [in a new window] |
Figure 1. Effect of Dex on LPS induction of TF, TNF- , and MCP-1 expression. (A) THP-1 cells were incubated for 5 h with vehicle, LPS (10 µg/ml) alone, and Dex (0.011 µM) alone or were preincubated with Dex (0.011 µM) for 30 min before LPS stimulation for 5 h. TF activity in cell lysates was measured in a single-step clotting assay. Results are shown as mean ± SEM (n=3). TNF- and MCP-1 levels in culture supernatants were measured by ELISA. Results are shown as mean ± SD (n=4). Asterisks indicate values that were statistically different from the LPS-stimulated cells (P<0.05).
|
and MCP-1 mRNA expression. Dex alone weakly induced TF mRNA 2.5 ± onefold but had no effect on TNF-
and MCP-1 mRNA levels (Fig. 2)
. These data demonstrate that Dex synergistically enhances LPS-induced TF activity and mRNA expression in monocytic cells but reduces LPS-induced TNF-
and MCP-1 mRNA expression.
![]() View larger version (29K): [in a new window] |
Figure 2. Effect of Dex on LPS induction of TF, TNF- , and MCP-1 mRNA expression. THP-1 cells were incubated for 2 h with vehicle, LPS (10 µg/ml) alone, and Dex (1 µM) alone or were preincubated with Dex for 30 min before LPS stimulation for 2 h. Steady-state levels of TF, TNF- , and MCP-1 mRNAs were determined by Northern blotting. G3PDH was used to monitor RNA loading. Data are shown from a representative experiment of three independent experiments.
|
LUC, and pMCP-1LUC and were stimulated with LPS in the presence and absence of Dex. LPS induced TF promoter activity 11.7-fold (Fig. 3A
). In contrast to Dex enhancement of LPS-induced TF mRNA and activity, Dex inhibited LPS-induced TF promoter activity by 58% (Fig. 3A)
. Dex also inhibited LPS induction of the TNF-
and MCP-1 promoters (Fig. 3A)
. Dex alone had no effect on the basal activities of any of these promoters. Further studies showed that Dex inhibited LPS induction of NF-
B-dependent LUC expression from p(
B)4LUC by 38% (not shown).
![]() View larger version (20K): [in a new window] |
Figure 3. Effect of Dex on LPS induction of TF, TNF- , and MCP-1 gene expression. (A) THP-1 cells were transfected with pTFLUC, pTNF- LUC, and pMCP-1LUC and were cotransfected with pRL-TK (Promega), which expresses RL. Transfected cells were incubated for 5 h with vehicle, LPS (10 µg/ml) alone, and Dex (1 µM) alone or were preincubated with Dex for 30 min before stimulation with LPS for 5 h. Levels of firefly LUC were normalized to the expression of RL and were shown as mean ± SEM (n=3). The asterisks indicate that Dex treatment produced a statistically significant reduction (P<0.05) in LPS-induced TF and TNF- promoter expression compared with cells treated with LPS alone. (B) Nuclear run-on experiments were performed using nuclei from THP-1 cells incubated for 1 h with vehicle alone, LPS (10 µg/ml) alone, and Dex (1 µM) alone or were preincubated with Dex for 30 min before stimulation with LPS for 1 h. Data normalized to G3PDH from a representative experiment of two experiments are shown.
|
Dex increases the stability of TF mRNA
Our studies suggested that Dex enhancement of LPS-induced TF mRNA expression was mediated by a post-transcriptional mechanism. Therefore, we measured the stability of LPS-induced TF mRNA in the presence and absence of Dex using actinomycin D to inhibit TF gene transcription. We found that Dex increased the half-life of TF mRNA from 35 to 105 min (Fig. 4A
). Dex did not affect the stability of TNF-
mRNA but decreased the stability of MCP-1 mRNA (Fig. 4B
and 4C)
. These data indicate that Dex increases the stability of TF mRNA in LPS-stimulated THP-1 cells.
![]() View larger version (44K): [in a new window] |
Figure 4. Effect of Dex on the stability of TF, TNF- , and MCP-1 mRNAs. THP-1 cells were incubated for 30 min with LPS (10 µg/ml) with or without a 30-min preincubation with Dex (1 µM) before actinomycin D (10 µg/ml) was added. Samples were taken between 0 and 3 h. The decay of TF (A), TNF- (B), and MCP-1 (C) mRNAs was monitored by Northern blotting. Data from a representative experiment of three independent experiments are shown. TF, TNF- , and MCP-1 mRNA levels were normalized using G3PDH and were shown as mean ± SEM (n=3).
|
![]() View larger version (34K): [in a new window] |
Figure 5. Effect of Dex on the stability of a TF transcript. (A) Sequence of the last 297 nt of human TF mRNA (numbering from ref. [27
]). The position of five AREs (underlined) is shown, which includes AUUUA pentamers, poly U tracts, and a UUAUUUAAU nanomer. (B) Decay of a radiolabeled TF transcript in the presence of cytoplasmic extracts from THP-1 cells incubated for 60 min with vehicle, LPS (10 µg/ml) alone, and Dex (1 µM) alone or preincubated with Dex for 30 min before stimulation with LPS for 60 min. Samples were incubated at 37°C, and aliquots were taken between 0 and 60 min and analyzed on 5% polyacrylamide gels containing 7 M urea. A representative experiment is shown. Quantitation of the decay of the TF transcript from three experiments is shown (mean±SEM, n=3). Data are expressed as a percentage of the T0 sample. (C) Decay of a control transcript.
|
|
|
|---|
We found that Dex inhibited LPS induction of TF gene expression in THP-1 cells in nuclear run-on experiments and in transient transfection experiments using a plasmid containing the human TF promoter. Dex also inhibited LPS induction of the TNF-
and MCP-1 promoters and NF-
B-dependent gene expression. The TF, TNF-
, and MCP-1 promoters are regulated by NF-
B and AP-1 in monocytic and endothelial cells [4
, 31
, 32
]. Thus, our studies are consistent with previous studies showing that Dex inhibits genes regulated by the transcription factors NF-
B and AP-1 [12
, 36
].
Analysis of TF mRNA stability in LPS-stimulated THP-1 cells in the presence and absence of Dex demonstrated that Dex enhancement of TF expression is mediated by a post-transcriptional mechanism. Measurement of TF mRNA stability showed that Dex increased the half-life of TF mRNA from 35 min to 105 min. The Dex-dependent stabilization of TF mRNA explains how Dex enhances LPS-induced TF mRNA and protein expression in THP-1 cells. This post-transcriptional mechanism would also explain why Dex alone weakly increases TF mRNA and activity without inducing TF gene transcription.
To further analyze the Dex-dependent stabilization of TF mRNA, we used in vitro decay assays. We focused on the last 297 nt of the TF 3'-UTR, as this region contains several AREs that include AUUUA pentamers, poly U tracks, and a UUAUUUAAU nanomer, all of which have been shown to regulate the stability of various mRNAs [21 22 23 24 ]. Indeed, this TF 3'-UTR transcript was unstable compared with a control transcript, which is consistent with a previous study showing that the TF 3'-UTR conferred instability to a ß-globin transcript [28 ]. We found that the stability of the TF transcript was increased when incubated with cytoplasmic extracts from cells stimulated with LPS alone or Dex alone compared with cytoplasmic extracts from unstimulated cells. LPS activation of the p38 mitogen-activated protein kinase (MAPK) pathway in THP-1 cells has been shown to increase the stability of a variety of ARE-containing mRNAs [37 ]. We previously demonstrated that LPS transiently stabilizes TF mRNA in THP-1 cells [3 ]. The current study extends this observation and shows that LPS-dependent stabilization is mediated by the last 297 nt of the TF transcript. At present, the mechanism by which LPS stabilizes TF mRNA has not been defined. It is important that the TF transcript was most stable when incubated with cytoplasmic extracts from cells stimulated with Dex and LPS. These results indicate that Dex enhancement of the stability of TF mRNA is mediated by a region(s) within the last 297 nt of the TF transcript.
Dex is used clinically in the treatment of various inflammatory diseases. Dex inhibits the expression of a variety of proinflammatory mediators at the transcriptional level by blocking NF-
B and AP-1 activity. Dex enhancement of the LPS induction of TF in human monocytic cells is rather unusual. The only other examples of Dex enhancement of LPS-induced gene expression are the expression of soluble type II IL receptor expression by peripheral blood mononuclear cells and the expression of sialoadhesin by rat macrophages [38
, 39
]. In addition, treatment of mice with Dex enhanced neutrophil accumulation and macrophage-inflammatory protein-2 expression in the lungs of endotoxemic mice [40
]. Further studies are required to determine if Dex enhancement of the LPS-induced expression of these genes is mediated via a common mechanism.
AREs in the 3'-UTRs of many inflammatory mediators are known to promote rapid mRNA degradation [21
22
23
24
25
]. Other studies have shown that rates of mRNA decay can be modified in response to extracellular stimuli, such as LPS and IL-1
. For example, we have shown that LPS stimulation of THP-1 cells transiently stabilizes TF mRNA [3
]. A more recent study showed that LPS activation of the p38 MAPK pathway in monocytic THP-1 cells mediated the increased stability of a variety of ARE-containing mRNAs [37
]. In addition, IL-1
enhancement of the stability of a variety of cytokine and chemokine mRNAs is dependent on the presence of ARE motifs in the 3'-UTRs [41
42
43
44
]. We speculate that Dex may induce the expression or function of a protein that stabilizes TF mRNA, such as Hu antigen R and ARE/poly(U)-binding/degradation factor-1 [45
, 46
], or inhibit the expression or function of a protein that destabilizes TF mRNA, such as tristetrapolin [47
]. The differential effects of Dex on the stability of TF, TNF-
, and MCP-1 mRNAs in LPS-stimulated THP-1 cells may be a result of the different affinities of the stabilizing and destabilizing proteins for the AREs within these different mRNAs. Further studies are required to characterize the proteins that bind to the AREs and other sites in the TF 3'-UTR and to define the precise mechanism by which Dex enhances TF mRNA stability in human monocytic cells.
Received February 3, 2004; revised March 1, 2004; accepted March 9, 2004.
|
|
|---|
B binding sites J. Exp. Med. 174,1517-1526
expression by inducing Elk-1 phosphorylation and Egr-1 expression Blood 98,1429-1439
secretion Inflamm. Res. 46,447-451[CrossRef][Medline]
expression by human monocytic THP-1 cells by suppressing transactivation through adjacent NF-
B and c-Jun-activating transcription factor-2 binding sites in the promoter J. Biol. Chem. 275,18432-18440
B/Rel and AP-1 activation Immunopharmacology 48,173-183[CrossRef][Medline]
, interleukin-1ß, and interleukin-6: mediation by decreased mRNA stability Mol. Pharmacol. 43,176-182[Abstract]
mRNA J. Biol. Chem. 273,13781-13786
promoter in human monocytic cells: regulation by Egr-1, c-Jun and NF-
B transcription factors J. Biol. Chem. 272,17795-17801
B-like site Mol. Cell. Biol. 14,3772-3781
mRNA impairs binding of the post-transcriptional regulatory protein HuR to TNF
mRNA Nucleic Acids Res 29,863-871
, IL-4, and lipopolysaccharide J. Immunol. 157,3130-3138[Abstract]
, ß,
, and IL-8 mRNAs by IL-1 beta Nucleic Acids Res 19,917-920This article has been cited by other articles:
![]() |
T. H. Mogensen Pathogen Recognition and Inflammatory Signaling in Innate Immune Defenses Clin. Microbiol. Rev., April 1, 2009; 22(2): 240 - 273. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Douard, H.-I. Choi, S. Elshenawy, D. Lagunoff, and R. P. Ferraris Developmental reprogramming of rat GLUT5 requires glucocorticoid receptor translocation to the nucleus J. Physiol., August 1, 2008; 586(15): 3657 - 3673. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Mogensen, R. S. Berg, S. R. Paludan, and L. Ostergaard Mechanisms of Dexamethasone-Mediated Inhibition of Toll-Like Receptor Signaling Induced by Neisseria meningitidis and Streptococcus pneumoniae Infect. Immun., January 1, 2008; 76(1): 189 - 197. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. de Kruif, L. C. Lemaire, I. A. Giebelen, M. A. D. van Zoelen, J. M. Pater, P. S. van den Pangaart, A. P. Groot, A. F. de Vos, P. J. Elliott, J. C. M. Meijers, et al. Prednisolone Dose-Dependently Influences Inflammation and Coagulation during Human Endotoxemia J. Immunol., February 1, 2007; 178(3): 1845 - 1851. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Cai, C. Song, I. Endoh, J. Goyette, W. Jessup, S. B. Freedman, H. P. McNeil, and C. L. Geczy Serum Amyloid A Induces Monocyte Tissue Factor J. Immunol., February 1, 2007; 178(3): 1852 - 1860. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. BelAiba, T. Djordjevic, S. Bonello, F. Artunc, F. Lang, J. Hess, and A. Gorlach The Serum- and Glucocorticoid-Inducible Kinase Sgk-1 Is Involved in Pulmonary Vascular Remodeling: Role in Redox-Sensitive Regulation of Tissue Factor by Thrombin Circ. Res., March 31, 2006; 98(6): 828 - 836. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||