| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Published online before print March 12, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* Department of Biological Sciences, Rutgers University, Newark, New Jersey; and
Instituto de Parasitologia y Biomedicina Lopez Neyra, CSIC, Granada, Spain
1 Correspondence: Rutgers University, Department of Biological Sciences, 101 Warren St., Newark, NJ 07102. E-mail: dganea{at}andromeda.rutgers.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: neuropeptides • bone marrow-derived dendritic cells • T cell proliferation • Th1/Th2 effectors
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Nonlymphoid and lymphoid organs are innervated by peptidergic nerve fibers capable of releasing various neuropeptides, such as vasoactive intestinal peptide (VIP), calcitonin gene-related peptide (CGRP), melanocyte-stimulating hormone (
-MSH), and substance P, released from sensory or autonomic nerve fibers and/or synthesized by immune cells, which have significant, immunomodulatory functions, including effects on DC (reviewed in refs. [7
8
9
]). Several subsets of DC with different origin, localization, and possibly different functions have been described (reviewed in refs. [10
, 11
]). The study of neuropeptide effects on the development and function of DC is quite incomplete, and most studies are limited to the skin-residing Langerhans cells (reviewed in refs. [10
, 11
]).
The neuropeptide VIP and the structurally related pituitary adenylate cyclase-activating polypeptide (PACAP) are potent, immunomodulatory agents. They function as general suppressors of macrophage/microglia activation and promote the differentiation and survival of T helper cell type 2 (Th2), as opposed to Th1 effectors (reviewed in refs. [12 13 14 ]). In contrast to macrophages and T cells, the role of VIP/PACAP in DC development and function has not been investigated. Only two previous studies, both using human blood monocyte-derived DC, reported effects of VIP on maturation and chemotaxis [15 , 16 ]. There are no studies about the effects of VIP/PACAP on murine DC maturation and/or function. Here, we report that VIP and PACAP have opposite effects on immature DC (iDC) and lipopolysaccharide (LPS)-stimulated bone marrow-derived DC (BM-DC) in terms of expression of costimulatory molecules and the capacity to activate CD4+ T cells. The function of the VIP/PACAP-treated DC was assessed in vitro and in vivo, leading to similar conclusions.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
(IFN-), IL-5, IL-10, monoclonal Ab (mAb) to CD40, CD4, Vß3, CD11b, CD11c, intracellular adhesion molecule-1, I-Ek, CD80 [IG10, rat immunoglobulin G (IgG)2a], and CD86 (GL1, rat IgG2a) and recombinant murine IFN-, IL-4, IL-5, and IL-10 were purchased from PharMingen (San Diego, CA). Recombinant murine granulocyte macrophage-colony stimulating factor (GM-CSF) was purchased from PeproTech (Rocky Hill, NJ). Pigeon cytochrome c fragment (PCCF) was synthesized and purified by Research Genetics (Huntsville, AL). LPS (from Escherichia coli 055:B5), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP), nitroblue tetrazolium (NBT), and avidin-peroxidase were purchased from Sigma Chemical Co. (St. Louis, MO). Maxadilan, a PACAP type 1 (PAC1) agonist; Ro 25-1553, a VIP receptor 2 (VPAC2) agonist; and [K15,R16,L27]VIP(1–7)–growth hormone-releasing factor (GRF8–27), a VPAC1 agonist, were generous gifts from Drs. Ethan Lerner (Massachusetts General Hospital, Charlestown) Ann Welton (Hoffmann-La Roche, Nutley, NJ), and Patrick Robberecht (Universite Libre de Bruxelles, Belgium), respectively. The VPAC1 antagonist, [Ac-His1,D-Phe2,K15,R16,L27]VIP(3–7)–GRF(8–27), was provided by Dr. P. Robberecht, and the PAC1/VPAC2 antagonist PACAP6–38 was purchased from Peninsula Laboratories (Belmont, CA).
Animals
B10.A (I-Ek), BALB/c (H-2d), and T cell receptor–Cyt-5CC7-I/Rag1–/– transgenic (Tg; I-Ek) mice were obtained from Jackson Laboratory (Bar Harbor, ME) and Taconic Farms (Germantown, NY). All mice used were between 7 and 12 weeks of age.
Cell isolation and cultures
BM-DC were generated as described previously [17
]. Nonadherent cells collected at days 7–8 consisted of 70–80% CD11c+ cells, as determined by fluorescein-activated cell sorter (FACS) analysis. DC (CD11c+) were further purified by using anti-CD11c immunomagnetic beads and the autoMACS system, according to the manufacturer’s instructions (Miltenyi Biotech, Bergish-Gladbach, Germany). The purified CD11c+ DC were plated in flat-bottom 48-well microtiter plates at 5 x 105 cells per well in a final volume of 500 µl and incubated in medium (iDC) or LPS (1 µg/ml) in the presence or absence of various concentrations of VIP or PACAP38 for 24 h at 37°C in 5% CO2. The cells were analyzed by flow cytometry or used in costimulatory assays as described below.
Purified, naïve CD4 T cells from Tg mice were isolated by positive immunomagnetic selection with anti-CD4 mAb magnetic beads (Miltenyi Biotech). The purified T cells were >98% CD4+ by FACS analysis.
APC were prepared by T cell depletion of B10.A (I-Ek) spleen cells with a mixture of anti-CD8 and anti-CD4 mAb magnetic beads and were treated with 50 µg/ml mitomycin C (Sigma Chemical Co.) for 20 min at 37°C.
FACS analysis
BM-DC (1x106 cells/ml) were harvested in ice-cold RPMI complete medium and were washed twice with phosphate-buffered saline (PBS) containing 0.1% sodium azide plus 2% heat-inactivated fetal calf serum (wash buffer). Cells were incubated with various mAb [fluorescein isothiocyanate (FITC)–anti-CD80, FITC–anti-CD86, FITC–anti-CD40, FITC–anti-I-Ek, phycoerythrin (PE)–anti-CD11c, FITC–anti-CD11b, 2.5 µg/ml final concentration] at 4°C for 1 h. Isotype-matched Ab were used as controls, and IgG block (Sigma Chemical Co.) was used to block the nonspecific binding to Fc receptors. After extensive washing, the cells were fixed in 1% paraformaldehyde. Stained DC, gated according to forward- and side-scatter characteristics, were analyzed on a FACScan flow cytometer (Becton Dickinson, San Jose, CA). Samples in which isotype-matched Ab was used instead of specific Ab were used as negative controls to determine the proper region or window setting. Fluorescence data were expressed as mean channel fluorescence (MCF) and/or as percentage of positive cells after subtraction of background isotype-matched values.
Assay of DC costimulatory activity
Allogeneic stimulation was performed by adding different numbers of B10.A BM-DC to BALB/c lymph node T cells (5x105) in flat-bottom 96-well plates. The syngeneic stimulation was performed by adding different numbers of B10.A BM-DC to purified PCCF-specific Tg CD4 T cells (5x105 cells/well) in the presence of PCCF (5 µM). The proliferation was evaluated by using a colorimetric cell proliferation assay (bromodeoxyuridine) from Roche Diagnostics GmbH (Mannheim, Germany) according to the manufacturer’s instructions. Cell-free culture supernatants were also harvested and kept at –20°C until cytokine determination by enzyme-linked immunosorbent assay (ELISA).
Allogeneic in vivo BM-DC/T cell priming
B10.A BM-DC (1x106 cells/ml) were incubated with medium alone, VIP (10–8 M), or PACAP (10–8 M) for 24 h. After washing, 2 x 105 BM-DC (in 50 µl PBS) were injected subcutaneously (s.c.) into the hind footpads of BALB/c mice. After 10 days, popliteal lymph node cells (4x105) were seeded in 96-well flat-bottom plates and were restimulated with different numbers of mitomycin C-treated B10.A splenic APC. The proliferation was evaluated by pulsing with 0.5 µCi [3H]thymidine (TdR; specific activity, 97 Ci/mmol, DuPont, Wilmington, DE) for the last 16 h of a 4-day culture period. [3H]TdR incorporation was measured by using a ß-scintillation counter (Beckman, Palo Alto, CA).
Syngeneic in vivo BM-DC/T cell priming
B10.A BM-DC (1x106 cells/ml) were incubated with medium alone, VIP (10–8 M), PACAP (10–8 M), LPS (1 µg/ml), LPS + VIP, or LPS + PACAP and were pulsed with PCCF (5 µM) for 24 h. After washing, 2 x 105, BM-DC were injected s.c. into the footpads of syngeneic, PCCF-specific Tg mice. On days 1 and 3, 500 µg PCCF balanced salt solution was injected intraperitoneally (i.p.). On day 10, CD4 T cells from the popliteal lymph nodes were isolated, plated in 96-well plates (5x105 cells/well), and restimulated ex vivo with different numbers of mitomycin C-treated, B10.A-splenic APC in the presence of PCCF (5 µM). The proliferation was evaluated by [3H]TdR incorporation as above. In some experiments, cell-free supernatants from the cultures restimulated ex vivo were harvested after 4 days and assayed for IL-4 and IFN- by ELISA. In other experiments, the numbers of IFN-- and IL-4-producing T cells per 105 viable cells were determined by enzyme-linked immunospot (ELISPOT) 24 h after restimulation.
Cytokine ELISA
The content of IL-4, IFN-, IL-5, transforming growth factor-ß1 (TGF-ß1), and IL-10 in culture supernatants was determined by specific sandwich ELISAs. The Ab pairs used were as follows, listed by capture/biotinylated detection Ab (PharMingen): IL-4, BVD4-1D11/BVD6-24G2; IFN-, R4-6A2/XMG1.2; IL-5, TRFK5/TRFK4; IL-10, JES5-2A5/JES5-16E3; TGF-ß1, A75-2.1/A75-3.1. The lower limits of detection for IL-4, IFN-, IL-5, IL-10, and TGF-ß1 were 0.1, 0.2, 0.05, 0.1, and 0.05 ng/ml, respectively.
ELISPOT assay
The frequency of Tg T cells producing IFN- or IL-4 was determined by the ELISPOT technique according to the supplier’s protocol (PharMingen). Following the administration of B10.A DC into Tg mice (see above), CD4 T cells from draining lymph nodes were restimulated ex vivo for 24 h. The viable cells were recovered by passage through a Histopaque 1007 density gradient (Sigma Chemical Co.), washed, serially diluted, and seeded in nitrocellulose-bottomed, 96-well Milititer HA plates (Millipore, Bedford, MA), precoated with anti-IL-4 (BVD4-1D11)- or anti-IFN- (R4-6A2)-capture mAb (5 µg/ml in 0.1 M bicarbonate buffer, pH 8.2, for 24 h at 4°C). The cells were cultured for 20 h at 37°C in 5% CO2. After extensive washing with PBS and Tween-20/PBS, the cytokines captured on the cellulose ester membranes were detected with biotinylated anti-IL-4 (BVD6-24G2) or anti-IFN- (XMG1.2) mAb. Spots, representing single IL-4- or IFN--producing cells were visualized using avidin-peroxidase and BCIP/NBT and were counted using a dissecting microscope. Data represent total number of cytokine-producing cells/105 splenocytes, calculated from the serially diluted samples. No spots were detected in unstimulated cultures without PCCF or in cultures stimulated with an irrelevant antigen [ovalbumin (OVA), 100 µg/ml].
Determination of Ab responses
Specific anti-PCCF Ab responses were determined by ELISA. Briefly, B10.A BM-DC (1x106 cells/ml) were incubated with medium alone, VIP (10–8 M), or PACAP (10–8 M) for 24 h, pulsed with PCCF (5 µM), and inoculated s.c. into the footpads of syngeneic Tg mice. On days 1 and 3, 500 µg PCCF balanced salt solution was injected i.p. On day 10, serum was obtained by cardiac puncture. Maxisorb plates (Millipore) were coated overnight at 4°C with 100 µl soluble PCCF (10 µg/ml) in 0.1 M bicarbonate buffer, pH 9.6, followed by blocking and incubation with serial dilutions of serum for 2 h at 37°C. Biotinylated anti-IgG1 (2.5 µg/ml) and anti-IgG2a (2.5 µg/ml; Serotec, Oxford, UK) were added for 1 h at 37°C. The plates were washed, followed by incubation with streptavidin-horseradish peroxidase, followed by the 2,2-azinobis-(3-ethylbenzothiazoline-6-sulphonate) substrate. A standard curve was constructed for each assay by coating wells with an isotype-specific anti-mouse Ig followed by addition of known concentrations of IgG1 or IgG2a.
Reverse transcriptase-polymerase chain reaction (RT-PCR) for VPAC1, VPAC2, and PAC1
Total RNA was isolated from 1–2 x 107 purified CD11c+ DC cultured at a concentration of 5 x 106 cells/ml for 24 h in the presence or absence of LPS (1 µg/ml) by using the Ultraspec RNA reagent (Biotecx Laboratories, Houston, TX) as recommended by the manufacturer.
Regular RT-PCR
Total RNA (1–2 µg) was reverse-transcribed into cDNA in the presence of 200 units Moloney murine leukemia virus (MMLV)-RT, 40 units RNasin, 1 µg random primers, 0.5 mM deoxy-unspecified nucleoside 5'-triphosphates (dNTPs), 3 µg bovine serum albumin (BSA), and 1x MMLV reaction buffer (Promega, Madison, WI) in a total volume of 30 µl at 42°C for 1 h.
The cDNA were amplified with specific primers. The primers for VPAC1, VPAC2, and PAC1 receptors have the following sequence: VPAC1 sense 5'-CCTTCTTCTCTGAGCGGAAGTACTT-3' and antisense 5'-CCTGCACCTCGCCATTGAGGAAGCAG-3'; VPAC2 sense 5'-GTCAAGGACAGCTGCTCTACTCC-3' and antisense 5'-CCCTGGAAGGAACCAACACATAAC-3'; PAC1 sense 5'-CAAGAAGGAGCAAGCCATGTGC-3' and antisense 5'-CATCGAAGTAATGGGGGAAGGG-3', glyceraldehyde 3-phosphate dehydrogenase (GAPDH) sense 5'-TCCTGCACCACCAACTGCTTAGCC and antisense 5'-GTTCAGCTCTGGGATGACCTTGCC -3'. The expected sizes for the amplified fragments are: 453 bp for VPAC1, 572 bp for VPAC2, 317 bp for PAC1, and 225 bp for GAPDH. Reverse-transcribed cDNA (5 µl) was subjected to PCR in the presence of 0.5 units pyrostase, 1 µM sense and antisense primers, 0.2 mM dNTPs, and polymerase buffer [50 mM Tris-HCl, pH 9.0, 1.5 mM MgCl2, 20 mM (NH4)2SO4, 50 µg/ml BSA]. The PCR conditions were: denaturation 94°C, 45 s; annealing 55°C, 45 s; primer extension 72°C, 90 s for 35 cycles. The PCR products were size-separated on 2% agarose gels and visualized by UV light.
Real-time RT-PCR
Taqman and SYBR Green-based real-time PCR were performed. The specific primers for real-time PCR were designed by using the Primer ExpressTM software from Applied Biosystems (Foster City, CA) and are as follows: VPAC1 forward CTCATCCCTCTGTTCGGAGTTC and reverse CGACGAGTTCGAAGACCATTTT; VPAC2 forward GGACAGCAACTCGCCTCTCT and reverse AGAATGGGCATCCGAATGAC; PAC1 forward GTGAGCGCCCTGAGGTCTT and reverse CCCCATGTCTGTGATCTCCAA; GAPDH forward CCTGCACCACCAACTGCTTA and reverse TCTTCTGGGTGGCAGTGATG.
The probes used in the Taqman experiments were as follows: VPAC1 tetrachloro-6-carboxyfluorescein-TTCCCCGACAACTTTAAGGCCCAGG-carboxytetramethylrhodamine (Tamra); VPAC2 VIC-AAGACACAGGTTGCTGGGACACAAACG-Tamra; PAC1 6-carboxyfluorescein (6FAM)-CGGATCTTCAACCCGGACCAAGTCTG-Tamra; GAPDH 6FAM-CTTTGGCATTGTGGAAGGGCT-Tamra.
Real-time PCR was performed using the ABI PRISM 7900HT sequence detection system (Applied Biosystems), and the cycling conditions used were 95°C for 15 s, 60°C for 1 min for 40 cycles, followed by a melting-point determination or dissociation curve that results in a single peak if the amplification is specific. The expression levels of VPAC1 and VPAC2 in unstimulated DC were determined from the cycle threshold values normalized to GAPHD, using the relative standard curve method. The standard curves for VPAC1 and VPAC2 were derived with brain and 2B4 (T cell hybridoma) cDNA, respectively.
In vivo migration of BM-DC
B10.A BM nonadherent cells (1x106 cells/ml) harvested on day 7 without subsequent, immunomagnetic purification of CD11c+ cells were incubated with medium alone or VIP (10–8 M) for 24 h. After washing, BM-DC (107/ml) were labeled with 5 µM 5(6)-carboxyfluorescein diacetate succinimidyl ester (CFSE; Molecular Probes) for 10 min at 37°C. CFSE-labeled DC (2x106 cells) were injected s.c. into the footpads of syngeneic, PCCF-specific Tg mice. On day 2, 500 µg PCCF balanced salt solution was injected i.p., and 2 days later, cells from the popliteal, mesenteric, and brachial lymph nodes were isolated and labeled with PE–anti-CD11c Ab as described above. The presence of transferred CFSE-labeled DC in the lymph nodes was detected by flow cytometry.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
|
|
. In contrast, VIP/PACAP-treated iDC induced Th2-type cytokines (IL-4, IL-10, IL-5) and much less IFN- compared with the medium control (Fig. 3D)
. Neither treatment induced detectable TGF-ß levels.
The effects of VIP on CD80/CD86 expression and T cell proliferation are mediated through VPAC1
The involvement of VPAC1/VPAC2 in the effects of VIP on iDC and LPS-stimulated DC was investigated by using receptor agonists and antagonists. The VPAC1 agonist mimicked the effects of VIP on CD80/CD86 expression and induction of syngeneic T cell proliferation for iDC and LPS-treated DC. The VPAC1 antagonist reversed the effects of VIP (Fig. 4
). In contrast, the PAC1 agonist was completely devoid of activity, and the VPAC2 agonist had only marginal effects. As expected, the PAC1/VPAC2 antagonist did not reverse the effects of VIP (Fig. 4)
. Therefore, VPAC1 is the major mediator for the effects of VIP in iDC and LPS-treated DC.
|
-producing T cells (Fig. 5C
and 5D)
. The Th2 bias was confirmed by the fact that PCCF-specific Ab from the serum of animals that received the VIP/PACAP-treated DC were predominantly of the IgG1 type (Fig. 5E) .
|
|
and IL-2 (Fig. 7C)
. If the DC were treated with LPS plus VIP or PACAP, IL-2 and IFN- production was significantly decreased without significant changes in the Th2 cytokines (IL-4, IL-5, IL-10) or in TGF-ß1 (Fig. 7C) .
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Three VIP/PACAP receptors have been cloned, i.e., VPAC1 and VPAC2 binding VIP and PACAP with equal affinity and PAC1, the PACAP-preferring receptor [17 ]. Immune cells differ in the expression of these receptors (reviewed in refs. [13 , 19 ]). Macrophages, primary and cell lines, express VPAC1 and PAC1 constitutively and VPAC2, following LPS stimulation. In contrast, CD4+ T cells express VPAC1 and VPAC2 but no PAC1, and the expression of VPAC1 and -2 is regulated during T cell activation and differentiation. Little is known about VIP/PACAP receptor expression on DC. With the exception of Langerhans cells, which respond to VIP treatment by an increase in intracellular cyclic adenosine monophosphate and express VPAC1 and -2 but no PAC1 mRNA [9 , 20 ], no other DC subtype has been characterized in terms of VIP/PACAP receptors. Our study is the first to report that similar to Langerhans cells, BM-DC express VPAC1 and VPAC2 but no PAC1 mRNA. Real-time RT-PCR indicates that VPAC1 expression is prevalent in DC, and VPAC1 is the major mediator for the effect of VIP on iDC and LPS-stimulated DC. This is similar to macrophages/microglia and different from T cells, where VPAC2 is the major functional receptor (reviewed in refs. [13 , 19 ]).
The LPS treatment of iDC results in an increase in the expression of the stimulatory (MHC II) and costimulatory (CD40, CD80, CD86) molecules. VIP/PACAP, added at the time of LPS stimulation, prevents the up-regulation of CD80 and CD86 expression but not of CD40 or MHC II. These results are similar to our previous findings with peritoneal macrophages [21
]. As reported for macrophages, VIP and PACAP reduce the stimulatory activity of LPS-treated DC for allogeneic and syngeneic T cells. LPS-stimulated DC induce the preferential production of the Th1-type cytokines IFN- and IL-2. VIP/PACAP treatment significantly reduces the amounts of IFN- and IL-2, without affecting the levels of the Th2-type cytokines IL-4 and IL-5 or of the cytokines associated with certain types of regulatory T cells, i.e., IL-10 and TGF-ß1. These results are in agreement with the previously reported anti-inflammatory activity of these neuropeptides and with their proposed role as endogenous immune deactivators.
However, VIP and PACAP have an opposite effect on iDC. They up-regulate CD86 expression, reminiscent of their effect on resting macrophages [21 ], and VIP/PACAP-treated iDC acquire the capacity to stimulate the proliferation of antigen-specific T cells in vivo and in vitro. It is interesting that the VIP/PACAP-treated iDC also acquire the capacity to bias the CD4+ T cell response in favor of Th2 effectors. This is associated in vivo with the predominant production of specific Ab belonging to the IgG1 subclass and a reduction in the IgG2a subclass. The fact that VIP and PACAP induce iDC to promote Th2 responses is in agreement with previous observations. We reported previously that VIP and PACAP induce Th2 responses in vivo, preferentially protect Th2 effectors from antigen-induced apoptosis, and promote the in vivo generation of Th2 memory cells [22 , 23 ]. In addition, the role of the VPAC2 receptor and of the endogenous, Th2-derived VIP for the Th1/Th2 balance in vivo and in vitro was demonstrated in a series of recent studies that confirmed the essential role of VIP/VPAC2 interactions in inducing and maintaining the Th2 bias [24 25 26 ]. The induction of Th2-type responses, in association with the suppression of acute, proinflammatory Th1-type responses, is in agreement with the proposed anti-inflammatory activity of the VIP and PACAP.
The differential effect of VIP/PACAP on activated versus iDC is not limited to CD86 and not unique for VIP/PACAP. Dunzendorfer et al. [16
] showed that VIP and CGRP induce chemotaxis in iDC with the same potency as CCL5 (a ligand for CCR5 expressed on iDC), whereas inhibiting chemotaxis of activated DC toward CCL19/21 (ligands for CCR7 expressed on mDC). Similar to VIP and PACAP, atrial natriuretic peptide (ANP) induces CD86 but not CD80 or CD40 on human monocyte-derived DC and inhibits the stimulation of T cell proliferation by LPS-treated DC [27
]. Moreover, ANP induces a Th2 bias, by reducing the number of IFN-- and increasing the number of IL-4-producing T cells.
Therefore, we propose that VIP and PACAP and possibly other endogenous peptides regulate the immune response through different mechanisms. In the absence of a strong, pathogenic challenge, VIP/PACAP promotes Th2-type responses that could confer protection through Ab production, without eliciting acute inflammation. This might be particularly suitable for immune-privileged sites, where acute, inflammatory processes could lead to irreversible damage. The Th2-induced bias by VIP/PACAP is probably mediated through a combination of effects on DC, macrophages, and directly on the Th2 effectors. In contrast, in the presence of strong, pathogenic challenges, mimicked in vitro by LPS, the major immune function of neuropeptides such as VIP, PACAP, CGRP, and -MSH is anti-inflammatory in nature. The neuropeptides inhibit the production of cytokines and chemokines from major, proinflammatory cells, i.e., macrophages and central nervous system microglia, and reduce the capacity of DC to stimulate T cell proliferation, primarily by preventing and/or reducing the expression of costimulatory molecules. In addition, we cannot exclude the possibility that by reducing the expression of costimulatory molecules on DC, neuropeptides such as VIP and PACAP also contribute to the generation of regulatory T cells.
|
ACKNOWLEDGEMENTS |
|---|
Received December 10, 2003; revised February 4, 2004; accepted February 6, 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
in inducing human dendritic cell maturation J. Immunol. 163,3071-3075This article has been cited by other articles:
|
|
 |
|
  W. H. Wheat, K. E. Pauken, R. V. Morris, and R. G. Titus Lutzomyia longipalpis Salivary Peptide Maxadilan Alters Murine Dendritic Cell Expression of CD80/86, CCR7, and Cytokine Secretion and Reprograms Dendritic Cell-Mediated Cytokine Release from Cultures Containing Allogeneic T Cells J. Immunol., June 15, 2008; 180(12): 8286 - 8298. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Mascanfroni, M. d. M. Montesinos, S. Susperreguy, L. Cervi, J. M. Ilarregui, V. D. Ramseyer, A. M. Masini-Repiso, H. M. Targovnik, G. A. Rabinovich, and C. G. Pellizas Control of dendritic cell maturation and function by triiodothyronine FASEB J, April 1, 2008; 22(4): 1032 - 1042. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Gonzalez-Rey, P. Anderson, and M. Delgado Emerging roles of vasoactive intestinal peptide: a new approach for autoimmune therapy Ann Rheum Dis, November 1, 2007; 66(suppl_3): iii70 - iii76. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Fabricius, M. S. O'Dorisio, S. Blackwell, and B. Jahrsdorfer Human Plasmacytoid Dendritic Cell Function: Inhibition of IFN-{alpha} Secretion and Modulation of Immune Phenotype by Vasoactive Intestinal Peptide J. Immunol., November 1, 2006; 177(9): 5920 - 5927. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Roosterman, T. Goerge, S. W. Schneider, N. W. Bunnett, and M. Steinhoff Neuronal control of skin function: the skin as a neuroimmunoendocrine organ. Physiol Rev, October 1, 2006; 86(4): 1309 - 1379. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Gonzalez-Rey, A. Chorny, A. Fernandez-Martin, D. Ganea, and M. Delgado Vasoactive intestinal peptide generates human tolerogenic dendritic cells that induce CD4 and CD8 regulatory T cells Blood, May 1, 2006; 107(9): 3632 - 3638. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Arimura, M. Li, V. Batuman, W.F. Clark, A.K. Stewart, G.A. Rock, M. Sternbach, D.M. Sutton, B.J. Barrett, A.P. Heidenheim, et al. Cast Nephropathy in Myeloma--Does PACAP38, a New Member of the Vasoactive Intestinal Peptide Family, Open a Therapeutic Window?: Potential Protective Action of Pituitary Adenylate Cyclase-Activiating Polypeptide (PACAP38) on In Vitro and In Vivo Models of Myeloma Kidney Injury. Blood 107: 661-668, 2006 J. Am. Soc. Nephrol., April 1, 2006; 17(4): 911 - 919. [Full Text] [PDF]
|
|
|
|
|
|
V. Sharma, M. Delgado, and D. Ganea Granzyme B, a New Player in Activation-Induced Cell Death, Is Down-Regulated by Vasoactive Intestinal Peptide in Th2 but Not Th1 Effectors J. Immunol., January 1, 2006; 176(1): 97 - 110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Delgado, E. Gonzalez-Rey, and D. Ganea The Neuropeptide Vasoactive Intestinal Peptide Generates Tolerogenic Dendritic Cells J. Immunol., December 1, 2005; 175(11): 7311 - 7324. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Chorny, E. Gonzalez-Rey, A. Fernandez-Martin, D. Pozo, D. Ganea, and M. Delgado Vasoactive intestinal peptide induces regulatory dendritic cells with therapeutic effects on autoimmune disorders PNAS, September 20, 2005; 102(38): 13562 - 13567. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kodali, W. Ding, J. Huang, K. Seiffert, J. A. Wagner, and R. D. Granstein Vasoactive Intestinal Peptide Modulates Langerhans Cell Immune Function J. Immunol., November 15, 2004; 173(10): 6082 - 6088. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. POZO and M. DELGADO The many faces of VIP in neuroimmunology: a cytokine rather a neuropeptide? FASEB J, September 1, 2004; 18(12): 1325 - 1334. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||
