Originally published online as doi:10.1189/jlb.0903421 on March 12, 2004
Published online before print March 12, 2004
(Journal of Leukocyte Biology. 2004;75:1079-1085.)
© 2004
by Society for Leukocyte Biology
MCP-1-dependent signaling in CCR2/ aortic smooth muscle cells
Alison D. Schecter*,1,
Adriane B. Berman*,
Lin Yi*,
Harry Ma
,
Christine M. Daly
,
Kenzo Soejima
,
Barrett J. Rollins
,
Israel F. Charo
and
Mark B. Taubman*,2
* The Cardiovascular Institute, Department of Medicine, The Mount Sinai School of Medicine, New York, New York;
The Dana Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts;
Departments of Pathology and Physiology and Biophysics, Albert Einstein College of Medicine, Bronx, New York; and
Gladstone Institute of Cardiovascular Disease and the Cardiovascular Research Institute, Department of Medicine, University of California, San Francisco
1 Correspondence: Box 1030, Mount Sinai School of Medicine, One Gustave L. Levy Place, New York, NY 10029. E-mail: alison.schecter{at}mssm.edu
 |
ABSTRACT
|
|---|
Monocyte chemoattractant protein-1 (MCP-1, CCL2) is a mediator of inflammation that has been implicated in the pathogenesis of a wide variety of human diseases. CCR2, a heterotrimeric G-coupled receptor, is the only known receptor that functions at physiologic concentrations of MCP-1. Despite the importance of CCR2 in mediating MCP-1 responses, several recent studies have suggested that there may be another functional MCP-1 receptor. Using arterial smooth muscle cells (SMC) from CCR2/ mice, we demonstrate that MCP-1 induces tissue-factor activity at physiologic concentrations. The induction of tissue factor by MCP-1 is blocked by pertussis toxin and 1,2-bis(O-aminophenyl-ethane-ethan)-N,N,N',N'-tetraacetic acid-acetoxymethyl ester, suggesting that signal transduction through the alternative receptor is G
i-coupled and dependent on mobilization of intracellular Ca2+. MCP-1 induces a time- and concentration-dependent phosphorylation of the mitogen-activated protein kinases p42/44. The induction of tissue factor activity by MCP-1 is blocked by PD98059, an inhibitor of p42/44 activation, but not by SB203580, a selective p38 inhibitor. These data establish that SMC possess an alternative MCP-1 receptor that signals at concentrations of MCP-1 that are similar to those that activate CCR2. This alternative receptor may be important in mediating some of the effects of MCP-1 in atherosclerotic arteries and in other inflammatory processes.
Key Words: chemokine tissue factor vascular smooth muscle receptors genetically altered mice kinases
 |
INTRODUCTION
|
|---|
Monocyte chemoattractant protein-1 (MCP-1, CCL2) is a low molecular weight CC chemokine secreted by endothelial cells [1
], smooth muscle cells (SMC) [2
], monocyte/macrophages [3
], and fibroblasts [4
]. MCP-1 has been implicated in a variety of inflammatory processes, including inflammatory bowel disease [5
], rheumatoid arthritis [6
], asthma [7
], nephritis [8
], and parasitic [9
] and viral infections [10
], and in atherosclerosis [11
]. As atherosclerosis is a leading cause of morbidity and mortality in developed countries [12
, 13
], considerable focus has been placed on the role of MCP-1 in mediating monocyte/macrophage accumulation in developing atherosclerotic plaques [14
, 15
]. MCP-1 is found in abundance in macrophage-derived foam cells and in intimal SMC of atherosclerotic plaques [15
16
17
18
] and is rapidly induced in arterial SMC by balloon injury [19
]. Gu and colleagues [20
], who showed that in the low-density lipoprotein receptor-deficient model of atherosclerosis, MCP-1/ mice developed smaller lesions than control mice, provided direct evidence that MCP-1 plays an important role in atherogenesis. Similar results were obtained in the apoB-transgenic model of dietary-dependent atherosclerotic lesion formation [21
]. These studies underscore the critical role of MCP-1 in the development of atherosclerosis.
MCP-1 binds with high affinity to CCR2, a member of the pertussis toxin-sensitive family of G-protein-coupled receptors, which bind CC chemokines [22
]. Two alternatively spliced forms of CCR2, CCR2A and -B, have been identified and have been shown to have similar activity [23
]. CCR2 is expressed on monocytes [24
], basophils [25
], activated T cells [26
], natural killer cells [27
], dendritic cells [28
], and endothelial cells [29
]. The physiologic importance of CCR2 has been highlighted by studies using ApoE//CCR2/ mice [30
]. Like the MCP-1/ mice, these animals display a marked reduction in atherosclerotic lesion formation and macrophage accumulation. Although several other CC chemokine receptors have been found to bind MCP-1, none appear to function at physiologic concentrations of the ligand. For example, CCR1 binds MCP-1, but the concentration of MCP-1 required to induce Ca2+ flux is 10100 times higher than that needed to activate CCR2 [31
].
Despite the importance of CCR2 as a physiologic MCP-1 receptor and the similarities of the CCR2/ and MCP-1/ mice in models of atherosclerosis, important differences between the MCP-1/ and CCR2/ animals have also been described. First, CCR2/ mice have a marked impairment in interferon-
(IFN-
) production after immunization [32
], whereas MCP-1/ mice have a deficiency in the production of T helper cell type 2 cytokines and have normal IFN-
production [33
]. Second, CCR2/ mice have a decrease in granuloma formation in response to immunization with the purified protein derivative of Mycobaterium tuberculosis [32
] and are more susceptible to lethal infection by live tuberculosis mycobacteria than wild-type (WT) controls (I. F. Charo, unpublished observations). In contrast, MCP-1/ mice were indistinguishable from WT MCP-1+/+ mice in their ability to clear M. tuberculosis and like the WT, displayed an increase in IFN-
secretion in response to infection [34
]. One explanation for these differences is that other chemokines, such as MCP-3 and MCP-5, are known to signal through CCR2 [35
]. In addition, there has also been evidence for a functional MCP-1 receptor other than CCR2. Heesen et al. [36
] reported that subnanomolar concentrations of MCP-1 specifically induced mouse astrocyte chemotaxis; however, reverse transcriptase-polymerase chain reaction (RT-PCR) failed to detect CCR2 mRNA in the astrocytes. Similarly, we have reported that low concentrations of MCP-1 induced tissue factor (TF) mRNA and activity in human aortic SMC [37
] in the absence of detectable CCR2 mRNA.
Given the compelling data implicating MCP-1 in atherosclerosis and other inflammatory processes, it is important to establish whether cells can respond to physiologic concentrations of MCP-1 in the absence of CCR2. To address this question, we established SMC cultures from CCR2/ and CCR2+/+ littermates. We now report that incubation with MCP-1 induced a marked increase in TF activity in CCR2/ and CCR2+/+ SMC. The increase in TF activity was dependent on activation of p42/44 mitogen-activated protein kinase (MAPK), involved mobilization of intracellular Ca2+, and was blocked by preincubation with pertussis toxin. These results provide the first definitive evidence for CCR2-independent responses to MCP-1.
 |
MATERIALS AND METHODS
|
|---|
Growth factors and other reagents
Recombinant murine MCP-1 was purchased from R & D Systems (Minneapolis, MN, Catalog #479-JE-010). Fetal bovine serum (FBS) and platelet-derived growth factor (PDGF) were obtained from Sigma Chemical Co. (St. Louis, MO). Pertussis toxin was obtained from LIST Biological Laboratories (Campbell, CA.). PD 98059, SB203580, and 1,2-bis(O-aminophenyl-ethane-ethan)-N,N,N',N'-tetraacetic acid-acetoxymethyl ester (BAPTA/AM) were purchased from Calbiochem (San Diego, CA). Collagenase type II was purchased from Worthington Biochemical (Freehold, NJ).
Cell culture
Aortic SMC were prepared by enzyme digestion from CCR2/ [30
] and CCR2+/+ littermates as described previously [38
]. Cells were grown in Dulbeccos modified Eagles medium (DMEM), supplemented with 10% FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin and serially passaged before reaching confluence. Cells were identified as smooth muscle by their typical appearance on light microscopy and by immunostaining with a monoclonal antibody to mouse smooth muscle
-actin (Clone 1A4 1:100, Sigma Chemical Co.). Experiments were performed on cells from passages 310.
PCR and RT-PCR
Total RNA was isolated from SMC as described previously [39
]. Primer pairs common to both splice variants were generated from the 3'-untranslated end of murine CCR2 mRNA (nt 13451598) [36
]: 5' GGTCCATGATCCCTATGTGG 3' (sense) and 5' CTGGGCACCTGATTTAAAGG 3' (antisense). For RT-PCR, the Titan One Tube RT-PCR system from Roche (Mannheim, Germany) was used, per the manufacturers instructions. An initial incubation was performed at 50°C for 30 min. This was followed by 35 cycles of 30 s at 94°C, 60 s at 53°C, 60 s at 72°C, and a final incubation for 10 min at 72°C. PCR reactions were performed under the following cycling conditions: initial incubation at 94°C for 2 min, followed by 39 cycles of 30 s at 94°C, 30 s at 55°C, 60 s at 72°C, and a final incubation for 10 min at 72°C. As a control for the quality of the RNA, RT-PCR was also performed with primers derived from the murine ß-actin mRNA from Stratagene (La Jolla, CA, Catalog #302110-14).
Determination of TF activity (factor Xa generation)
SMC grown in 10% FBS were placed in 0.3% FBS 24 h before treatment. MCP-1 was added directly to the plates, and TF activity was measured 4 h after treatment. In some experiments, BAPTA/AM (10 µM), PD98059 (20 µM), SB203580 (20 µM), or pertussis toxin (100 ng/ml) was added to the culture 1 h or 3 h (for pertussis toxin) before treatment with MCP-1. To measure TF activity, cells were washed twice and then lysed in 15 mM octyl-ß-D-glycopyranoside (final concentration). Human factors VIIa and X were then added sequentially to cell lysates as described previously [40
]. Aliquots (40 µl) were taken every 2 min for 6 min and placed in a 96-well plate containing 100 µl Bicine buffer (pH 8.5, 1 g/l BSA, and 25 mM EDTA) to stop the reaction. Factor Xa was assayed by adding 25 µl 2 mM Spectrozyme® to each well and measuring the changes in absorption at 405 nm at 35°C in an enzyme-linked immunosorbent assay plate reader (Tmax, Molecular Devices, Menlo Park, CA). The concentration of factor Xa was calculated from the slope of the absorption over time.
Analysis of p42/44 MAPK activity
SMC were cultured and treated as described above for the measurement of TF activity. At the times indicated, cells were washed twice in ice-cold phosphate-buffered saline and harvested in buffer containing 62.5 mM Tris-HCl (pH 6.8), 2% (w/v) sodium dodecyl sulfate (SDS), 50 mM dithiothreitol, and 10% (w/v) glycerol. SDS-polyacrylamide gel electrophoresis (PAGE), transfer to nitrocellulose, and detection of p42/44 and phospho-p42/44 MAPK were performed as described [41
, 42
]. Antibodies to p42/44 MAPK and phospho-p42/44 MAPK (Thr183/Tyr185; Cell Signaling Technology, Beverly, MA) were used at concentrations recommended, per the manufacturers protocol.
Statistics
All studies were performed two or three times using duplicate plates. Values are presented as the mean ± SD. The Students t-test was used in the analysis of unpaired means, and P < 0.05 was considered significant.
 |
RESULTS
|
|---|
Analysis of CCR2 mRNA and DNA in mouse SMC
To establish that mouse aortic SMC do not possess CCR2 mRNA, RT-PCR was performed with CCR2-specific primers [43
]. As shown in Figure 1
, no signal was detected with RNA from CCR2+/+ or CCR2/ mice. In contrast, a signal of the appropriate size was detected with RNA from mouse spleen. All three RNAs generated a positive signal with primers for mouse ß-actin.

View larger version (45K):
[in this window]
[in a new window]
|
Figure 1. Analysis of CCR2 mRNA in CCR2+/+ and CCR2/ SMC. RT-PCR was performed using 2 µg total RNA from CCR2+/+ SMC (lanes 13), CCR2/ SMC (lanes 46), and murine (CCR2+/+ C57Bl/6) spleen (lanes 79). Samples were amplified using primer pairs specific for murine CCR2 mRNA (lanes 1, 2, 4, 5, 7, and 8; band size=254 bp) or ß-actin (lanes 3, 6, and 9; band size=514 bp). In lanes 2, 5, and 8, the RT was omitted.
|
|
MCP-1 induces TF activity in CCR2/ SMC
SMC were treated with increasing concentrations of MCP-1 and assayed for cellular TF activity. As shown in Figure 2
, MCP-1 induced TF activity in SMC cultured from CCR2/ and CCR2+/+ mice. The concentration curves for TF induction were identical for WT and knockout SMC and are typical of those reported for other MCP-1-mediated effects [44
].

View larger version (22K):
[in this window]
[in a new window]
|
Figure 2. MCP-1 induces TF activity in CCR2+/+ and CCR2/ SMC, which at 80% confluence, were incubated in 0.3% FBS for 24 h. Cells were then treated for 4 h with MCP-1 at the concentrations indicated. TF activity (factor Xa generation) was measured from cells lysed in detergent. Values represent the average ± SD from three experiments performed on duplicate plates. *,P < 0.001 compared with untreated cells.
|
|
MCP-1-mediated induction of TF activity in CCR2/ SMC is dependent on p42/44 MAPK
The induction of TF in CCR2/ by low concentrations of MCP-1 suggests the presence of a receptor that binds MCP-1 with high affinity in SMC. To determine whether this receptor shares characteristics of other CC chemokine receptors, CCR2/ SMC were exposed to pertussis toxin before MCP-1 treatment. Pertussis toxin blocked the increase in TF activity (Fig. 3
), suggesting that the receptor mediating the response to MCP-1 is G
i protein-coupled. Pretreatment with BAPTA/AM to chelate intracellular Ca2+ also blocked the increase in TF activity, demonstrating that induction of TF involves intracellular Ca2+ mobilization.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 3. Signaling pathways involved in the induction of TF activity by MCP-1. SMC were incubated in 0.3% FBS for 24 h to achieve quiescence. Cells from CCR2/ or CCR2+/+ mice were then treated with 1 ng/ml MCP-1 alone or after pretreatment with 100 ng/ml pertussis toxin (PT), 10 µM BAPTA/AM (BAPTA), 20 µM PD98059 (PD), or 20 µM SB203580 (SB). All pretreatments were for 1 h, except for pertussis toxin, which was 3 h. TF activity (pM factor Xa generation) was measured from cell lysates harvested 4 h after treatment with MCP-1. Control cells were treated for 4 h with DMEM. For comparison, cells were also treated for 4 h with 10 ng/ml PDGF (*, P<0.001, compared with cells treated with MCP-1 alone). Inset: SMC were treated as above with the indicated concentrations of PD (average of two experiments).
|
|
The MAPK pathway transduces a variety of extracellular stimuli. p42/44 MAPK is stimulated by growth factors and other mitogenic stimuli, whereas p38 MAPK, c-Jun N-terminal kinases, and Big MAPK are primarily activated by cellular stresses, including proinflammatory cytokines [42
, 45
]. To determine whether the MAPK pathway is activated by MCP-1 in the absence of CCR2, CCR2/ SMC were treated with PD98059, a p42/44 MAPK inhibitor, or SB203580, a p38 MAPK inhibitor, before MCP-1 exposure (Fig. 3)
. PD98059, in a concentration-dependent manner (see inset), inhibited the increase in TF activity, whereas SB203580 did not, indicating that MCP-1-mediated regulation of TF involves activation of p42/44 MAPK. The peak effect occurred at a dose of
2 µM, similar to that shown to maximally inhibit p42/44 MAPK [46
] and other MAPK-dependent processes in SMC [41
, 46
]. In contrast to its lack of effect on TF induction by MCP-1, SB203580 had a marked effect on the induction of TF by stromal-derived factor-1 (SDF-1), whereas PD98059 did not (SDF-1: 1350±150 pM factor Xa; SDF-1+SB203580: 410±60; SDF-1+PD98059: 1200±200), demonstrating that under the conditions used for these experiments, the p38 MAPK inhibitor was active and further establishing the specificity of the two inhbitors. SDF-1 has previously been shown to induce TF in SMC in a p38 but not in a p42/44 MAPK-dependent manner [47
]. To confirm that MCP-1 induced p42/44 MAPK, Western blots were performed with antibodies to the phospho-specific and nonactivated forms of p42/44. MCP-1 caused a time-dependent and concentration-dependent increase in phosphorylated p42/44 MAPK (Fig. 4
). No significant differences in the nonphosphorylated species were noted.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 4. MCP-1-mediated activation of p42/44 MAPK in CCR2/ SMC, which from CCR2/ mice, were incubated in 0.3% FBS for 24 h and then treated with MCP-1. Cellular extracts (10 µg/lane) were resolved by 7.5% SDS-PAGE, transferred to nitrocellulose, and probed with antibodies specific for the phosphorylated extracellular-regulated kinase (pERK) 1/2 and unphosphorylated (ERK1/2) forms of p42/44 MAPK. (A) SMC treated with MCP-1 (1 ng/ml) for the times indicated (min). (B) SMC treated for 15 min with the concentrations of MCP-1 indicated (ng/mL). Gels are representative of three separate experiments performed on different passages of SMC.
|
|
 |
DISCUSSION
|
|---|
MCP-1 is an important mediator of inflammation and has been implicated in numerous pathologic processes. To date, only one receptor, CCR2, has been shown to be involved in the cellular responses to physiologic concentrations of MCP-1. This report demonstrates that MCP-1 induces TF activity and phosphorylation of p42/44 MAPK in SMC derived from CCR2/ mice and thus establishes the ability of MCP-1 to act in the absence of CCR2.
Although originally thought to act solely on cells of leukocyte origin, there is increasing evidence that MCP-1 acts as an agonist for SMC. MCP-1 has been shown to induce TF in human and rat SMC [37
] and interleukin-6 (IL-6) [48
] in human SMC. The induction of TF was dependent on activation of protein kinase C and mobilization of intracellular Ca2+, whereas the induction of IL-6 involved activation of nuclear factor-
B. The effects of MCP-1 on SMC proliferation in vitro remain controversial: Recent studies have demonstrated a stimulatory effect [48
49
50
], whereas earlier studies showed no effect [51
] or an inhibitory effect [52
]. Similarly, the role of CCR2 in mediating the effects of MCP-1 remains unclear. RT-PCR has been used to identify CCR2 mRNA in cultured human SMC in several studies [48
, 53
], whereas we were unable to find CCR2 mRNA in human aortic SMC using the same approach [37
]. This may reflect the vicissitudes of primary SMC culture, which is heterogeneous and represents a spectrum of dedifferentiated phenotypes [54
]. The expression of CCR2 mRNA may be highly regulated and transient under certain culture conditions. Conversely, the sensitivity of RT-PCR would allow mRNA to be detected from a small subset of SMC, possessing a distinct phenotype, or from a group of contaminating cells of non-SMC origin. For this reason, we chose a system in which CCR2 was absent to determine whether SMC could respond to MCP-1 in the absence of CCR2.
The mechanism underlying the response to MCP-1 in the absence of CCR2 remains to be determined. The peak increase in TF activity in CCR2/ SMC occurs at MCP-1 concentrations of 0.110 ng/ml. These concentrations are thought to be present under physiologic conditions and are similar to those previously shown to activate CCR2 [55
]. This is in contrast to the activation of other known chemokine receptors, such as CCR1 [31
] and CCR11 [56
], by MCP-1, which occurs at concentrations several logs higher. Dose responses to MCP-1 with respect to TF generation in CCR2+/+ and CCR2/ SMC are identical, as are the responses to inhibitors of intracellular signaling. These data, taken together with the absence of CCR2 mRNA in CCR2+/+ SMC, suggest that the receptor(s) responding to MCP-1 is present at similar density on WT and CCR2-deficient mice and that the absence of CCR2 does not induce novel MCP-1 binding sites. The decrease in TF activity at higher MCP-1 concentrations is typical of that found for CC chemokines and may be secondary to the generation of inactive dimers [57
]. Treatment with pertussis toxin completely abolished the increase in TF activity, suggesting that the response is mediated via a G
i-coupled receptor. BAPTA/AM also completely blocked the increase in TF activity, suggesting that this receptor signals in part through mobilization of intracellular Ca2+. These responses are typical of members of the family of seven spanning CC chemokine receptors [58
] and suggest that a member of this family mediates the response of SMC to MCP-1.
We have previously demonstrated specific binding of MCP-1 to human aortic SMC [37
]. The derived dissociation constant was
1.0 nM, comparable with the affinity of MCP-1 for human monocytes [44
] or for cells transfected with CCR2 [22
, 44
]. Using the same methodology, we were unable to obtain specific binding of murine MCP-1 to mouse SMC. In addition, using fluorescent microscopy, we were unable to identify CCR2 binding on murine SMC monolayers using biotinylated MCP-1 followed by fluorescein-conjugated avidin as described [59
]. There are several possible reasons for this result. First, binding assays using SMC are often complicated by the presence of nonspecific or high background binding, as illustrated in our previous work with human SMC [37
]. This may be a result, in part, of the necessity of performing these experiments with cells adherent to plastic, rather than in suspension; it is likely that much of the nonspecific binding is to exposed matrix proteins. Second, it is possible that the number of receptors per cell is low. The total number of MCP-1 receptors on monocytes is
3000 [44
], which would be very difficult to detect given the limited number of SMC on a confluent dish. Finally, the dissociation constant may not be in the low nanomolar range and would thus require other techniques to determine.
There are several mechanisms by which the response to MCP-1 would not involve direct binding to an alternative MCP-1 receptor. One would depend on heterodimerization of MCP-1 with another chemokine, such as has been shown to occur for macrophage inflammatory protein (MIP)-1
and -ß [60
]. Such a heterodimer could have modified activity and induce TF by activating another chemokine receptor. SMC have been shown to synthesize a variety of chemokines and to possess chemokine receptors, such as CCR5 [61
] and CCR8 [62
]. It is also possible that MCP-1 is altered in the culture medium and could thus activate another chemokine receptor to which it does not normally bind. In that regard, it should be noted that MCP-1 normally secreted into the culture medium by SMC retains potent monocyte chemotactic activity that can be completely inhibited with antibodies to MCP-1 [63
]. One additional possibility is the presence of a contaminant, such as bacterial endotoxin lipopolysaccharide (LPS), in the MCP-1 preparation. We have previously demonstrated that polymyxin B, an inhibitor of LPS, did not block the induction of TF by MCP-1 and in addition, that MCP-1 did not induce TF in endothelial cells, which are very responsive to LPS [37
]. In addition, the concentrations of MCP-1 necessary to activate SMC in this and other studies are within the usual range for MCP-1-mediated responses, further arguing against a contaminant being responsible.
The current study focused on the measurement of TF activity. TF is the principal initiator of the clotting cascade and is considered to be a major regulator of hemeostasis and thrombosis [64
]. TF binds factor VII/VIIa, and the resulting complex acts as a catalyst for the conversion of factors IX and X to IXa and Xa, respectively. Like MCP-1, TF is induced in the SMC of the injured arterial wall and is abundant in macrophages and intimal SMC of the atherosclerotic plaque [65
]. Thrombosis associated with rupture of vulnerable atherosclerotic plaques is considered the major cause of myocardial infarction and unstable coronary syndromes [66
]. The exposure of TF to circulating blood as a consequence of plaque rupture is thought to play a critical role in initiating thrombotic coronary occlusions [67
]. By virtue of its ability to induce TF in SMC and macrophages, MCP-1 may be a major contributor to the procoagulant state of atherosclerotic arteries.
Another feature of MCP-1-mediated signaling in SMC is the activation of p42/44 MAPK, which are a family of ubiquitously expressed protein kinases involved in cell growth, transformation, differentiation, and apoptosis [41
]. MAPK are part of specific kinase cascades whose downstream substrates include other kinases and cytoplasmic and nuclear proteins involved in transcription. Although the activation of MAPK pathways by CC chemokines has not been examined in detail, p42/44 MAPK has been shown to be induced by MCP-1 in Chinese hamster ovary cells expressing CCR2 and to be involved in MCP-1-mediated monocyte chemotaxis [68
]. The p42/44 MAPK has also been implicated in MIP-3
[69
], MIP-2 [70
], and MIP-1ß [71
] signaling. In the present study, the increase in TF activity was completely blocked by an inhibitor of p42/44 MAPK, suggesting that this pathway is essential for MCP-1-mediated TF induction. Given the involvement of MAPK pathways in regulating many aspects of SMC biology (reviewed in refs. [41
, 72
, 73
]), it is likely that effects of MCP-1 on SMC will be protean and not limited to the regulation of TF.
In summary, we have used CCR2/ mice to provide definitive evidence for CCR2-independent MCP-1 signaling. MCP-1 has been implicated in the genesis of many pathologic syndromes. The presence of CCR2-independent MCP-1 responses may thus have important implications for the pathogenesis and treatment of a variety of human diseases. In particular, it raises the possibility that antagonists to CCR2, currently in development, may not be sufficient to neutralize all of the effects of MCP-1.
 |
ACKNOWLEDGEMENTS
|
|---|
This work was supported in part by National Institutes of Health Grants HL73458 (A. D. S.), HL29019 (M. B. T.), HL61818 (M. B. T.), HL63894-01 (I. F. C.), and HL52773-07 (I. F. C). H. M. was supported by National Institutes of Health Fellowship T32GM07288.
 |
FOOTNOTES
|
|---|
2 Correspondence at current address: University of Rochester, Box 679CCMC, 601 Elmwood Avenue, Rochester, NY 14642. E-mail: Mark_Taubman{at}URMC.Rochester.edu 
Received September 11, 2003;
revised January 26, 2004;
accepted January 30, 2004.
 |
REFERENCES
|
|---|
- Rollins, B. J., Yoshimura, T., Leonard, E. J., Pober, J. S. (1990) Cytokine-activated human endothelial cells synthesize and secrete a monocyte chemoattractant, MCP-1/JE Am. J. Pathol. 136,1229-1233[Abstract]
- Valente, A. J., Graves, D. T., Vialle-Valentin, C. E., Delgado, R., Schwartz, C. J. (1988) Purification of a monocyte chemotactic factor secreted by nonhuman primate vascular cells in culture Biochemistry 27,4162-4168[CrossRef][Medline]
- Yoshimura, T., Robinson, E. A., Tanaka, S., Appella, E., Leonard, E. J. (1989) Purification and amino acid analysis of two human monocyte chemoattractants produced by phytohemagglutinin-stimulated human blood mononuclear leukocytes J. Immunol. 142,1956-1962[Abstract]
- Strieter, R. M., Wiggins, R., Phan, S. H., Wharram, B. L., Showell, H. J., Remick, D. G., Chensue, S. W., Kunkel, S. L. (1989) Monocyte chemotactic protein gene expression by cytokine-treated human fibroblasts and endothelial cells Biochem. Biophys. Res. Commun. 162,694-700[CrossRef][Medline]
- MacDermott, R. P. (1999) Chemokines in the inflammatory bowel diseases J. Clin. Immunol. 19,266-272[CrossRef][Medline]
- DeVries, M. E., Ran, L., Kelvin, D. J. (1999) On the edge: the physiological and pathophysiological role of chemokines during inflammatory and immunological responses Semin. Immunol. 11,95-104[CrossRef][Medline]
- Ying, S., Meng, Q., Zeibecoglou, K., Robinson, D. S., Macfarlane, A., Humbert, M., Kay, A. B. (1999) Eosinophil chemotactic chemokines (eotaxin, eotaxin-2, RANTES, monocyte chemoattractant protein-3 (MCP-3), and MCP-4), and C-C chemokine receptor 3 expression in bronchial biopsies from atopic and nonatopic (intrinsic) asthmatics J. Immunol. 163,6321-6329[Abstract/Free Full Text]
- Panzer, U., Stahl, R. A. (1999) Chemokines and renal inflammation Nephrologie 20,335-341[Medline]
- Sato, N., Kuziel, W. A., Melby, P. C., Reddick, R. L., Kostecki, V., Zhao, W., Maeda, N., Ahuja, S. K., Ahuja, S. S. (1999) Defects in the generation of IFN-
are overcome to control infection with Leishmania donovani in CC chemokine receptor (CCR) 5-, macrophage inflammatory protein-1
-, or CCR2-deficient mice J. Immunol. 163,5519-5525[Abstract/Free Full Text]
- Dawson, T. C., Beck, M. A., Kuziel, W. A., Henderson, F., Maeda, N. (2000) Contrasting effects of CCR5 and CCR2 deficiency in the pulmonary inflammatory response to influenza A virus Am. J. Pathol. 156,1951-1959[Abstract/Free Full Text]
- Reape, T. J., Groot, P. H. (1999) Chemokines and atherosclerosis Atherosclerosis 147,213-225[CrossRef][Medline]
- Thom, T. J., Epstein, F. H. (1994) Heart disease, cancer, and stroke mortality trends and their interrelations. An international perspective Circulation 90,574-582[Abstract/Free Full Text]
- Frolkis, J. P. (1999) Screening for cardiovascular disease. Concepts, conflicts, and consensus Med. Clin. North Am. 83,1339-1373[CrossRef][Medline]
- Sasayama, S., Okada, M., Matsumori, A. (2000) Chemokines and cardiovascular diseases Cardiovasc. Res. 45,267-269 (editorial; comment)[Free Full Text]
- Yla-Herttuala, S., Lipton, B. A., Rosenfeld, M. E., Sarkioja, T., Yoshimura, T., Leonard, E. J., Witztum, J. L., Steinberg, D. (1991) Expression of monocyte chemoattractant protein 1 in macrophage-rich areas of human and rabbit atherosclerotic lesions Proc. Natl. Acad. Sci. USA 88,5252-5256[Abstract/Free Full Text]
- Yu, X., Dluz, S., Graves, D. T., Zhang, L., Antoniades, H. N., Hollander, W., Prusty, S., Valente, A. J., Schwartz, C. J., Sonenshein, G. E. (1992) Elevated expression of monocyte chemoattractant protein 1 by vascular smooth muscle cells in hypercholesterolemic primates Proc. Natl. Acad. Sci. USA 89,6953-6957[Abstract/Free Full Text]
- Nelken, N. A., Coughlin, S. R., Gordon, D., Wilcox, J. N. (1991) Monocyte chemoattractant protein-1 in human atheromatous plaques J. Clin. Invest. 88,1121-1127
- Takeya, M., Yoshimura, T., Leonard, E. J., Takahashi, K. (1993) Detection of monocyte chemoattractant protein-1 in human atherosclerotic lesions by an anti-monocyte chemoattractant protein-1 monoclonal antibody Hum. Pathol. 24,534-539[CrossRef][Medline]
- Taubman, M. B., Rollins, B. J., Poon, M., Marmur, J., Green, R. S., Berk, B. C., Nadal-Ginard, B. (1992) JE mRNA accumulates rapidly in aortic injury and in platelet-derived growth factor-stimulated vascular smooth muscle cells Circ. Res. 70,314-325[Abstract/Free Full Text]
- Gu, L., Okada, Y., Clinton, S. K., Gerard, C., Sukhova, G. K., Libby, P., Rollins, B. J. (1998) Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice Mol. Cell 2,275-281[CrossRef][Medline]
- Gosling, J., Slaymaker, S., Gu, L., Tseng, S., Zlot, C. H., Young, S. G., Rollins, B. J., Charo, I. F. (1999) MCP-1 deficiency reduces susceptibility to atherosclerosis in mice that overexpress human apolipoprotein B J. Clin. Invest. 103,773-778[Medline]
- Charo, F. I., Myers, J. S., Herman, A., Franci, C., Connolly, J. A., Coughlin, R. S. (1994) Molecular cloning and functional expression of two monocyte chemoattractant protein 1 receptors reveals alternative splicing of the carboxyl-terminal tails Proc. Natl. Acad. Sci. USA 91,2752-2756[Abstract/Free Full Text]
- Wong, L. M., Myers, S. J., Tsou, C. L., Gosling, J., Arai, H., Charo, I. F. (1997) Organization and differential expression of the human monocyte chemoattractant protein 1 receptor gene. Evidence for the role of the carboxyl-terminal tail in receptor trafficking J. Biol. Chem. 272,1038-1045[Abstract/Free Full Text]
- Sica, A., Saccani, A., Borsatti, A., Power, C. A., Wells, T. N., Luini, W., Polentarutti, N., Sozzani, S., Mantovani, A. (1997) Bacterial lipopolysaccharide rapidly inhibits expression of C-C chemokine receptors in human monocytes J. Exp. Med. 185,969-974[Abstract/Free Full Text]
- Ochensberger, B., Tassera, L., Bifrare, D., Rihs, S., Dahinden, C. A. (1999) Regulation of cytokine expression and leukotriene formation in human basophils by growth factors, chemokines and chemotactic agonists Eur. J. Immunol. 29,11-22[CrossRef][Medline]
- Ruffing, N., Sullivan, N., Sharmeen, L., Sodroski, J., Wu, L. (1998) CCR5 has an expanded ligand-binding repertoire and is the primary receptor used by MCP-2 on activated T cells Cell. Immunol. 189,160-168[CrossRef][Medline]
- Nieto, M., Navarro, F., Perez-Villar, J. J., del Pozo, M. A., Gonzalez-Amaro, R., Mellado, M., Frade, J. M., Martinez, A. C., Lopez-Botet, M., Sanchez-Madrid, F. (1998) Roles of chemokines and receptor polarization in NK-target cell interactions J. Immunol. 161,3330-3339[Abstract/Free Full Text]
- Sozzani, S., Luini, W., Borsatti, A., Polentarutti, N., Zhou, D., Piemonti, L., DAmico, G., Power, C. A., Wells, T. N., Gobbi, M., Allavena, P., Mantovani, A. (1997) Receptor expression and responsiveness of human dendritic cells to a defined set of CC and CXC chemokines J. Immunol. 159,1993-2000[Abstract]
- Weber, K. S., Nelson, P. J., Grone, H. J., Weber, C. (1999) Expression of CCR2 by endothelial cells: implications for MCP-1 mediated wound injury repair and in vivo inflammatory activation of endothelium Arterioscler. Thromb. Vasc. Biol. 19,2085-2093[Abstract/Free Full Text]
- Boring, L., Gosling, J., Cleary, M., Charo, I. F. (1998) Decreased lesion formation in CCR2/ mice reveals a role for chemokines in the initiation of atherosclerosis Nature 394,894-897[CrossRef][Medline]
- Neote, K., DiGregorio, D., Mak, J. Y., Horuk, R., Schall, T. J. (1993) Molecular cloning, functional expression, and signaling characteristics of a C-C chemokine receptor Cell 72,415-425[CrossRef][Medline]
- Boring, L., Gosling, J., Chensue, S. W., Kunkel, S. L., Farese, R. V., Jr, Broxmeyer, H. E., Charo, I. F. (1997) Impaired monocyte migration and reduced type 1 (Th1) cytokine responses in C-C chemokine receptor 2 knockout mice J. Clin. Invest. 100,2552-2561[Medline]
- Gu, L., Tseng, S., Horner, R. M., Tam, C., Loda, M., Rollins, B. J. (2000) Control of TH2 polarization by the chemokine monocyte chemoattractant protein-1 Nature 404,407-411[CrossRef][Medline]
- Lu, B., Rutledge, B. J., Gu, L., Fiorillo, J., Lukacs, N. W., Kunkel, S. L., North, R., Gerard, C., Rollins, B. J. (1998) Abnormalities in monocyte recruitment and cytokine expression in monocyte chemoattractant protein 1-deficient mice J. Exp. Med. 187,601-608[Abstract/Free Full Text]
- Warmington, K. S., Boring, L., Ruth, J. H., Sonstein, J., Hogaboam, C. M., Curtis, J. L., Kunkel, S. L., Charo, I. R., Chensue, S. W. (1999) Effect of C-C chemokine receptor 2 (CCR2) knockout on type-2 (schistosomal antigen-elicited) pulmonary granuloma formation: analysis of cellular recruitment and cytokine responses Am. J. Pathol. 154,1407-1416[Abstract/Free Full Text]
- Heesen, M., Tanabe, S., Berman, M. A., Yoshizawa, I., Luo, Y., Kim, R. J., Post, T. W., Gerard, C., Dorf, M. E. (1996) Mouse astrocytes respond to the chemokines MCP-1 and KC, but reverse transcriptase-polymerase chain reaction does not detect mRNA for the KC or new MCP-1 receptor J. Neurosci. Res. 45,382-391[CrossRef][Medline]
- Schecter, A. D., Rollins, B. J., Zhang, Y. J., Charo, I. F., Fallon, J. T., Rossikhina, M., Giesen, P. L., Nemerson, Y., Taubman, M. B. (1997) Tissue factor is induced by monocyte chemoattractant protein-1 in human aortic smooth muscle and THP-1 cells J. Biol. Chem. 272,28568-28573[Abstract/Free Full Text]
- Taubman, M. B. (1993) Tissue factor regulation in vascular smooth muscle: a summary of studies performed using in vivo and in vitro models Am. J. Cardiol. 72,55C-60C[CrossRef][Medline]
- Taubman, M. B., Marmur, J. D., Rosenfield, C. L., Guha, A., Nichtberger, S., Nemerson, Y. (1993) Agonist-mediated tissue factor expression in cultured vascular smooth muscle cells. Role of Ca2+ mobilization and protein kinase C activation J. Clin. Invest. 91,547-552
- Schecter, A. D., Giesen, P. L., Taby, O., Rosenfield, C. L., Rossikhina, M., Fyfe, B. S., Kohtz, D. S., Fallon, J. T., Nemerson, Y., Taubman, M. B. (1997) Tissue factor expression in human arterial smooth muscle cells. TF is present in three cellular pools after growth factor stimulation J. Clin. Invest. 100,2276-2285[Medline]
- Kusuhara, M., Takahashi, E., Peterson, T. E., Abe, J., Ishida, M., Han, J., Ulevitch, R., Berk, B. C. (1998) p38 Kinase is a negative regulator of angiotensin II signal transduction in vascular smooth muscle cells: effects on Na+/H+ exchange and ERK1/2 Circ. Res. 83,824-831[Abstract/Free Full Text]
- De Keulenaer, G. W., Ushio-Fukai, M., Yin, Q., Chung, A. B., Lyons, P. R., Ishizaka, N., Rengarajan, K., Taylor, W. R., Alexander, R. W., Griendling, K. K. (2000) Convergence of redox-sensitive and mitogen-activated protein kinase signaling pathways in tumor necrosis factor-
-mediated monocyte chemoattractant protein-1 induction in vascular smooth muscle cells Arterioscler. Thromb. Vasc. Biol. 20,385-391[Abstract/Free Full Text]
- Kurihara, T., Bravo, R. (1996) Cloning and functional expression of mCCR2, a murine receptor for the C-C chemokines JE and FIC J. Biol. Chem. 271,11603-11607[Abstract/Free Full Text]
- Ernst, C. A., Zhang, Y. J., Hancock, P. R., Rutledge, B. J., Corless, C. L., Rollins, B. J. (1994) Biochemical and biologic characterization of murine monocyte chemoattractant protein-1. Identification of two functional domains J. Immunol. 152,3541-3549[Abstract]
- Jing, Q., Xin, S. M., Zhang, W. B., Wang, P., Qin, Y. W., Pei, G. (2000) Lysophosphatidylcholine activates p38 and p42/44 mitogen-activated protein kinases in monocytic THP-1 cells, but only p38 activation is involved in its stimulated chemotaxis Circ. Res. 87,52-59[Abstract/Free Full Text]
- Graf, K., Xi, X. P., Yang, D., Fleck, E., Hsueh, W. A., Law, R. E. (1997) Mitogen-activated protein kinase activation is involved in platelet-derived growth factor-directed migration by vascular smooth muscle cells Hypertension 29,334-339[Abstract/Free Full Text]
- Schecter, A. D., Berman, A. B., Yi, L., Mosoian, A., McManus, C. M., Berman, J. W., Klotman, M. E., Taubman, M. B. (2001) HIV envelope gp120 activates human arterial smooth muscle cells Proc. Natl. Acad. Sci. USA 98,10142-10147[Abstract/Free Full Text]
- Viedt, C., Vogel, J., Athanasiou, T., Shen, W., Orth, S. R., Kubler, W., Kreuzer, J. (2002) Monocyte chemoattractant protein-1 induces proliferation and interleukin-6 production in human smooth muscle cells by differential activation of nuclear factor-
B and activator protein-1 Arterioscler. Thromb. Vasc. Biol. 22,914-920[Abstract/Free Full Text]
- Porreca, E., Di Febbo, C., Reale, M., Castellani, M. L., Baccante, G., Barbacane, R., Conti, P., Cuccurullo, F., Poggi, A. (1997) Monocyte chemotactic protein 1 (MCP-1) is a mitogen for cultured rat vascular smooth muscle cells J. Vasc. Res. 34,58-65[Medline]
- Selzman, C. H., Miller, S. A., Zimmerman, M. A., Gamboni-Robertson, F., Harken, A. H., Banerjee, A. (2002) Monocyte chemotactic protein-1 directly induces human vascular smooth muscle proliferation Am. J. Physiol. Heart Circ. Physiol. 283,H1455-H1461[Abstract/Free Full Text]
- Watanabe, T., Pakala, R., Katagiri, T., Benedict, C. R. (2001) Monocyte chemotactic protein 1 amplifies serotonin-induced vascular smooth muscle cell proliferation J. Vasc. Res. 38,341-349[CrossRef][Medline]
- Ikeda, U., Okada, K., Ishikawa, S., Saito, T., Kasahara, T., Shimada, K. (1995) Monocyte chemoattractant protein 1 inhibits growth of rat vascular smooth muscle cells Am. J. Physiol. 268,H1021-H1026
- Hayes, I. M., Jordan, N. J., Towers, S., Smith, G., Paterson, J. R., Earnshaw, J. J., Roach, A. G., Westwick, J., Williams, R. J. (1998) Human vascular smooth muscle cells express receptors for CC chemokines Arterioscler. Thromb. Vasc. Biol. 18,397-403[Abstract/Free Full Text]
- Chamley-Campbell, J. H., Campbell, G. R., Ross, R. (1981) Phenotype-dependent response of cultured aortic smooth muscle to serum mitogens J. Cell Biol. 89,379-383[Abstract/Free Full Text]
- Boring, L., Gosling, J., Monteclaro, F. S., Lusis, A. J., Tsou, C. L., Charo, I. F. (1996) Molecular cloning and functional expression of murine JE (monocyte chemoattractant protein 1) and murine macrophage inflammatory protein 1
receptors: evidence for two closely linked C-C chemokine receptors on chromosome 9 J. Biol. Chem. 271,7551-7558[Abstract/Free Full Text]
- Schweickart, V. L., Epp, A., Raport, C. J., Gray, P. W. (2000) CCR11 is a functional receptor for the monocyte chemoattractant protein family of chemokines J. Biol. Chem. 275,9550-9556[Abstract/Free Full Text]
- Zhang, Y., Rollins, B. J. (1995) A dominant negative inhibitor indicates that monocyte chemoattractant protein 1 functions as a dimer Mol. Cell. Biol. 15,4851-4855[Abstract]
- Sozzani, S., Locati, M., Zhou, D., Rieppi, M., Luini, W., Lamorte, G., Bianchi, G., Polentarutti, N., Allavena, P., Mantovani, A. (1995) Receptors, signal transduction, and spectrum of action of monocyte chemotactic protein-1 and related chemokines J. Leukoc. Biol. 57,788-794[Abstract]
- Andjelkovic, A. V., Kerkovich, D., Shanley, J., Pulliam, L., Pachter, J. S. (1999) Expression of binding sites for ß chemokines on human astrocytes Glia 28,225-235[CrossRef][Medline]
- Guan, E., Wang, J., Norcross, M. A. (2001) Identification of human macrophage inflammatory proteins 1
and 1ß as a native secreted heterodimer J. Biol. Chem. 276,12404-12409[Abstract/Free Full Text]
- Schecter, A. D., Calderon, T. M., Berman, A. B., McManus, C. M., Fallon, J. T., Rossikhina, M., Zhao, W., Christ, G., Berman, J. W., Taubman, M. B. (2000) Human vascular smooth muscle cells possess functional CCR5 J. Biol. Chem. 275,5466-5471[Abstract/Free Full Text]
- Harpel, P. C., Haque, N. S. (2002) Chemokine receptor-8: potential role in atherogenesis Isr. Med. Assoc. J. 4,1025-1027[Medline]
- Poon, M., Hsu, W. C., Bogadanov, V. Y., Taubman, M. B. (1996) Secretion of monocyte chemotactic activity by cultured rat aortic smooth muscle cells in response to PDGF is due predominantly to the induction of JE/MCP-1 Am. J. Pathol. 149,307-317[Abstract]
- Nemerson, Y. (1995) Tissue factor: then and now Thromb. Haemost. 74,180-184[Medline]
- Taubman, M. B., Giesen, P. L., Schecter, A. D., Nemerson, Y. (1999) Regulation of the procoagulant response to arterial injury Thromb. Haemost. 82,801-805[Medline]
- Fuster, V., Badimon, L., Badimon, J. J., Chesebro, J. H. (1992) The pathogenesis of coronary artery disease and the acute coronary syndromes (2) N. Engl. J. Med. 326,310-318[Medline]
- Moreno, P. R., Bernardi, V. H., Lopez-Cuellar, J., Murcia, A. M., Palacios, I. F., Gold, H. K., Mehran, R., Sharma, S. K., Nemerson, Y., Fuster, V., Fallon, J. T. (1996) Macrophages, smooth muscle cells, and tissue factor in unstable angina. Implications for cell-mediated thrombogenicity in acute coronary syndromes Circulation 94,3090-3097[Abstract/Free Full Text]
- Yen, H., Zhang, Y., Penfold, S., Rollins, B. J. (1997) MCP-1-mediated chemotaxis requires activation of non-overlapping signal transduction pathways J. Leukoc. Biol. 61,529-532[Abstract]
- Sullivan, S. K., McGrath, D. A., Liao, F., Boehme, S. A., Farber, J. M., Bacon, K. B. (1999) MIP-3
induces human eosinophil migration and activation of the mitogen-activated protein kinases (p42/p44 MAPK) J. Leukoc. Biol. 66,674-682[Abstract]
- Xiao, Y. Q., Someya, K., Morita, H., Takahashi, K., Ohuchi, K. (1999) Involvement of p38 MAPK and ERK/MAPK pathways in staurosporine-induced production of macrophage inflammatory protein-2 in rat peritoneal neutrophils Biochim. Biophys. Acta 1450,155-163[Medline]
- Dairaghi, D. J., Franz-Bacon, K., Callas, E., Cupp, J., Schall, T. J., Tamraz, S. A., Boehme, S. A., Taylor, N., Bacon, K. B. (1998) Macrophage inflammatory protein-1ß induces migration and activation of human thymocytes Blood 91,2905-2913[Abstract/Free Full Text]
- Takahashi, E., Berk, B. C. (1998) MAP kinases and vascular smooth muscle function Acta Physiol. Scand. 164,611-621[Medline]
- Griendling, K. K., Ushio-Fukai, M. (2000) Reactive oxygen species as mediators of angiotensin II signaling Regul. Pept. 91,21-27[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
L. Yahiaoui, D. Gvozdic, G. Danialou, M. Mack, and B. J. Petrof
CC family chemokines directly regulate myoblast responses to skeletal muscle injury
J. Physiol.,
August 15, 2008;
586(16):
3991 - 4004.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Egashira, K. Nakano, K. Ohtani, K. Funakoshi, G. Zhao, Y. Ihara, J.-i. Koga, S. Kimura, R. Tominaga, and K. Sunagawa
Local Delivery of Anti-Monocyte Chemoattractant Protein-1 by Gene-Eluting Stents Attenuates In-Stent Stenosis in Rabbits and Monkeys
Arterioscler. Thromb. Vasc. Biol.,
December 1, 2007;
27(12):
2563 - 2568.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. K. Shireman, V. Contreras-Shannon, O. Ochoa, B. P. Karia, J. E. Michalek, and L. M. McManus
MCP-1 deficiency causes altered inflammation with impaired skeletal muscle regeneration
J. Leukoc. Biol.,
March 1, 2007;
81(3):
775 - 785.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Wareing, A. Lyon, C. Inglis, F. Giannoni, I. Charo, and S. R. Sarawar
Chemokine regulation of the inflammatory response to a low-dose influenza infection in CCR2-/- mice
J. Leukoc. Biol.,
March 1, 2007;
81(3):
793 - 801.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Kruglov, R. A. Nathanson, T. Nguyen, and J. A. Dranoff
Secretion of MCP-1/CCL2 by bile duct epithelia induces myofibroblastic transdifferentiation of portal fibroblasts
Am J Physiol Gastrointest Liver Physiol,
April 1, 2006;
290(4):
G765 - G771.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Kodali, M. Hajjou, A. B. Berman, M. B. Bansal, S. Zhang, J. J. Pan, and A. D. Schecter
Chemokines induce matrix metalloproteinase-2 through activation of epidermal growth factor receptor in arterial smooth muscle cells
Cardiovasc Res,
February 15, 2006;
69(3):
706 - 715.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F Marra
Renaming cytokines: MCP-1, Major Chemokine in Pancreatitis
Gut,
December 1, 2005;
54(12):
1679 - 1681.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. P. de Lema, H. Maier, T. J. Franz, M. Escribese, S. Chilla, S. Segerer, N. Camarasa, H. Schmid, B. Banas, S. Kalaydjiev, et al.
Chemokine Receptor Ccr2 Deficiency Reduces Renal Disease and Prolongs Survival in MRL/lpr Lupus-Prone Mice
J. Am. Soc. Nephrol.,
December 1, 2005;
16(12):
3592 - 3601.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. W. Raines and N. Ferri
Thematic Review Series: The Immune System and Atherogenesis. Cytokines affecting endothelial and smooth muscle cells in vascular disease
J. Lipid Res.,
June 1, 2005;
46(6):
1081 - 1092.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. F. Charo and M. B. Taubman
Chemokines in the Pathogenesis of Vascular Disease
Circ. Res.,
October 29, 2004;
95(9):
858 - 866.
[Abstract]
[Full Text]
[PDF]
|
 |
|