Published online before print March 12, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* The Cardiovascular Institute, Department of Medicine, The Mount Sinai School of Medicine, New York, New York;
The Dana Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts;
Departments of Pathology and Physiology and Biophysics, Albert Einstein College of Medicine, Bronx, New York; and
Gladstone Institute of Cardiovascular Disease and the Cardiovascular Research Institute, Department of Medicine, University of California, San Francisco
1 Correspondence: Box 1030, Mount Sinai School of Medicine, One Gustave L. Levy Place, New York, NY 10029. E-mail: alison.schecter{at}mssm.edu
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
i-coupled and dependent on mobilization of intracellular Ca2+. MCP-1 induces a time- and concentration-dependent phosphorylation of the mitogen-activated protein kinases p42/44. The induction of tissue factor activity by MCP-1 is blocked by PD98059, an inhibitor of p42/44 activation, but not by SB203580, a selective p38 inhibitor. These data establish that SMC possess an alternative MCP-1 receptor that signals at concentrations of MCP-1 that are similar to those that activate CCR2. This alternative receptor may be important in mediating some of the effects of MCP-1 in atherosclerotic arteries and in other inflammatory processes.
Key Words: chemokine • tissue factor • vascular smooth muscle • receptors • genetically altered mice • kinases
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
MCP-1 binds with high affinity to CCR2, a member of the pertussis toxin-sensitive family of G-protein-coupled receptors, which bind C–C chemokines [22 ]. Two alternatively spliced forms of CCR2, CCR2A and -B, have been identified and have been shown to have similar activity [23 ]. CCR2 is expressed on monocytes [24 ], basophils [25 ], activated T cells [26 ], natural killer cells [27 ], dendritic cells [28 ], and endothelial cells [29 ]. The physiologic importance of CCR2 has been highlighted by studies using ApoE–/–/CCR2–/– mice [30 ]. Like the MCP-1–/– mice, these animals display a marked reduction in atherosclerotic lesion formation and macrophage accumulation. Although several other CC chemokine receptors have been found to bind MCP-1, none appear to function at physiologic concentrations of the ligand. For example, CCR1 binds MCP-1, but the concentration of MCP-1 required to induce Ca2+ flux is 10–100 times higher than that needed to activate CCR2 [31 ].
Despite the importance of CCR2 as a physiologic MCP-1 receptor and the similarities of the CCR2–/– and MCP-1–/– mice in models of atherosclerosis, important differences between the MCP-1–/– and CCR2–/– animals have also been described. First, CCR2–/– mice have a marked impairment in interferon-
(IFN-) production after immunization [32
], whereas MCP-1–/– mice have a deficiency in the production of T helper cell type 2 cytokines and have normal IFN- production [33
]. Second, CCR2–/– mice have a decrease in granuloma formation in response to immunization with the purified protein derivative of Mycobaterium tuberculosis [32
] and are more susceptible to lethal infection by live tuberculosis mycobacteria than wild-type (WT) controls (I. F. Charo, unpublished observations). In contrast, MCP-1–/– mice were indistinguishable from WT MCP-1+/+ mice in their ability to clear M. tuberculosis and like the WT, displayed an increase in IFN- secretion in response to infection [34
]. One explanation for these differences is that other chemokines, such as MCP-3 and MCP-5, are known to signal through CCR2 [35
]. In addition, there has also been evidence for a functional MCP-1 receptor other than CCR2. Heesen et al. [36
] reported that subnanomolar concentrations of MCP-1 specifically induced mouse astrocyte chemotaxis; however, reverse transcriptase-polymerase chain reaction (RT-PCR) failed to detect CCR2 mRNA in the astrocytes. Similarly, we have reported that low concentrations of MCP-1 induced tissue factor (TF) mRNA and activity in human aortic SMC [37
] in the absence of detectable CCR2 mRNA.
Given the compelling data implicating MCP-1 in atherosclerosis and other inflammatory processes, it is important to establish whether cells can respond to physiologic concentrations of MCP-1 in the absence of CCR2. To address this question, we established SMC cultures from CCR2–/– and CCR2+/+ littermates. We now report that incubation with MCP-1 induced a marked increase in TF activity in CCR2–/– and CCR2+/+ SMC. The increase in TF activity was dependent on activation of p42/44 mitogen-activated protein kinase (MAPK), involved mobilization of intracellular Ca2+, and was blocked by preincubation with pertussis toxin. These results provide the first definitive evidence for CCR2-independent responses to MCP-1.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Cell culture
Aortic SMC were prepared by enzyme digestion from CCR2–/– [30
] and CCR2+/+ littermates as described previously [38
]. Cells were grown in Dulbecco’s modified Eagle’s medium (DMEM), supplemented with 10% FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin and serially passaged before reaching confluence. Cells were identified as smooth muscle by their typical appearance on light microscopy and by immunostaining with a monoclonal antibody to mouse smooth muscle -actin (Clone 1A4 1:100, Sigma Chemical Co.). Experiments were performed on cells from passages 3–10.
PCR and RT-PCR
Total RNA was isolated from SMC as described previously [39
]. Primer pairs common to both splice variants were generated from the 3'-untranslated end of murine CCR2 mRNA (nt 1345–1598) [36
]: 5' GGTCCATGATCCCTATGTGG 3' (sense) and 5' CTGGGCACCTGATTTAAAGG 3' (antisense). For RT-PCR, the Titan One Tube RT-PCR system from Roche (Mannheim, Germany) was used, per the manufacturer’s instructions. An initial incubation was performed at 50°C for 30 min. This was followed by 35 cycles of 30 s at 94°C, 60 s at 53°C, 60 s at 72°C, and a final incubation for 10 min at 72°C. PCR reactions were performed under the following cycling conditions: initial incubation at 94°C for 2 min, followed by 39 cycles of 30 s at 94°C, 30 s at 55°C, 60 s at 72°C, and a final incubation for 10 min at 72°C. As a control for the quality of the RNA, RT-PCR was also performed with primers derived from the murine ß-actin mRNA from Stratagene (La Jolla, CA, Catalog #302110-14).
Determination of TF activity (factor Xa generation)
SMC grown in 10% FBS were placed in 0.3% FBS 24 h before treatment. MCP-1 was added directly to the plates, and TF activity was measured 4 h after treatment. In some experiments, BAPTA/AM (10 µM), PD98059 (20 µM), SB203580 (20 µM), or pertussis toxin (100 ng/ml) was added to the culture 1 h or 3 h (for pertussis toxin) before treatment with MCP-1. To measure TF activity, cells were washed twice and then lysed in 15 mM octyl-ß-D-glycopyranoside (final concentration). Human factors VIIa and X were then added sequentially to cell lysates as described previously [40
]. Aliquots (40 µl) were taken every 2 min for 6 min and placed in a 96-well plate containing 100 µl Bicine buffer (pH 8.5, 1 g/l BSA, and 25 mM EDTA) to stop the reaction. Factor Xa was assayed by adding 25 µl 2 mM Spectrozyme® to each well and measuring the changes in absorption at 405 nm at 35°C in an enzyme-linked immunosorbent assay plate reader (Tmax, Molecular Devices, Menlo Park, CA). The concentration of factor Xa was calculated from the slope of the absorption over time.
Analysis of p42/44 MAPK activity
SMC were cultured and treated as described above for the measurement of TF activity. At the times indicated, cells were washed twice in ice-cold phosphate-buffered saline and harvested in buffer containing 62.5 mM Tris-HCl (pH 6.8), 2% (w/v) sodium dodecyl sulfate (SDS), 50 mM dithiothreitol, and 10% (w/v) glycerol. SDS-polyacrylamide gel electrophoresis (PAGE), transfer to nitrocellulose, and detection of p42/44 and phospho-p42/44 MAPK were performed as described [41
, 42
]. Antibodies to p42/44 MAPK and phospho-p42/44 MAPK (Thr183/Tyr185; Cell Signaling Technology, Beverly, MA) were used at concentrations recommended, per the manufacturer’s protocol.
Statistics
All studies were performed two or three times using duplicate plates. Values are presented as the mean ± SD. The Student’s t-test was used in the analysis of unpaired means, and P < 0.05 was considered significant.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
 View larger version (45K): [in a new window] |
Figure 1. Analysis of CCR2 mRNA in CCR2+/+ and CCR2–/– SMC. RT-PCR was performed using 2 µg total RNA from CCR2+/+ SMC (lanes 1–3), CCR2–/– SMC (lanes 4–6), and murine (CCR2+/+ C57Bl/6) spleen (lanes 7–9). Samples were amplified using primer pairs specific for murine CCR2 mRNA (lanes 1, 2, 4, 5, 7, and 8; band size=254 bp) or ß-actin (lanes 3, 6, and 9; band size=514 bp). In lanes 2, 5, and 8, the RT was omitted.
|
 View larger version (22K): [in a new window] |
Figure 2. MCP-1 induces TF activity in CCR2+/+ and CCR2–/– SMC, which at 80% confluence, were incubated in 0.3% FBS for 24 h. Cells were then treated for 4 h with MCP-1 at the concentrations indicated. TF activity (factor Xa generation) was measured from cells lysed in detergent. Values represent the average ± SD from three experiments performed on duplicate plates. *,P < 0.001 compared with untreated cells.
|
i protein-coupled. Pretreatment with BAPTA/AM to chelate intracellular Ca2+ also blocked the increase in TF activity, demonstrating that induction of TF involves intracellular Ca2+ mobilization.
 View larger version (46K): [in a new window] |
Figure 3. Signaling pathways involved in the induction of TF activity by MCP-1. SMC were incubated in 0.3% FBS for 24 h to achieve quiescence. Cells from CCR2–/– or CCR2+/+ mice were then treated with 1 ng/ml MCP-1 alone or after pretreatment with 100 ng/ml pertussis toxin (PT), 10 µM BAPTA/AM (BAPTA), 20 µM PD98059 (PD), or 20 µM SB203580 (SB). All pretreatments were for 1 h, except for pertussis toxin, which was 3 h. TF activity (pM factor Xa generation) was measured from cell lysates harvested 4 h after treatment with MCP-1. Control cells were treated for 4 h with DMEM. For comparison, cells were also treated for 4 h with 10 ng/ml PDGF (*, P<0.001, compared with cells treated with MCP-1 alone). Inset: SMC were treated as above with the indicated concentrations of PD (average of two experiments).
|
2 µM, similar to that shown to maximally inhibit p42/44 MAPK [46
] and other MAPK-dependent processes in SMC [41
, 46
]. In contrast to its lack of effect on TF induction by MCP-1, SB203580 had a marked effect on the induction of TF by stromal-derived factor-1 (SDF-1), whereas PD98059 did not (SDF-1: 1350±150 pM factor Xa; SDF-1+SB203580: 410±60; SDF-1+PD98059: 1200±200), demonstrating that under the conditions used for these experiments, the p38 MAPK inhibitor was active and further establishing the specificity of the two inhbitors. SDF-1 has previously been shown to induce TF in SMC in a p38 but not in a p42/44 MAPK-dependent manner [47
]. To confirm that MCP-1 induced p42/44 MAPK, Western blots were performed with antibodies to the phospho-specific and nonactivated forms of p42/44. MCP-1 caused a time-dependent and concentration-dependent increase in phosphorylated p42/44 MAPK (Fig. 4
). No significant differences in the nonphosphorylated species were noted.
 View larger version (51K): [in a new window] |
Figure 4. MCP-1-mediated activation of p42/44 MAPK in CCR2–/– SMC, which from CCR2–/– mice, were incubated in 0.3% FBS for 24 h and then treated with MCP-1. Cellular extracts (10 µg/lane) were resolved by 7.5% SDS-PAGE, transferred to nitrocellulose, and probed with antibodies specific for the phosphorylated extracellular-regulated kinase (pERK) 1/2 and unphosphorylated (ERK1/2) forms of p42/44 MAPK. (A) SMC treated with MCP-1 (1 ng/ml) for the times indicated (min). (B) SMC treated for 15 min with the concentrations of MCP-1 indicated (ng/mL). Gels are representative of three separate experiments performed on different passages of SMC.
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Although originally thought to act solely on cells of leukocyte origin, there is increasing evidence that MCP-1 acts as an agonist for SMC. MCP-1 has been shown to induce TF in human and rat SMC [37
] and interleukin-6 (IL-6) [48
] in human SMC. The induction of TF was dependent on activation of protein kinase C and mobilization of intracellular Ca2+, whereas the induction of IL-6 involved activation of nuclear factor-
B. The effects of MCP-1 on SMC proliferation in vitro remain controversial: Recent studies have demonstrated a stimulatory effect [48
49
50
], whereas earlier studies showed no effect [51
] or an inhibitory effect [52
]. Similarly, the role of CCR2 in mediating the effects of MCP-1 remains unclear. RT-PCR has been used to identify CCR2 mRNA in cultured human SMC in several studies [48
, 53
], whereas we were unable to find CCR2 mRNA in human aortic SMC using the same approach [37
]. This may reflect the vicissitudes of primary SMC culture, which is heterogeneous and represents a spectrum of dedifferentiated phenotypes [54
]. The expression of CCR2 mRNA may be highly regulated and transient under certain culture conditions. Conversely, the sensitivity of RT-PCR would allow mRNA to be detected from a small subset of SMC, possessing a distinct phenotype, or from a group of contaminating cells of non-SMC origin. For this reason, we chose a system in which CCR2 was absent to determine whether SMC could respond to MCP-1 in the absence of CCR2.
The mechanism underlying the response to MCP-1 in the absence of CCR2 remains to be determined. The peak increase in TF activity in CCR2–/– SMC occurs at MCP-1 concentrations of 0.1–10 ng/ml. These concentrations are thought to be present under physiologic conditions and are similar to those previously shown to activate CCR2 [55
]. This is in contrast to the activation of other known chemokine receptors, such as CCR1 [31
] and CCR11 [56
], by MCP-1, which occurs at concentrations several logs higher. Dose responses to MCP-1 with respect to TF generation in CCR2+/+ and CCR2–/– SMC are identical, as are the responses to inhibitors of intracellular signaling. These data, taken together with the absence of CCR2 mRNA in CCR2+/+ SMC, suggest that the receptor(s) responding to MCP-1 is present at similar density on WT and CCR2-deficient mice and that the absence of CCR2 does not induce novel MCP-1 binding sites. The decrease in TF activity at higher MCP-1 concentrations is typical of that found for CC chemokines and may be secondary to the generation of inactive dimers [57
]. Treatment with pertussis toxin completely abolished the increase in TF activity, suggesting that the response is mediated via a Gi-coupled receptor. BAPTA/AM also completely blocked the increase in TF activity, suggesting that this receptor signals in part through mobilization of intracellular Ca2+. These responses are typical of members of the family of seven spanning CC chemokine receptors [58
] and suggest that a member of this family mediates the response of SMC to MCP-1.
We have previously demonstrated specific binding of MCP-1 to human aortic SMC [37
]. The derived dissociation constant was 1.0 nM, comparable with the affinity of MCP-1 for human monocytes [44
] or for cells transfected with CCR2 [22
, 44
]. Using the same methodology, we were unable to obtain specific binding of murine MCP-1 to mouse SMC. In addition, using fluorescent microscopy, we were unable to identify CCR2 binding on murine SMC monolayers using biotinylated MCP-1 followed by fluorescein-conjugated avidin as described [59
]. There are several possible reasons for this result. First, binding assays using SMC are often complicated by the presence of nonspecific or high background binding, as illustrated in our previous work with human SMC [37
]. This may be a result, in part, of the necessity of performing these experiments with cells adherent to plastic, rather than in suspension; it is likely that much of the nonspecific binding is to exposed matrix proteins. Second, it is possible that the number of receptors per cell is low. The total number of MCP-1 receptors on monocytes is 3000 [44
], which would be very difficult to detect given the limited number of SMC on a confluent dish. Finally, the dissociation constant may not be in the low nanomolar range and would thus require other techniques to determine.
There are several mechanisms by which the response to MCP-1 would not involve direct binding to an alternative MCP-1 receptor. One would depend on heterodimerization of MCP-1 with another chemokine, such as has been shown to occur for macrophage inflammatory protein (MIP)-1 and -ß [60
]. Such a heterodimer could have modified activity and induce TF by activating another chemokine receptor. SMC have been shown to synthesize a variety of chemokines and to possess chemokine receptors, such as CCR5 [61
] and CCR8 [62
]. It is also possible that MCP-1 is altered in the culture medium and could thus activate another chemokine receptor to which it does not normally bind. In that regard, it should be noted that MCP-1 normally secreted into the culture medium by SMC retains potent monocyte chemotactic activity that can be completely inhibited with antibodies to MCP-1 [63
]. One additional possibility is the presence of a contaminant, such as bacterial endotoxin lipopolysaccharide (LPS), in the MCP-1 preparation. We have previously demonstrated that polymyxin B, an inhibitor of LPS, did not block the induction of TF by MCP-1 and in addition, that MCP-1 did not induce TF in endothelial cells, which are very responsive to LPS [37
]. In addition, the concentrations of MCP-1 necessary to activate SMC in this and other studies are within the usual range for MCP-1-mediated responses, further arguing against a contaminant being responsible.
The current study focused on the measurement of TF activity. TF is the principal initiator of the clotting cascade and is considered to be a major regulator of hemeostasis and thrombosis [64 ]. TF binds factor VII/VIIa, and the resulting complex acts as a catalyst for the conversion of factors IX and X to IXa and Xa, respectively. Like MCP-1, TF is induced in the SMC of the injured arterial wall and is abundant in macrophages and intimal SMC of the atherosclerotic plaque [65 ]. Thrombosis associated with rupture of vulnerable atherosclerotic plaques is considered the major cause of myocardial infarction and unstable coronary syndromes [66 ]. The exposure of TF to circulating blood as a consequence of plaque rupture is thought to play a critical role in initiating thrombotic coronary occlusions [67 ]. By virtue of its ability to induce TF in SMC and macrophages, MCP-1 may be a major contributor to the procoagulant state of atherosclerotic arteries.
Another feature of MCP-1-mediated signaling in SMC is the activation of p42/44 MAPK, which are a family of ubiquitously expressed protein kinases involved in cell growth, transformation, differentiation, and apoptosis [41
]. MAPK are part of specific kinase cascades whose downstream substrates include other kinases and cytoplasmic and nuclear proteins involved in transcription. Although the activation of MAPK pathways by CC chemokines has not been examined in detail, p42/44 MAPK has been shown to be induced by MCP-1 in Chinese hamster ovary cells expressing CCR2 and to be involved in MCP-1-mediated monocyte chemotaxis [68
]. The p42/44 MAPK has also been implicated in MIP-3 [69
], MIP-2 [70
], and MIP-1ß [71
] signaling. In the present study, the increase in TF activity was completely blocked by an inhibitor of p42/44 MAPK, suggesting that this pathway is essential for MCP-1-mediated TF induction. Given the involvement of MAPK pathways in regulating many aspects of SMC biology (reviewed in refs. [41
, 72
, 73
]), it is likely that effects of MCP-1 on SMC will be protean and not limited to the regulation of TF.
In summary, we have used CCR2–/– mice to provide definitive evidence for CCR2-independent MCP-1 signaling. MCP-1 has been implicated in the genesis of many pathologic syndromes. The presence of CCR2-independent MCP-1 responses may thus have important implications for the pathogenesis and treatment of a variety of human diseases. In particular, it raises the possibility that antagonists to CCR2, currently in development, may not be sufficient to neutralize all of the effects of MCP-1.
Received September 11, 2003; revised January 26, 2004; accepted January 30, 2004.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
are overcome to control infection with Leishmania donovani in CC chemokine receptor (CCR) 5-, macrophage inflammatory protein-1 -, or CCR2-deficient mice J. Immunol. 163,5519-5525-mediated monocyte chemoattractant protein-1 induction in vascular smooth muscle cells Arterioscler. Thromb. Vasc. Biol. 20,385-391B and activator protein-1 Arterioscler. Thromb. Vasc. Biol. 22,914-920 receptors: evidence for two closely linked C-C chemokine receptors on chromosome 9 J. Biol. Chem. 271,7551-7558 and 1ß as a native secreted heterodimer J. Biol. Chem. 276,12404-12409 induces human eosinophil migration and activation of the mitogen-activated protein kinases (p42/p44 MAPK) J. Leukoc. Biol. 66,674-682[Abstract]This article has been cited by other articles:
 |
|
 |
|
  A. Mildner, M. Mack, H. Schmidt, W. Bruck, M. Djukic, M. D. Zabel, A. Hille, J. Priller, and M. Prinz CCR2+Ly-6Chi monocytes are crucial for the effector phase of autoimmunity in the central nervous system Brain, June 16, 2009; (2009) awp144v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Yahiaoui, D. Gvozdic, G. Danialou, M. Mack, and B. J. Petrof CC family chemokines directly regulate myoblast responses to skeletal muscle injury J. Physiol., August 15, 2008; 586(16): 3991 - 4004. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Egashira, K. Nakano, K. Ohtani, K. Funakoshi, G. Zhao, Y. Ihara, J.-i. Koga, S. Kimura, R. Tominaga, and K. Sunagawa Local Delivery of Anti-Monocyte Chemoattractant Protein-1 by Gene-Eluting Stents Attenuates In-Stent Stenosis in Rabbits and Monkeys Arterioscler. Thromb. Vasc. Biol., December 1, 2007; 27(12): 2563 - 2568. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. K. Shireman, V. Contreras-Shannon, O. Ochoa, B. P. Karia, J. E. Michalek, and L. M. McManus MCP-1 deficiency causes altered inflammation with impaired skeletal muscle regeneration J. Leukoc. Biol., March 1, 2007; 81(3): 775 - 785. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Wareing, A. Lyon, C. Inglis, F. Giannoni, I. Charo, and S. R. Sarawar Chemokine regulation of the inflammatory response to a low-dose influenza infection in CCR2-/- mice J. Leukoc. Biol., March 1, 2007; 81(3): 793 - 801. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. A. Kruglov, R. A. Nathanson, T. Nguyen, and J. A. Dranoff Secretion of MCP-1/CCL2 by bile duct epithelia induces myofibroblastic transdifferentiation of portal fibroblasts Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G765 - G771. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Kodali, M. Hajjou, A. B. Berman, M. B. Bansal, S. Zhang, J. J. Pan, and A. D. Schecter Chemokines induce matrix metalloproteinase-2 through activation of epidermal growth factor receptor in arterial smooth muscle cells Cardiovasc Res, February 15, 2006; 69(3): 706 - 715. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F Marra Renaming cytokines: MCP-1, Major Chemokine in Pancreatitis Gut, December 1, 2005; 54(12): 1679 - 1681. [Full Text] [PDF]
|
|
|
|
 |
|
 G. P. de Lema, H. Maier, T. J. Franz, M. Escribese, S. Chilla, S. Segerer, N. Camarasa, H. Schmid, B. Banas, S. Kalaydjiev, et al. Chemokine Receptor Ccr2 Deficiency Reduces Renal Disease and Prolongs Survival in MRL/lpr Lupus-Prone Mice J. Am. Soc. Nephrol., December 1, 2005; 16(12): 3592 - 3601. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. W. Raines and N. Ferri Thematic Review Series: The Immune System and Atherogenesis. Cytokines affecting endothelial and smooth muscle cells in vascular disease J. Lipid Res., June 1, 2005; 46(6): 1081 - 1092. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. F. Charo and M. B. Taubman Chemokines in the Pathogenesis of Vascular Disease Circ. Res., October 29, 2004; 95(9): 858 - 866. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
