Accuri C6 Flow Cytometer System
Originally published online as doi:10.1189/jlb.1203638 on February 13, 2004

Published online before print February 13, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.1203638v1
75/5/884    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rao, G. K.
Right arrow Articles by Kaminski, N. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rao, G. K.
Right arrow Articles by Kaminski, N. E.
(Journal of Leukocyte Biology. 2004;75:884-892.)
© 2004 by Society for Leukocyte Biology

Cannabinoid receptor-mediated regulation of intracellular calcium by {Delta}9-tetrahydrocannabinol in resting T cells

Gautham K. Rao*,{dagger},{ddagger}, Wei Zhang*,{dagger} and Norbert E. Kaminski*,{dagger},{ddagger},1

* Department of Pharmacology and Toxicology,
{dagger} National Food Safety and Toxicology Center, and
{ddagger} Center for Integrative Toxicology, Michigan State University, East Lansing

1Correspondence: Department of Pharmacology and Toxicology, 315 National Food Safety and Toxicology Center, Michigan State University, East Lansing, MI 48824. E-mail: kamins11{at}msu.edu


arrow
ABSTRACT
 
Cannabinoids exhibit broad immune modulating activity by targeting many cell types within the immune system, including T cells, which exhibit sensitivity, as evidenced by altered activation, proliferation, and cytokine expression. As a result of the critical role calcium plays in T cell function coupled with previous findings demonstrating disruption of the calcium-regulated transcription factor, nuclear factor of activated T cells, by cannabinoid treatment, the objective of the present investigation was to perform an initial characterization of the role of the cannabinoid receptors in the regulation of the intracellular calcium concentration ([Ca2+]i) by {Delta}9-tetrahydrocannabinol ({Delta}9-THC) in T lymphocytes. Here, we demonstrate that {Delta}9-THC robustly elevates [Ca2+]i in purified murine splenic T cells and in the human peripheral blood acute lymphoid leukemia (HPB-ALL) human T cell line but only minimally elevates [Ca2+]i in Jurkat E6-1 (dysfunctional cannabinoid receptor 2-expressing) human T cells. Removal of extracellular calcium severely attenuated the {Delta}9-THC-mediated rise in [Ca2+]i in murine splenic T cells and HPB-ALL cells. Pretreatment with cannabinoid receptor antagonists, SR144528 and/or SR141716A, led to an attenuation of {Delta}9-THC-mediated elevation in [Ca2+]i in splenic T cells and HPB-ALL cells but not in Jurkat E6-1 cells. Furthermore, pretreatment of HPB-ALL cells with SR144528 antagonized the small rise in [Ca2+]i elicited by {Delta}9-THC in the absence of extracellular calcium. These findings suggest that {Delta}9-THC induces an influx of extracellular calcium in resting T cells in a cannabinoid receptor-dependent manner.

Key Words: immune system • CB2 • CP55, 940 • CB1 • SR141716A • SR144528


arrow
INTRODUCTION
 
The immunomodulatory properties of plant-derived cannabinoids have been widely established [1 ]. The most extensively characterized cannabinoid, {Delta}9-tetrahydrocannabinol ({Delta}9-THC), exhibits a broad range of immunomodulatory activity, including direct effects on T cell function, as evidenced by altered, mitogen-induced cell proliferation, suppressed accessory cell function in T cell-dependent antibody responses, and altered production of several T cell-derived cytokines [2 3 4 5 ]. Although widely studied, the specific mechanism responsible for altered T cell function by cannabinoids remains poorly understood. Recent investigations focusing specifically on cannabinoid-mediated changes in signaling events associated with T cell activation have demonstrated a strong correlation between cannabinoid-mediated modulation of interleukin (IL)-2 expression and reciprocal changes in DNA binding and reporter gene activity of the transcription factor, nuclear factor of activated T cells (NFAT) [6 7 8 ], which is an essential regulator of a number of T cell-derived cytokines including IL-2 [9 ]. NFAT activation and subsequent nuclear translocation are under the control of the calcium-dependent phosphatase, calcineurin, whose activity is initiated by a rapid rise in intracellular calcium concentration ([Ca2+]i), which is induced almost immediately upon engagement of the T cell antigen receptor [9 ]. The rise in [Ca2+]i after stimulation of the T cell receptor occurs in two distinct phases. The first phase is characterized by a rapid but modest rise in [Ca2+]i as a result of the release of intracellular stored calcium [10 ]. The second phase is triggered by the release of stored calcium, is significantly greater in magnitude and duration than the rise in calcium produced from the release of [Ca2+]i stores, and is a result of the influx of extracellular calcium through the opening of calcium release-activated calcium channels [10 ]. Conversely, an elevation of [Ca2+]i before activation of the T cell renders it anergic [11 12 13 14 15 ].

Many of the biological effects produced by cannabinoids have been reported to occur through cannabinoid receptors, of which there are two types, CB1 and CB2 [16 17 18 ], which belong to the G protein-coupled receptor superfamily. CB1, also termed the central cannabinoid receptor, is primarily responsible for cannabinoid-mediated effects on the central nervous system (CNS) but is also expressed widely outside the nervous system [19 ]. CB2, termed the peripheral cannabinoid receptor, was originally described within the immune system and is believed not to be expressed within the CNS or if so, at very low levels [1 ]. The CB2 receptor, in particular, is thought to be involved in cannabinoid-mediated immune modulation as a result of its markedly higher mRNA expression in leukocytes than CB1 [19 20 21 ]; however, a rigorous characterization of CB1 and CB2 expression at the protein level for these receptors has not yet been performed in leukocytes. In addition, the specific role of CB1 and CB2 in cannabinoid-mediated immune modulation has remained controversial due to the fact that both receptors are expressed in primary leukocytes, the absence of widely available CB1- and CB2-selective agonists, and the recent identification of CB1/CB2-independent effects, which have complicated the interpretation of results using CB1 and CB2 receptor antagonists. In light of our previous findings demonstrating altered NFAT regulation in activated T cells, coupled with a past report of altered calcium regulation in {Delta}9-THC-treated leukocytes [22 ], the objective of the present investigation was to characterize the putative role of the cannabinoid receptors in the regulation of [Ca2+]i by {Delta}9-THC in resting T lymphocytes. The rationale for studying the effect of {Delta}9-THC on calcium regulation in resting T cells was to examine whether {Delta}9-THC independently exerts effects on [Ca2+]i, in the absence of the confounding factor of T cell activation-associated rise in [Ca2+]i. The present studies show that {Delta}9-THC increases [Ca2+]i in primary murine T cells and a human T cell line in a CB1- and CB2-dependent manner.


arrow
MATERIALS AND METHODS
 
Cannabinoid compounds and antagonists
SR144528, SR141716A, CP55,940, and {Delta}9-THC were provided by the National Institute on Drug Abuse (Bethesda, MD).

Animals
Pathogen-free, female B6C3F1 mice, 6 weeks of age, were purchased from Charles River Breeding (Portage, MI). On arrival, mice were randomized, transferred to plastic cages containing sawdust bedding (five animals/cage), and quarantined for 1 week. Mice were given food (Purina-certified laboratory chow) and water ad lib. Mice were not used for experimentation until their body weight was 17–20 g. Animal holding-rooms were maintained at 21–24°C and 40–60% relative humidity with a 12-h light/dark cycle. All studies were performed in compliance with the Michigan State University All-University Committee on Animal Use and Care (East Lansing).

Cell lines
Dr. Jeffrey A. Ledbetter (Pacific Northwest Research Institute, Seattle, WA) generously provided the human peripheral blood acute lymphoid leukemia (HPB-ALL) cell line. The human T cell leukemia line, Jurkat E6-1 clone, was obtained from the American Type Culture Collection (Manassas, VA; TIB 152). Both cell lines were cultured in RPMI-1640 medium, supplemented with 100 units penicillin/ml, 100 units streptomycin/ml, 10% bovine calf serum (Hyclone, Logan, UT), 100 mM nonessential amino acids (Gibco-BRL, Grand Island, NY), and 1 mM sodium pyruvate (Gibco-BRL).

T cell isolations
T cell isolations were performed as previously reported [21 ]. Briefly, splenocytes from naïve mice were depleted of red blood cells by lysis using Gey’s balanced salt solution. The recovered cells were resuspended in 1x column wash buffer at a concentration of 1.5 x 108 cells/ml and transferred in 2-ml aliquots onto T cell enrichment columns (R&D Systems, Minneapolis, MN) and incubated for 10 min at room temperature. Purification of T cells by T cell enrichment columns was through negative selection. The collected cells were then loaded with fura-2-AM dye for calcium determinations. This method routinely yields >95% pure T cells, as established by flow cytometry.

Calcium determination
Isolated splenic T cells or human T cell lines were washed twice in Ca2+-KREB buffer (129 mM NaCl, 5 mM KCl, 1.2 mM KH2PO4, 1.2 mM MgSO4, 1 mM CaCl2, 5 mM NaHCO3, 10 mM HEPES, 2.8 mM glucose, 0.2% bovine serum albumin). For studies with pertussis toxin, cells were pretreated with 100 ng/ml pertussis toxin (Sigma Chemical Co., St. Louis, MO) for 18 h at 37°C and washed twice in Ca2+-KREB buffer. [Ca2+]i was determined by measuring the fluorescence of fura-2 dye, which is dually excited at 340 nm and 380 nm. Briefly, cells were incubated with cell-permeant fura-2-AM dye (1 µM, Molecular Research Products, Eugene, OR) for 30 min at 37°C in the dark. Cells were harvested, washed three times with Ca2+-KREB buffer to remove extracellular fura-2 dye, and readjusted to 5 x 106 cells/ml (for splenic T cells) or 5 x 105 cells/ml (for human T cell lines) in Ca2+-KREB buffer. Cells were placed in a 3-ml quartz cuvette with constant stirring. Calcium determinations were performed at room temperature with a Beckman Spex 1681 0.22m spectrometer with dual excitation at 340 and 380 nm and emission at 510 nm (all slit-widths were 1 mm). [Ca2+]i calculations were based on maximum and minimum calcium values, as assessed with use of 0.1% Triton-X and 500 mM EGTA, respectively. The dissociation constant for the fura-2 calcium complex was 1.45 x 107 M. For studies conducted in the absence of extracellular calcium, the Ca2+-KREB buffer was prepared as above without CaCl2 and supplemented with 1 mM MgCl2 and 20 µM EGTA. All compounds used in [Ca2+]i determination were screened for autofluorescence using fura-2 sodium salt containing Ca2+-KREB buffer. None of the compounds exhibited autofluorescence nor did they interfere with fura-2 fluorescence.

Reverse transcriptase-polymerase chain reaction (RT-PCR)
Total RNA from HPB-ALL or Jurkat E6-1 cells was isolated using Tri-Reagent (Sigma Chemical Co.). Isolated RNA samples were confirmed to be free of DNA contamination by the absence of product after PCR amplification in the absence of RT. RT-PCR was performed as described previously [6 ]. Briefly, 100 ng total RNA from HPB-ALL and Jurkat E6-1 cells was used. The PCR master mixture consisted of PCR buffer, 2.5 mM MgCl2, 1.25 units of Taq DNA polymerase, and 6 pmol forward and reverse primers for CB1 or CB2. Samples were heated to 94°C for 4 min and cycled 40 times at 94°C for 30 s, 57°C for 30 s, and 72°C for 1 min, after which an additional extension step of 72°C for 5 min was included. The primer sequences from 5' to 3' for CB1 were: GGCTGGAACTGCGAGAAACT (forward) and TGATCAACACCACCAGGATCA (reverse). The primer sequences from 5' to 3' for CB2 were: TCCCAGGCACCTAGACACG (forward) and TGGTCTCTGGAGGATGCAGG (reverse). PCR products were resolved in a 3% NuSieve 3:1 agarose gel (FMC Bioproducts, Rockland, ME) and visualized with ethidium bromide staining. The CB1 primers produced a 301-bp amplicon, and the CB2 primers produced a 203-bp amplicon.

Sequencing
Total RNA from HPB-ALL or Jurkat E6-1 cells was isolated using Tri-Reagent (Sigma Chemical Co.). CB2 cDNA was obtained by reverse transcription with 5 µg isolated, total RNA using PowerScriptTM RT (BD Biosciences, Palo Alto, CA) and amplified by PCR using the Advantage-HF 2 PCR kit (BD Biosciences) as per the manufacturer’s instructions. Briefly, samples were heated to 94°C for 5 min and cycled 40 times at 94°C for 30 s, 60°C for 30 s, and 72°C for 90 s, after which an additional extension step of 72°C for 5 min was included. The PCR primers contained cleavage sites for restriction endonucleases BamHI and HindIII within the forward and reverse primers, respectively. The sequences for PCR primers from 5' to 3' were: CTGAAGGATCCACCCCATGGAGGAATGCTGGGTGAC (forward) and CCTCTCAAGCTTCCAGGGAGTGAACTGATTTCTGACTTGAG (reverse). The PCR products were then cloned into pCMV-Tag-1 (Stratagene, La Jolla, CA) and sequenced with T3 and T7 primers using an ABI PRISM® 3100 genetic analyzer at the Michigan State University Macromolecular Structure, Sequencing, and Synthesis Facility (East Lansing). The sequences for the T3 and T7 primers, respectively, from 5' to 3' were as follows: AATTAACCCTCACTAAAGGG and GTAATACGACTCACTATAGGGC.


arrow
RESULTS
 
Effect of {Delta}9-THC and CP55,940 on [Ca2+]i in splenic T cells and human T cell lines
The prototypical plant-derived cannabinoid, {Delta}9-THC as well as the synthetic cannabinoid CP55,940 were used to examine the effect of cannabinoid treatment on [Ca2+]i regulation in T cells. Three different T cell preparations were examined, primary mouse splenic T cells and two different human-derived T cell lines, HPB-ALL, and Jurkat E6-1. Addition of {Delta}9-THC (10 µM) but not CP55,940 (10 µM) induced a robust increase in [Ca2+]i within ~300 s in purified splenic T cells (1652.0±216.8 nM), as seen in Figure 1A . At concentrations of {Delta}9-THC equal to or above 10 µM, the rise in [Ca2+]i was rapid and did not reach a plateau during the entire period of calcium measurement (1800 s). It is interesting that at {Delta}9-THC concentrations below 10 µM, no appreciable increase in [Ca2+]i was detected. At the concentrations of {Delta}9-THC and CP55,940, used for [Ca2+]i determination, neither compound resulted in toxicity to the cells as measured by trypan blue exclusion (data not shown).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. {Delta}9-THC elevates [Ca2+]i in unstimulated (A) murine splenic T cells, (B) HPB-ALL cells, and (C) Jurkat E6-1 cells. Purified murine splenic T cells (5x106 cells/ml) or human T cells (5x105 cells/ml) were loaded with fura-2-AM dye for 30 min at 37°C in the dark. Cells were harvested and washed three times in Ca2+-KREB buffer to remove excess fura-2-AM dye from the buffer. A 3-ml aliquot of cells was added into a quartz cuvette, and calcium concentration was determined. {Delta}9-THC, CP55,940 (CP), and/or 0.1% ethanol vehicle (VH) were injected using a glass syringe to the cuvette at 300 s, and the increase in [Ca2+]i was measured for 1800 s total. Maximum and minimum values were obtained with 0.1% Triton-X at 1600 s and 0.5 mM EGTA at 1700 s, respectively. [Ca2+]i concentration was calculated from the changes in the ratio of bound to free calcium. The results are presented as mean ± SEM of three independent experiments along with a representative graph of calcium traces.

To confirm that the effect of {Delta}9-THC on [Ca2+]i was not unique to murine T cells and to ascertain the putative involvement of the CB2 receptor, HPB-ALL and Jurkat E6-1 human T cell lines were also used. As with the purified splenic T cells, treatment of HPB-ALL cells with {Delta}9-THC (10 µM) but not CP55,940 (10 µM) led to a robust elevation of [Ca2+]i but at concentrations greater than or equal to 7.5 µM (Fig. 1B) . However, unlike the splenic T cells, 10 µM {Delta}9-THC led to a rapid but transient rise in [Ca2+]i (883.0±56.2 nM) in HPB-ALL cells, which reached a peak at ~1000 s.

In light of the observation that the high-affinity, nonselective CB1/CB2 agonist, CP55,940, did not lead to an elevation of [Ca2+]i, an additional series of experiments was performed in HPB-ALL cells to determine whether CP55,940 can block the effect of {Delta}9-THC on [Ca2+]i by acting as a neutral antagonist. HPB-ALL cells were pretreated with CP55,940 (1 µM) for 300 s followed by {Delta}9-THC (10 µM). It is interesting that pretreatment of HPB-ALL cells with CP55,940 did not attenuate the increase in [Ca2+]i elicited by {Delta}9-THC (Fig. 2 ).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. CP55,940 does not antagonize the elevation of [Ca2+]i elicited by {Delta}9-THC in HPB-ALL cells (5x105 cells/ml), which were washed twice in Ca2+-KREB buffer and loaded with fura-2-AM dye for 30 min at 37°C in the dark. CP55,940 (CP) and/or 0.1% ethanol vehicle (VH) were added directly to the cuvette, just before beginning calcium measurements. {Delta}9-THC and/or 0.1% ethanol vehicle were injected using a glass syringe to the cuvette at 300 s, and the increase in [Ca2+]i was measured for 1800 s total. [Ca2+]i concentration was calculated as described in the legend for Figure 1 . The results are presented as mean ± SEM of three independent experiments along with a representative graph of calcium traces.

Additionally, calcium measurements were performed in the dysfunctional CB2 receptor expressing Jurkat E6-1 cells. Treatment of the Jurkat E6-1 cells with {Delta}9-THC (10 µM) led to a modest rise in [Ca2+]i (101.7±12.1 nM; Fig. 1C ), which was small in comparison with the effect of {Delta}9-THC (10 µM) on [Ca2+]i in the purified murine splenic T cells and HPB-ALL cells. In the Jurkat E6-1 cells, the {Delta}9-THC-mediated rise in [Ca2+]i was also comparatively slow and concentration-responsive.

Effect of {Delta}9-THC on [Ca2+]i in the presence or absence of extracellular calcium
The primary mechanism of calcium entry into nonexcitable cells is through capacitative calcium entry, which involves sequential release of [Ca2+]i pools followed by an influx of extracellular calcium through store-operated calcium channels [23 ]. To determine if the {Delta}9-THC-mediated rise in [Ca2+]i involved an influx of extracellular calcium, calcium measurements were performed in the presence or absence of extracellular calcium in splenic T cells as well as in HPB-ALL cells. The results showed that absence of extracellular calcium severely attenuated (>90%) the {Delta}9-THC-mediated [Ca2+]i elevation, as compared with control conditions in the presence of extracellular calcium in splenic T cells (Fig. 3A ) and HPB-ALL cells (Fig. 3B) . In the absence of extracellular calcium, {Delta}9-THC induced only a small, delayed rise in [Ca2+]i. In fact, the response in splenic T cells and HPB-ALL cells to {Delta}9-THC was remarkably similar in the absence of extracellular calcium.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 3. Effect of {Delta}9-THC on [Ca2+]i in the presence or absence of extracellular calcium ([Ca2+]e) in (A) murine splenic T cells and (B) HPB-ALL cells. Purified splenic T cells (5x106 cells/ml) or HPB-ALL cells (5x106 cells/ml) were washed twice in Ca2+-KREB buffer and loaded with fura-2-AM dye for 30 min at 37°C in the dark. Cells were harvested and washed three times in Ca2+-KREB buffer to remove excess fura-2-AM dye from the buffer. Cells were then resuspended in Ca2+-KREB or Ca2+-free–KREB buffer just before beginning calcium measurements. {Delta}9-THC and/or 0.1% ethanol vehicle (VH) were injected using a glass syringe to the cuvette at 300 s, and the increase in [Ca2+]i was measured for 1800 s total. Results are presented as mean change ± SEM in the 340 nm/380 nm fluorescence ratio of [Ca2+]i from base to peak of three independent experiments along with a representative graph of calcium traces.

Characterization of the CB1 and CB2 receptors in the HPB-ALL and Jurkat E6-1 cells
This laboratory has previously reported the absence of transcripts for CB1 and presence of CB2 receptor transcripts in the HPB-ALL and Jurkat E6-1 cells by Northern analysis [21 ]. Presently, the expression of CB1 and CB2 was further characterized by RT-PCR, a significantly more sensitive method. CB1 mRNA expression was not detected by RT-PCR in either of the two cell lines (data not shown). Conversely, a single, predicted, 203-bp amplicon for CB2 was produced by RT-PCR from RNA derived from both cell lines (Fig. 4 ), which was not detected in the absence of RT (data not shown). Previous results from this laboratory have also suggested that the CB2 receptor in the Jurkat E6-1 cells was dysfunctional [21 ]. To elucidate whether the dysfunctionality of the CB2 receptor in the Jurkat E6-1 cells was a result of putative mutations in the CB2 gene, CB2 cDNA was sequenced from HPB-ALL and Jurkat E6-1 cells. Results showed that the CB2 coding sequence was 100% homologous between the two cells lines and 99.4% homologous as compared with the previously reported coding sequence for human CB2 (GenBank accession no. XM086356).



View larger version (60K):
[in this window]
[in a new window]
 
Figure 4. RT-PCR analysis of CB2 in HPB-ALL and Jurkat E6-1 cells. Total RNA was isolated from HPB-ALL and Jurkat E6-1 cells. Three separate RNA isolates were assayed for expression of CB2 mRNA transcripts by RT-PCR. The RNA samples were confirmed to be free of DNA contamination by the absence of product after PCR amplification in the absence of RT. RNA (100 ng) was reverse-transcribed and amplified using 40 cycles (conditions described in Materials and Methods). The results are representative of three independent experiments.

Antagonism of {Delta}9-THC-mediated rise in [Ca2+]i by cannabinoid receptor antagonists
The role of the cannabinoid receptors in the {Delta}9-THC-mediated elevation in [Ca2+]i was examined with the use of the cannabinoid receptor antagonists SR141716A and SR144528. In light of previous findings showing that CB1 and CB2 receptor transcripts are expressed in mouse splenocytes [6 , 21 ], CB1 and CB2 receptor antagonists were used individually or in combination in studies with splenic T cells. The antagonists by themselves had no effect on [Ca2+]i. However, pretreatment of splenic T cells with SR141716A and SR144528 (1.0 µM each), individually or in combination, for 300 s followed by 10 µM {Delta}9-THC treatment showed a marked attenuation of a {Delta}9-THC-mediated rise in [Ca2+]i (Fig. 5 ). It is interesting that the magnitude of the attenuation in the {Delta}9-THC-mediated [Ca2+]i rise by SR141716A and SR144528, individually, was almost as great as when used in combination. Although the pretreatment of the splenic T cells with a combination of SR141716A and SR144528 did lead to a further attenuation of the {Delta}9-THC-mediated increase in [Ca2+]i, the antagonists in combination did not additively antagonize the elevation of [Ca2+]i elicited by {Delta}9-THC.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 5. SR144528 and SR141716A antagonize the {Delta}9-THC-mediated elevation in [Ca2+]i in murine splenic T cells. Purified, murine, splenic T cells (5x106 cells/ml) were washed twice in Ca2+-KREB buffer and loaded with fura-2-AM dye for 30 min at 37°C in the dark, harvested, and washed as described in the legend for Figure 1 . SR144528 and SR141716A and/or 0.1% dimethylsulfoxide (DMSO) vehicle were added directly to the cuvette just before beginning calcium measurements. {Delta}9-THC and/or 0.1% ethanol vehicle (VH) were injected using a glass syringe to the cuvette at 300 s, and the increase in [Ca2+]i was measured for 1800 s total. [Ca2+]i concentration was calculated as described in the legend for Figure 1 . The results are presented as mean ± SEM of two independent experiments along with a representative graph of calcium traces.

Pretreatment of HPB-ALL cells with SR144528 (0.1–2.5 µM) also caused a marked inhibition of the rise in [Ca2+]i by 10 µM {Delta}9-THC (Table 1A ). This effect of SR144528 was concentration-responsive and inhibited the {Delta}9-THC-mediated rise in [Ca2+]i at concentrations as low as 0.1 µM. At higher concentrations (2.5 µM), SR144528 completely reversed the effect of {Delta}9-THC on [Ca2+]i. Of interest is the observation that the CB1 receptor antagonist, SR141716A, had no effect on [Ca2+]i in the absence of CB1 expression at concentrations below 2.5 µM (Table 1B) , as demonstrated in the CB2 expressing HPB-ALL cells. Additionally, in the dysfunctional CB2 receptor expressing Jurkat E6-1 cells, pretreatment even with high concentrations of SR144528 (5 µM) had no effect on [Ca2+]i elevation induced by 10 µM {Delta}9-THC (Table 1C) .


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of the Effects of Cannabinoid Receptor Antagonists and Pertussis Toxin on the {Delta}9-THC-Mediated Elevation in [Ca2+]i in HPB-ALL Cells (A, B, D) and Jurkat Cells (C)

To ascertain that the cannabinoid receptor antagonists did not attenuate calcium responses by acting as calcium channel blockers, an elevation in [Ca2+]i was induced by thapsigargin in the presence and absence of SR144528 and/or SR141716A. Specifically, [Ca2+]i measurements were performed by first pretreating HPB-ALL cells with SR144528 and/or SR141716A for 300 s followed by treatment with thapsigargin (1 µM). As expected, in control experiments performed in the absence of SR144528 and/or SR141716A, thapsigargin induced a rapid elevation in [Ca2+]i (348±53 nM; n=3). In the absence of extracellular calcium, thapsigargin also induced an elevation of [Ca2+]i, which was significantly reduced in magnitude, reflecting the blockade of the endoplasmic reticulum calcium ATPase and demonstrating the elevation of [Ca2+]i by thapsigargin in cells held in calcium-containing buffer to be largely from extracellular calcium influx (data not shown). Pretreatment of HPB-ALL cells with SR144528 and/or SR141716A (5 µM) did not attenuate the thapsigargin-induced elevation of [Ca2+]i, indicating that the cannabinoid receptor antagonists do not nonspecifically block calcium channels (data not shown).

Finally, calcium measurements were also performed with SR144528 in the absence of extracellular calcium to investigate whether the small and modest rise in [Ca2+]i elicited by 10 µM {Delta}9-THC in HPB-ALL cells was attributable to a CB2 receptor-dependent mechanism. Pretreatment of HPB-ALL cells with 5 µM SR144528 for 300 s followed by 10 µM {Delta}9-THC treatment showed a significant attenuation in the {Delta}9-THC-mediated rise in [Ca2+]i (Fig. 6 ).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 6. SR144528 antagonizes the modest elevation in [Ca2+]i elicited by {Delta}9-THC in the absence of extracellular calcium in HPB-ALL cells (5x105 cells/ml), which were washed twice in Ca2+-KREB buffer and loaded with fura-2-AM dye for 30 min at 37°C in the dark, harvested, and washed as described in the legend for Figure 1 . Cells were then resuspended in Ca2+-free–KREB buffer, and SR144528 and/or 0.1% DMSO vehicle were added directly to the cuvette just before beginning calcium measurements. {Delta}9-THC and/or 0.1% ethanol vehicle (VH) were injected using a glass syringe to the cuvette at 300 s, and the increase in [Ca2+]i was measured for 1800 s total. Results are presented as mean change ± SEM in the 340 nm/380 nm fluorescence ratio of [Ca2+]i from base to peak of two independent experiments along with a representative graph of calcium traces.

No attenuation of {Delta}9-THC-mediated rise in [Ca2+]i by pertussis toxin
CB1 and CB2 receptors belong to the G protein-coupled receptor superfamily and have been demonstrated to couple to the pertussis toxin-sensitive G proteins, G{alpha}i/G{alpha}o [24 25 ]. To investigate whether the {Delta}9-THC-mediated increase in [Ca2+]i occurred in a G{alpha}i/G{alpha}o-dependent manner, HPB-ALL cells, preincubated with pertussis toxin (100 ng/ml) or vehicle for 18 h at 37°C, were treated with {Delta}9-THC (10 µM). Preincubation with pertussis toxin did not attenuate the {Delta}9-THC-mediated increase in [Ca2+]i (Table 1D) .


arrow
DISCUSSION
 
Recent studies investigating the effects of cannabinoids on T cell activation and IL-2 gene expression identified alterations in NFAT DNA binding and transcriptional activity [6 7 8 ]. The regulation of NFAT is critically dependent on a marked and sustained elevation in [Ca2+]i induced by ligation of the T cell receptor, which leads to NFAT dephosphorylation and nuclear translocation [9 ]. This critical role that [Ca2+]i plays in the regulation of NFAT during T cell activation prompted a comprehensive investigation of the effects of {Delta}9-THC on [Ca2+]i in resting T cells. Our initial characterization shows that {Delta}9-THC produced a rapid and robust rise in [Ca2+]i in purified, murine, splenic T cells through CB1 and CB2 receptors and in the human T cell line, HPB-ALL, through CB2 receptors, independently of G{alpha}i/G{alpha}o, as evidenced by the absence of sensitivity to pertussis toxin treatment. In the absence of extracellular calcium, {Delta}9-THC led to a small rise in [Ca2+]i, which was significantly delayed and of a much smaller magnitude than in the presence of extracellular calcium, likely indicating an influx of residual calcium remaining in the calcium-free buffer. Furthermore, the small rise in [Ca2+]i elicited by {Delta}9-THC in the absence of extracellular calcium was antagonized in the HPB-ALL cells when pretreated with SR144528. It is interesting that the high-affinity, synthetic, CB1/CB2-nonselective ligand CP55,940 neither induced a rise in [Ca2+]i in T cells nor did it attenuate the {Delta}9-THC-mediated rise in [Ca2+]i in HPB-ALL cells by acting as a neutral antagonist.

The present studies provide several lines of evidence supporting the involvement of a cannabinoid receptor-dependent mechanism in the {Delta}9-THC-mediated rise in [Ca2+]i in resting T cells. The most direct evidence implicating cannabinoid receptor involvement is the observation that pretreatment of purified splenic T cells with the CB1 and/or CB2 receptor antagonists, SR141716A and SR144528, respectively, or HPB-ALL cells with SR144528 attenuated the {Delta}9-THC-mediated rise in [Ca2+]i. It is interesting that in purified, splenic T cells, SR141716A and SR144528, individually, were equally effective in attenuating the {Delta}9-THC-mediated rise in [Ca2+]i but were not markedly more effective when used in combination. Although it is possible that SR141716A at 1 µM may exhibit some cross-reactivity with CB2, as we have observed at very high SR141716A concentrations (5–10 µM), it is unlikely here, as 1 µM SR141716A alone had no effect on the {Delta}9-THC-mediated rise in [Ca2+]i in the CB2-only expressing HPB-ALL cells but significantly attenuated [Ca2+]i elevation in the murine splenic T cells. Furthermore, SR144528 and SR141716A were incapable of attenuating thapsigargin-induced elevation in [Ca2+]i in HPB-ALL cells, demonstrating that neither of the cannabinoid receptor antagonists act as calcium-channel blockers in the T cell preparation. Collectively, these results suggest that CB1 and CB2 are equally capable of mediating the rise in [Ca2+]i induced by {Delta}9-THC in T lymphocytes. It is noteworthy that cannabinoid-mediated effects have previously been shown to be modulated by CB1 and CB2 receptors in a nonadditive manner [26 ]. Additional evidence supporting the involvement of cannabinoid receptors in the {Delta}9-THC-mediated rise in [Ca2+]i comes from experiments using Jurkat E6-1 cells, which have previously been suggested to express dysfunctional CB2 receptors [21 ]. In the present investigation, {Delta}9-THC treatment of Jurkat E6-1 cells induced a very modest rise in [Ca2+]i as compared with HPB-ALL cells and primary murine splenic T cells, which were not significantly attenuated by SR144528 treatment. Sequencing the full-length, CB2-translated region revealed 100% homology between Jurkat E6-1 and HPB-ALL cells, indicating that the absence of CB2 function in Jurkat E6-1 cells is not a result of differences in the coding sequence of the CB2 receptor. Nevertheless, the studies clearly show that Jurkat E6-1 cells exhibit only a small elevation in [Ca2+]i in response to {Delta}9-THC treatment, which is insensitive to SR144528, further implicating the involvement of the CB2 receptor in the {Delta}9-THC-mediated rise in [Ca2+]i in T cells.

With respect to the mechanism for [Ca2+]i elevation by cannabinoids in resting T cells, several important insights beyond the involvement of cannabinoid receptors can be gleaned from the present investigation. Perhaps most importantly, in the absence of extracellular calcium, {Delta}9-THC induced a small and delayed rise in [Ca2+]i in HPB-ALL cells, which was attenuated by SR144528, an observation that has two implications. The first is that the rise in [Ca2+]i induced by {Delta}9-THC under normal extracellular calcium concentrations is, not surprisingly, a result of the entry of extracellular calcium. The second implication is that {Delta}9-THC acts in a cannabinoid receptor-dependent manner to induce a calcium influx putatively via the activation of calcium channels, independently of pertussis toxin-sensitive G proteins, which to our knowledge, has not been previously reported in T cells. In the present study, {Delta}9-THC elicited only a small elevation in [Ca2+]i in the absence of extracellular calcium, which was considerably delayed, as compared with control conditions where extracellular calcium was present. That delayed onset of the [Ca2+]i rise in the absence of extracellular calcium argues against a mechanism of capacitative calcium entry, where the depletion of intracellular stored calcium precedes extracellular calcium influx. Lastly, our studies rule out G{alpha}i/G{alpha}o involvement in the elevation of [Ca2+]i by {Delta}9-THC, based on the lack of sensitivity to pertussis toxin. Although historically, CB1 and CB2 have been predominately found to transduce signals through activation of pertussis toxin-sensitive G{alpha}i/G{alpha}o, more recently, CB1 has also been found to activate pertussis toxin-insensitive G{alpha}s [27 , 28 ]. It is presently unclear whether CB2 can also activate G{alpha}s and whether the {Delta}9-THC-induced elevation in [Ca2+]i is mediated through G{alpha}s activation. Recently, our laboratory has reported that cannabinol, another plant-derived cannabinoid, induced an elevation in [Ca2+]i in murine splenocytes and thymocytes, which was antagonized by SR144528 and/or SR141716A [15 ], indicating that the ability of cannabinoids to induce an elevation in [Ca2+]i via the cannabinoid receptors is not unique to {Delta}9-THC. However, in comparison with {Delta}9-THC, the calcium response elicited by cannabinol was modest.

An intriguing observation in the current investigation was the inability of CP55,940, a high-affinity, nonselective CB1/CB2 synthetic ligand, to induce a rise in [Ca2+]i in HPB-ALL cells or in primary splenic T cells. The observation is significant, as it suggests that discrete signaling cascades can be activated through cannabinoid receptors in a ligand-specific manner. One mechanism by which this could occur is through the differential recruitment of guanosine 5'-triphosphate-binding protein subtypes to cannabinoid receptors based on the tertiary structure of the ligand and its physical interaction with the receptor, as recently suggested by Howlett and co-workers [29 , 30 ]. It is equally intriguing that pretreatment of HPB-ALL cells with CP55,940, which has significantly greater binding affinity for CB1 and CB2 than {Delta}9-THC, did not attenuate the {Delta}9-THC-induced rise in [Ca2+]i. Previously, radioligand binding analysis has demonstrated competition between {Delta}9-THC and CP55,940 for CB2 binding [31 , 32 ], suggesting that both ligands interact with common domains within the binding pocket of CB2. Yet, the present, functional results demonstrate that {Delta}9-THC activation of CB2 is not influenced by CP55,940. One possible explanation for the apparent discrepancy between previous binding analysis and the calcium response results presented here is that there is more than one site within the cannabinoid receptors through which these ligands can interact. Reggio and co-workers [33 ] have recently postulated that at least at the CB1 receptor, the alkyl chain of classical, nonclassical, and endocannabinoids may interact with specific residues in a novel interaction site in transmembrane domain 6. In such a scenario, CP55,940 and {Delta}9-THC may bind to alternative sites within the cannabinoid receptors, thereby eliciting alternative, signaling cascades.

The functional implications of altered [Ca2+]i regulation produced by {Delta}9-THC in T cells are far-reaching, especially with respect to T cell activation. Yebra and colleagues [22 ] have previously reported that pretreatment of murine thymocytes with {Delta}9-THC suppressed the normal rise in [Ca2+]i induced by concanavalin A (Con A) at the level of [Ca2+]i release as well as extracellular calcium influx. In fact, [Ca2+]i elevation induced by an incomplete activation signal (i.e., no coreceptor stimulation) or produced artificially with calcium ionophores (e.g., ionomycin or A23187) is well-established to render T cells anergic [11 12 13 14 15 ]. Our findings suggest that {Delta}9-THC interferes with calcium mobilization in resting T cells, such that Con A may not further mobilize [Ca2+]i. Collectively, the findings from the present investigation, coupled with the report from Yebra et al. [22 ], suggest that one critical aspect to the immunomodulatory effects elicited by {Delta}9-THC may be through disruption of [Ca2+]i regulation. However, it is equally notable that disruption of [Ca2+]i regulation cannot fully account for the entire mechanism of action produced by T cell-modulating cannabinoids, as evidenced by the lack of an effect by CP55,940 on T cell [Ca2+]i.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by funds from National Institute of Drug Abuse Grants DA07908 and DA16828.

Received December 17, 2003; accepted January 14, 2004.


arrow
REFERENCES
 
    1
  1. Klein, T. W., Newton, C., Friedman, H. (1998) Cannabinoid receptors and immunity Immunol. Today 19,373-381[CrossRef][Medline]
  2. 2
  3. Schatz, A. R., Koh, W. S., Kaminski, N. E. (1993) {Delta}9-Tetrahydrocanabinol selectively inhibits T-cell-dependent humoral immune responses through direct inhibition of accessory T-cell function Immunopharmacology 26,129-137[CrossRef][Medline]
  4. 3
  5. Condie, R., Herring, A., Koh, W. S., Lee, M., Kaminski, N. E. (1996) Cannabinoid inhibition of adenylate cyclase-mediated signal transduction and interleukin 2 (IL-2) expression in the murine T-cell line, EL4.IL-2 J. Biol. Chem. 271,13175-13183[Abstract/Free Full Text]
  6. 4
  7. Newton, C., Klein, T., Friedman, H. (1998) The role of macrophages in THC-induced alteration of the cytokine network Adv. Exp. Med. Biol. 437,207-214[Medline]
  8. 5
  9. Klein, T. W., Lane, B., Newton, C. A., Friedman, H. (2000) The cannabinoid system and cytokine network Proc. Soc. Exp. Biol. Med. 225,1-8[Abstract/Free Full Text]
  10. 6
  11. Jan, T. R., Rao, G. K., Kaminski, N. E. (2002) Cannabinol enhancement of interleukin-2 (IL-2) expression by T cells is associated with an increase in IL-2 distal nuclear factor of activated T cell activity Mol. Pharmacol. 61,446-454[Abstract/Free Full Text]
  12. 7
  13. Ouyang, Y., Hwang, S. G., Han, S. H., Kaminski, N. E. (1998) Suppression of interleukin-2 by the putative endogenous cannabinoid 2-arachidonyl-glycerol is mediated through down-regulation of the nuclear factor of activated T cells Mol. Pharmacol. 53,676-683[Abstract/Free Full Text]
  14. 8
  15. Yea, S. S., Yang, K. H., Kaminski, N. E. (2000) Role of nuclear factor of activated T-cells and activator protein-1 in the inhibition of interleukin-2 gene transcription by cannabinol in EL4 T-cells J. Pharmacol. Exp. Ther. 292,597-605[Abstract/Free Full Text]
  16. 9
  17. Rao, A., Luo, C., Hogan, P. G. (1997) Transcription factors of the NFAT family: regulation and function Annu. Rev. Immunol. 15,707-747[CrossRef][Medline]
  18. 10
  19. Lewis, R. S. (2001) Calcium signaling mechanisms in T lymphocytes Annu. Rev. Immunol. 19,497-521[CrossRef][Medline]
  20. 11
  21. Nghiem, P., Ollick, T., Gardner, P., Schulman, H. (1994) Interleukin-2 transcriptional block by multifunctional Ca2+/calmodulin kinase Nature 371,347-350[CrossRef][Medline]
  22. 12
  23. Nakayama, T., Ueda, Y., Yamada, H., Shores, E. W., Singer, A., June, C. H. (1992) In vivo calcium elevations in thymocytes with T cell receptors that are specific for self ligands Science 257,96-99[Abstract/Free Full Text]
  24. 13
  25. Schwartz, R. H. (1992) Costimulation of T lymphocytes: the role of CD28, CTLA-4, and B7/BB1 in interleukin-2 production and immunotherapy Cell 71,1065-1068[CrossRef][Medline]
  26. 14
  27. Harding, F. A., McArthur, J. G., Gross, J. A., Raulet, D. H., Allison, J. P. (1992) CD28-mediated signalling co-stimulates murine T cells and prevents induction of anergy in T-cell clones Nature 356,607-609[CrossRef][Medline]
  28. 15
  29. Faubert Kaplan, B. L., Rockwell, C. E., Kaminski, N. E. (2003) Evidence for cannabinoid receptor-dependent and -independent mechanisms of action in leukocytes J. Pharmacol. Exp. Ther. 306,1077-1085[Abstract/Free Full Text]
  30. 16
  31. Matsuda, L. A., Lolait, S. J., Brownstein, M. J., Young, A. C., Bonner, T. I. (1990) Structure of a cannabinoid receptor and functional expression of the cloned cDNA Nature 346,561-564[CrossRef][Medline]
  32. 17
  33. Munro, S., Thomas, K. L., Abu-Shaar, M. (1993) Molecular characterization of peripheral receptor for cannabinoids Nature 365,61-65[CrossRef][Medline]
  34. 18
  35. Shire, D., Calandra, B., Rinaldi-Carmona, M., Oustric, D., Pessegue, B., Bonnin-Cabanne, O., Le Fur, G., Caput, D., Ferrara, P. (1996) Molecular cloning, expression and function of the murine CB2 peripheral cannabinoid receptor Biochim. Biophys. Acta 1307,132-136[Medline]
  36. 19
  37. Berdyshev, E. V. (2000) Cannabinoid receptors and the regulation of immune response Chem. Phys. Lipids 108,169-190[CrossRef][Medline]
  38. 20
  39. Bouaboula, M., Rinaldi, M., Carayon, P., Carillon, C., Delpech, B., Shire, D., Le Fur, G., Casellas, P. (1993) Cannabinoid-receptor expression in human leukocytes Eur. J. Biochem. 214,173-180[Medline]
  40. 21
  41. Schatz, A. R., Lee, M., Condie, R. B., Pulaski, J. T., Kaminski, N. E. (1997) Cannabinoid receptors CB1 and CB2: a characterization of expression and adenylate cyclase modulation within the immune system Toxicol. Appl. Pharmacol. 142,278-287[CrossRef][Medline]
  42. 22
  43. Yebra, M., Klein, T. W., Friedman, H. (1992) {Delta}9-Tetrahydrocannabinol suppresses concanavalin A-induced increase in cytoplasmic-free calcium in mouse thymocytes Life Sci. 51,151-160[CrossRef][Medline]
  44. 23
  45. Putney, J. W., Jr, Broad, L. M., Braun, F. J., Lievremont, J. P., Bird, G. S. (2001) Mechanisms of capacitative calcium entry J. Cell Sci. 114,2223-2229
  46. 24
  47. Glass, M., Northup, J. K. (1999) Agonist selective regulation of G proteins by cannabinoid CB(1) and CB(2) receptors Mol. Pharmacol. 56,1362-1369[Abstract/Free Full Text]
  48. 25
  49. Bouaboula, M., Desnoyer, N., Carayon, P., Combes, T., Casellas, P. (1999) Gi protein modulation induced by a selective inverse agonist for the peripheral cannabinoid receptor CB2: implication for intracellular signalization cross-regulation Mol. Pharmacol. 55,473-480[Abstract/Free Full Text]
  50. 26
  51. Casanova, M. L., Blazquez, C., Martinez-Palacio, J., Villanueva, C., Fernandez-Acenero, M. J., Huffman, J. W., Jorcano, J. L., Guzman, M. (2003) Inhibition of skin tumor growth and angiogenesis in vivo by activation of cannabinoid receptors J. Clin. Invest. 111,43-50[CrossRef][Medline]
  52. 27
  53. Calandra, B., Portier, M., Kerneis, A., Delpech, M., Carillon, C., Le Fur, G., Ferrara, P., Shire, D. (1999) Dual intracellular signaling pathways mediated by the human cannabinoid CB1 receptor Eur. J. Pharmacol. 374,445-455[CrossRef][Medline]
  54. 28
  55. Glass, M., Felder, C. C. (1997) Concurrent stimulation of cannabinoid CB1 and dopamine D2 receptors augments cAMP accumulation in striatal neurons: evidence for a Gs linkage to the CB1 receptor J. Neurosci. 17,5327-5333[Abstract/Free Full Text]
  56. 29
  57. Mukhopadhyay, S., Howlett, A. C. (2001) CB1 receptor-G protein association. Subtype selectivity is determined by distinct intracellular domains Eur. J. Biochem. 268,499-505[Medline]
  58. 30
  59. Mukhopadhyay, S., Shim, J. Y., Assi, A. A., Norford, D., Howlett, A. C. (2002) CB(1) cannabinoid receptor-G protein association: a possible mechanism for differential signaling Chem. Phys. Lipids 121,91-109[CrossRef][Medline]
  60. 31
  61. Rinaldi-Carmona, M., Barth, F., Heaulme, M., Shire, D., Calandra, B., Congy, C., Martinez, S., Mauruani, J., Neliat, G., Caput, D., Ferrara, P., Soubrie, P., Breliere, J. C., Le Fur, G. (1994) SR141716A, a potent and selective antagonist of the brain cannabinoid receptor FEBS Lett. 350,240-244[CrossRef][Medline]
  62. 32
  63. Showalter, V. M., Compton, D. R., Martin, B. R., Abood, M. E. (1996) Evaluation of binding in a transfected cell line expressing a peripheral cannabinoid receptor (CB2): identification of cannabinoid receptor subtype selective ligands J. Pharmacol. Exp. Ther. 278,989-999[Abstract/Free Full Text]
  64. 33
  65. Barnett-Norris, J., Hurst, D. P., Buehner, K., Ballesteros, J. A., Guarnieri, F., Reggio, P. H. (2002) Agonist alkyl tail interaction with cannabinoid CB1 receptor V6.43/I6.46 groove induces a helix 6 active conformation Int. J. Quantum Chem. 88,76-86[CrossRef]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
E. D. Giudice, L. Rinaldi, M. Passarotto, F. Facchinetti, A. D'Arrigo, A. Guiotto, M. D. Carbonare, L. Battistin, and A. Leon
Cannabidiol, unlike synthetic cannabinoids, triggers activation of RBL-2H3 mast cells
J. Leukoc. Biol., June 1, 2007; 81(6): 1512 - 1522.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Raduner, A. Majewska, J.-Z. Chen, X.-Q. Xie, J. Hamon, B. Faller, K.-H. Altmann, and J. Gertsch
Alkylamides from Echinacea Are a New Class of Cannabinomimetics: CANNABINOID TYPE 2 RECEPTOR-DEPENDENT AND -INDEPENDENT IMMUNOMODULATORY EFFECTS
J. Biol. Chem., May 19, 2006; 281(20): 14192 - 14206.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
G. K. Rao and N. E. Kaminski
Cannabinoid-Mediated Elevation of Intracellular Calcium: A Structure-Activity Relationship
J. Pharmacol. Exp. Ther., May 1, 2006; 317(2): 820 - 829.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. K. Rao and N. E. Kaminski
Induction of intracellular calcium elevation by {Delta}9-tetrahydrocannabinol in T cells involves TRPC1 channels
J. Leukoc. Biol., January 1, 2006; 79(1): 202 - 213.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. C. Sipe, N. Arbour, A. Gerber, and E. Beutler
Reduced endocannabinoid immune modulation by a common cannabinoid 2 (CB2) receptor gene polymorphism: possible risk for autoimmune disorders
J. Leukoc. Biol., July 1, 2005; 78(1): 231 - 238.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
B. L. F. Kaplan, Y. Ouyang, C. E. Rockwell, G. K. Rao, and N. E. Kaminski
2-Arachidonoyl-glycerol suppresses interferon-{gamma} production in phorbol ester/ionomycin-activated mouse splenocytes independent of CB1 or CB2
J. Leukoc. Biol., June 1, 2005; 77(6): 966 - 974.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. R. Kim, D. Y. Lee, E. S. Chung, U. T. Oh, S. U. Kim, and B. K. Jin
Transient Receptor Potential Vanilloid Subtype 1 Mediates Cell Death of Mesencephalic Dopaminergic Neurons In Vivo and In Vitro
J. Neurosci., January 19, 2005; 25(3): 662 - 671.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.1203638v1
75/5/884    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rao, G. K.
Right arrow Articles by Kaminski, N. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rao, G. K.
Right arrow Articles by Kaminski, N. E.