Published online before print February 13, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Padua University School of Medicine,
* Department of Clinical and Experimental Medicine, Clinical Immunology Branch, and Venetian Institute of Molecular Medicine (VIMM) and
Department of Occupational Medicine, Padova, Italy
1Correspondence: Padua University School of Medicine, Department of Clinical and Experimental Medicine, Clinical Immunology Branch, Via Giustiniani 2, 35128 Padova, Italy. E-mail: g.semenzato{at}unipd.it
|
|
|---|
Key Words: interstitial lung diseases T cell receptor T cell clones immunopathogenesis
|
|
|---|
(IFN-
), and Tc2 preferentially synthesize interleukin (IL)-4, IL-5, and IL-10. Recent data indicate that CD8+ T cells obtained from the BAL of patients with HP are Tc1 cells characterized by a predominance of IFN-
production [7
]. The majority of T lymphocytes use the
ß T cell receptor (TCR) to specifically recognize antigens, in association with the class I or class II major histocompatibility complex (MHC). Southern blot analyses of the molecular configuration of the TCR-ß genes (TCRB) from CD8+ T cells accumulating in the lung during HP reactions have shown a pattern characterized by the presence of rearranged bands [8
]. A bias in the expression of some TCRB variable (TCRBV) regions, as compared with the lung and the peripheral blood (PB) of normal subjects, has been demonstrated. Specifically, the overexpression of the TCRBV families #2, 3, 5, 6, 8, and 13 has been observed in the lung with respect to the blood, suggesting that the exposure to the relevant antigen could induce a bias in TCRBV expression [9
]. Furthermore, lung T cells involved in alveolitis expressed CD56 and CD57 molecules and were memory T cells (CD45R0+), providing additional proof that these lymphocytes have already met the antigen [9
]. Although the above data indicate the abnormal expression of specific TCRBV regions and the presence of T cells with similar TCR specificities in the lung, no information is yet available concerning the clonality of these cells. In the present study, we investigated, by use of sequencing analyses, the TCRBV genes of expanded CD8+ T cell populations in the lung and in PB of patients with HP. We herein demonstrate the presence of oligoclonal T cell expansions in the lung and in the blood of the patients. Taken together, these data provide evidence of an oligoclonal selection of effector CD8+ T lymphocytes in the BAL and to a lesser extent, in the PB of patients with HP.
|
|
|---|
Five nonsmoking subjects (three men and two women with an average age of 36±4.7 years; two nonsmoking, healthy persons and three subjects evaluated for complaints of cough without lung disease) were used as controls. They had no clinical symptoms and normal physical examination, chest radiographs, and pulmonary functions.
Informed consent was obtained from each HP patient and control subjects.
Recovery and handling BAL and PB cells
BAL was performed under local anesthesia according to the procedure described previously [11
]. Briefly, a total of 100150 ml sterile 0.9% saline solution (warmed to 37°C) was injected in 25 ml aliquots via fiberoptic bronchoscopy. Each aliquot was immediately aspirated and filtered through layers of surgical gauze, and the volume was measured. Cells recovered from the BAL were washed with phosphate-buffered saline (PBS), resuspended in RPMI-1640 medium (Gibco Laboratories, Grand Island, NY), and counted in a haemocytometer. A differential count of macrophages, lymphocytes, neutrophils, and eosinophils (made from total counts of 300 cells) was performed on cytocentrifuged smears stained with Wright-Giemsa.
For molecular studies, BAL cells from patients under study were initially centrifuged on a Ficoll/Hypaque density gradient, washed, and then resuspended in RPMI-1640 culture medium supplemented with 2 mM glutamine, 100 U/ml penicillin, 100 mg/ml streptomycin, and 10% of fetal calf serum (Flow Laboratories, Irvine, CA). T lymphocytes were enriched from the entire mononuclear cell suspension by rosetting with neuraminidase (Sigma Chemical Co., St. Louis, MO)-treated sheep red blood cells (SRBC) followed by repeated Ficoll/Hypaque gradient separations, as described elsewhere [8 ]. More than 95% of the cell population obtained with this procedure was represented by T lymphocytes, and more than 85% of T cells were constituted by CD8+ lymphocytes, as determined by flow cytometry analysis with CD3, CD4, and CD8 monoclonal antibodies (mAb). The cells were greater than 95% viable, as determined by the trypan blue exclusion test. In selected cases, pulmonary CD8+ T cells were separated from CD4+ T lymphocytes by magnetic separations over columns (Mini MACS, Sunnyvale, CA). Briefly, the cell suspensions obtained as above were incubated at 4°C for 30 min with magnetic beads coated with anti-CD8 mAb (OKT8, Ortho, Raritan, NJ). The CD8+ lymphocytes were then isolated and removed from CD4+ cells by applying a magnetic system to the outer wall of the columns. After this positive selection procedure, more than 97% of the cells were viable, and 9599% showed CD8+ phenotype.
PB mononuclear cells (PBMC) from patients under study were obtained from freshly heparinized blood following centrifugation on Ficoll-Hypaque gradient and washing with PBS. The cells were then resuspended in RPMI-1640 medium (Gibco, Paisle, Scotland). For molecular analyses, PB lymphocytes were further enriched following rosetting PBMC with SRBC, as reported above [12 ]. More than 98% of PB lymphocytes obtained with this procedure were represented by T lymphocytes.
In six out of the 14 HP patients with HP, BAL and PB lymphocytes were obtained at diagnosis and 6 months and 12 months after diagnosis, allowing follow-up studies.
Phenotypic evaluation
BAL and blood lymphocytes from patients and normal subjects were characterized using different mAb, including those belonging to CD3, CD4, and CD8. TCRBV segment use was analyzed with the following mAb: BV5a, b, c, BV6, BV8, and BV12 (T Cell Science, Cambridge, MA) and BV2, BV3, BV13, BV17, and BV18 (Immunotech, Marseille, France). Cells were further characterized with mAb anti-IL-4 and anti-IFN-
(PharMingen, San Diego, CA). Cells were studied for the expression of cell-surface antigens with direct, two-color analysis using fluorescein isothiocyanate-conjugated and phycoerythrin-conjugated mAb using flow cytometry analysis (FACScan, Becton Dickinson, Sunnyvale, CA) as described previously [9
]. Expression of the cytoplasmic cytokines was evaluated after permeabilization of the cell membranes with 1:2 diluted PermeaFix (Ortho) for 40 min. After permeabilization procedures, anti-IL-4 and anti-IFN-
mAb were added. Cells were analyzed using a FACScan analyzer (Becton Dickinson) and using the CellQuest program data, were processed. Ten thousand cells bearing the typical lymphocyte scatter were scored.
RNA extraction, cDNA synthesis, and TCRBV amplification by polymerase chain reaction (PCR)
Total cellular RNA was extracted using the Ultraspec I RNA isolation system (Biotecx Laboratory, Houston, TX) from 510 x 106 enriched BAL or blood lymphocytes and quantified by measuring absorbance at 260 nm. cDNA was synthesized from 2 µg total RNA at 42°C for 15 min in the presence of avian myloblastosis virus reverse transcriptase (2.5 units), using 2.5 mM oligo-d(T) primer and reaction conditions described by the manufacturer (Promega, Madison, WI).
The TCRBV gene expression in HP patients was evaluated by the method described by Choi et al. [9 13 ].
Heteroduplex analysis
Heteroduplex analysis was performed on the complete TCR repertoire of the lung and blood lymphocytes of the patients with HP. As the limited number of lung T cells recovered from the BAL of normal subjects prevented the heteroduplex analysis on the complete TCR repertoire expressed by BAL T cells, normal PB T cells were used to control the efficiency of the technique. The TCRBV PCR products (20 µl) were denatured at 95°C for 5 min and then kept at 50°C for 1 h. This temperature is permissive for the annealing between homologous (homoduplex) and heterologous DNA strands, which belong to the same TCRBV family but differ for the N and the TCRBJ regions (heteroduplex). The annealed PCR samples were separated on a 12% acrylamide gel (29:1 acrylamide/bisacrylamide) in 1x Tris-boric acid-EDTA (TBE) buffer for 6 h at 200 V. Gels were then stained with ethidium bromide (0.75 µg/ml) for 30 min in 1x TBE and were photographed under UV light. Unrelated by the TCRBV expression, polyclonal PCR products smear in the gel, and monoclonal PCR products give a definite single band. TCRBV oligoclonal pattern is characterized by the presence of more distinct bands on a smeared background.
Cloning and sequencing PCR products
TCRBV repertoires of four patients were cloned and sequenced. The PCR products were purified by cutting the band with the expected size from a 2.5% NuSieve GTG low-melting agarose gel (FMC BioProducts, Rockland, ME) and eluting the melted gel through an ion-exchange resin column (Qiagen tip5, Qiagen, Chatsworth, CA). Purified DNA fragments were ligated to pCRII vector. Plasmids were grown in INV
-F'-modified, competent Escherichia coli cells in Luria-Bertani agar plates, and several plaques for each TCRBV, which showed an oligoclonal pattern at the heteroduplex analysis, were picked up and expanded according to the manufacturers instructions (TA cloning kit, Invitrogen, San Diego, CA) for subsequent sequencing. To verify the presence of the correct insert, recombinant plaques were tested by PCR with the above-described TCRBV-specific family primers and with two primers specific for the TCRBC segments (the antisense primers ßAI, 5' CCCACTGTGCACCTCCTTCC 3', and the sense oligonucleotide Cß1, 5' GTCGCTGTGTTTGAGCCATCAGAA 3'). Plasmid DNA from TCRBV-positive plaques was sequenced with automated laser fluorescent A.L.F. DNA sequencer (Pharmacia LKB, Uppsala, Sweden) using the AutoRead sequencing kit (Pharmacia LKB) [14
]. Sequences were compared with published data of TCRBV, TCRBD, and TCRBC segments [15
16 ].
Statistical analysis
Data are expressed as mean ± SD, and comparison between values was made using the t-test. A P value <0.05 was considered significant.
|
|
|---|
but not IL-4 (data not shown). CD4+ and CD8+ subsets detected in the PB were superimposable to those observed in the controls. |
View this table: [in a new window] |
Table 1. Phenotype of Lung and Blood Lymphocytes in HP Patients and Control Subjects
|
![]() View larger version (64K): [in a new window] |
Figure 1. Heteroduplex analysis of TCRBV gene PCR products obtained from BAL and PB lymphocytes from one representative HP patient (A) and one control subject (B). TCRBV8-amplified products, obtained from the amplification of J77 and C1-632 cell RNA, were used as mono (M)- and polyclonal (P) controls and loaded, respectively, in the first two lanes of both gels. MW, Molecular weight marker pBR322.
|
![]() View larger version (59K): [in a new window] |
Figure 2. Heteroduplex analysis of TCRBV gene PCR products obtained from BAL and PB lymphocytes from two representative HP patients. The migration patterns of TCRBV2 and TCRBV7 PCR products, obtained from lung T lymphocytes of case #5, and the migration of TCRBV17 PCR product, obtained from lung T lymphocytes of case #3, showed the presence of one homoduplex band that was absent in the homologous TCRBVs of PB. This would suggest the existence of dominant T cell clones in the lung that are completely absent in the T cell populations expressing the same TCRBVs in the blood. Furthermore, the migration of TCRBV10 PCR product obtained from T cells of lung and blood of patient #3 showed the presence of homoduplex bands with different positions, suggesting that the lung and the blood have dominant T cell populations but that the clones are different.
|
|
View this table: [in a new window] |
Table 2. Junctional Amino Acid Sequences of the Indicated TCRBV Segments, Obtained from BAL and PB Lymphocytes Prepared from Three Patients with HP
|
|
View this table: [in a new window] |
Table 3. Junctional Amino Acid Sequences of the TCRBV4 Segments, Obtained from BAL CD8+ and CD4+ Lymphocytes Prepared from One Representative Patient with HP (Case #8)
|
|
View this table: [in a new window] |
Table 4. TCRBV Region Expression Values Obtained by Flow Cytometry from BAL T Cells of Patients with HP in Follow-Up Studies. The Frequency of Lymphocytes Positive for Anti-BV Region mAb Was Determined on 10,000 Cells Bearing Typical Lymphocyte Scatter. TCRBV Expression of Control Subjects Range from 1.0 to 10.0%
|
![]() View larger version (85K): [in a new window] |
Figure 3. Heteroduplex analysis of TCRBV2 gene PCR products obtained from BAL and PB lymphocytes from a representative HP patient (case #2) during exposure and 12 months after removal from antigenic exposure. The migration patterns of TCRBV2 PCR products, obtained from lung and blood T lymphocytes during the patients antigenic exposure, showed the presence of the same homoduplex bands. On the contrary, the migration patterns of TCRBV2 PCR products, obtained from lung and blood T lymphocytes of the same patient 12 months after removal from F. rectivirgula exposure, showed a polyclonal pattern of TCRBV2 PCR products, and the homoduplex bands corresponding to T cell clones were no longer detected in the lung nor in the blood. TCRBV8-amplified products, obtained from the amplification of J77 and C1-632 cell RNA, were used as mono (M)- and polyclonal (P) controls and were loaded, respectively, in the first two lanes of gels. MW, Molecular weight marker pBR322.
|
|
View this table: [in a new window] |
Table 5. Phenotype of Lung Cells of Patients with HP in Follow-Up Studies
|
|
|
|---|
Our data provide the formal proof of the presence of CD8+ T cell clones in the pulmonary microenvironment of HP patients [8 17 ]. The persistence of T lymphocytic alveolitis and the presence of clonal T populations are likely to represent the result of an antigen-driven process, triggered by epitopes derived from F. rectivirgula, i.e., the agent accounting for HP in our patients [18 ]. On the contrary, the presence of clonality in T cell expansions strongly argues against the hypothesis that a superantigen accounts for the expansions in these patients. In fact, superantigens selectively stimulate T lymphocytes to express the appropriate TCRBV segment but generate a polyclonal T cell proliferation [19 ]. Noteworthy, some T cell clones expressing different BV segments, identified in the lung and in the blood, have similar or identical CDR3 regions. As the CDR3 region is directly involved in antigen recognition, these results support the idea that T cell clones have interacted with a common epitope derived from F. rectivirgula.
The presence of oligoclonal CD8+ T cells was already demonstrated in the PB of healthy individuals [20 21 ]. For this reason, finding homoduplex bands in the blood of our control subjects was not unexpected. Our hypothesis that oligoclonality demonstrated in our HP patients is not a simple reflection of the presence of CD8+ T cell clones in the blood but that it is strictly correlated to the exposure to F. rectivirgula has been confirmed by the follow-up studies. In fact, the removal from antigenic exposure is associated with the resolution of the alveolitis and the normalization of pulmonary T cell populations and of the CD4/CD8 ratio (Table 5) . Furthermore, the heteroduplex analyses performed during the follow-up on BAL and blood T lymphocytes of HP patients removed from antigenic exposure showed a polyclonal pattern of TCRBV PCR products, and homoduplex bands previously corresponding to T cell clones were no longer detected (Fig. 3) . On the contrary, no relevant differences were shown in TCRBV expressions and TCRBV heteroduplex patterns on BAL and blood T lymphocytes of HP patients who maintained exposure to the relevant antigen and a persistent disease (without acute episodes). Thus, our data are consistent with the fact that F. rectivirgula causes an antigenic pressure, triggering the proliferation of T cells bearing a restricted TCR repertoire characterized by different TCRBV regions and sharing the same hypervariable region. Noteworthy, we demonstrated the same T cell clones in the lung and blood of the same patient, but we did not find the presence of identical CDR3 regions among the patients under study. Probably, this is a result of the antigenic complexity of F. rectivirgula and to the MHC molecules of each patient. It would be interesting to analyze the TCRBV regions in these patients following in vitro stimulation of lung and blood lymphocytes by F. rectivirgula. At present, this study is hindered by the lack of the purified antigen and/or of synthetic peptides.
A large number of antigens may cause HP; most of them belong to thermophilic actinomycetes, including F. rectivirgula, Thermoactinomyces vulgaris, Tetraselmis viridis, Thermoactinomyces saccharii, and Thermoactinomyces candidus, and are implicated in farmers lung, bagassosis, Mushroom Workers disease, and ventilation pneumonitis [22 ]. Other antigens are related to fungi, animal proteins (avian proteins accounting for Pigeon Breeders disease), and more, but currently, only few data are available about the preferential use of TCRBV regions in HP caused by antigens other than F. rectivirgula. In particular, studies have been performed on summer-type HP, the most prevalent form of HP in Japan, induced preferentially by Trichosporon cutaneum, which demonstrated a preferential TCRV gene use but no common T cell expansions [23 ]. Bird Fanciers disease, induced by avian serum proteins [24 ], has also been studied; however, these studies have not provided any formal evidence of T cell clonality (e.g., heteroduplex and sequence analyses were not assessed).
The presence of T cell clones in the BAL of patients with farmers lung is not specific for this illness. In fact, a skewing of the TCR repertoire has been detected in other interstitial lung diseases. Chronic Beryllium disease is characterized by TCRBV repertoire alterations in the BAL compared with the blood of patients and by oligoclonal expansions of the BAL CD4+ TCRBV3 subset [25 ]. A discrete use of some TCRBV segments and the TCRAV 2.3 region in the lung T lymphocytes has been demonstrated in sarcoidosis patients [9 26 ]. Some viruses, such as human immunodeficiency virus (HIV), determine a pulmonary involvement characterized by an alveolitis sustained by the proliferation of CD8+ T cells that overexpress specific TCRBV regions [27 ].
Even if the lung is the predominant organ involved in interstitial lung diseases, other organs may be affected. Chronic Beryllium disease and sarcoidosis are multisystem disorders involving the lymphatic system, skin, liver, and spleen. The evidence that T cell populations obtained from the lung and blood of HP patients express the same or similar T cell clones suggests that HP itself is not exclusively restricted to the lung but is likely to represent a systemic disease. The pathogenic relevance of this phenomenon is still unknown, and further studies are needed to assess the TCR repertoire in other organs of patients with HP and the molecular and functional mechanisms possibly involved in the distribution of T cell clones. In fact, recent data in other interstitial lung disorders, such as sarcoidosis and the T-lymphocytic alveolitis detected in patients with HIV, pointed out the central role of the cytokine/chemokine networks in the recruitment and accumulation of T cells in the lung [28 29 ]. Analysis of the functional and molecular interactions between chemokines and T cells is needed to comprehend the contribution of these molecules in triggering an antigen-specific TCR oligoclonal response in the lung and the possible distribution of clonal T cells in different organs of patients with HP.
Received May 14, 2003; revised November 13, 2003; accepted December 30, 2003.
|
|
|---|
This article has been cited by other articles:
![]() |
G. de Laurentiis, L. Vitiello, L. Racioppi, F. Perna, M. Galgani, G. Merola, P. Carratu, M. Maniscalco, S. Marsico, and M. Sofia CD8+ T-cell alveolitis in familial pulmonary alveolar microlithiasis Eur. Respir. J., July 1, 2007; 30(1): 165 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Caffieri, F. Di Lisa, F. Bolesani, M. Facco, G. Semenzato, F. Dall'Acqua, and M. Canton The mitochondrial effects of novel apoptogenic molecules generated by psoralen photolysis as a crucial mechanism in PUVA therapy Blood, June 1, 2007; 109(11): 4988 - 4994. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Fink, H. G. Ortega, H. Y. Reynolds, Y. F. Cormier, L. L. Fan, T. J. Franks, K. Kreiss, S. Kunkel, D. Lynch, S. Quirce, et al. Needs and Opportunities for Research in Hypersensitivity Pneumonitis Am. J. Respir. Crit. Care Med., April 1, 2005; 171(7): 792 - 798. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||