|
|
||||||||
Published online before print January 2, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
INSERM U364, Faculty of Medicine, Nice, France
1Correspondence: UCSF, Department of Anatomy, Genentech Hall, 600 16th Street, San Francisco, CA 94143-2140. E-mail: pleroy{at}itsa.ucsf.edu
| ABSTRACT |
|---|
|
|
|---|
Key Words: hematopoietic cells bone marrow microenvironment extracellular matrix leukemia
| INTRODUCTION |
|---|
|
|
|---|
Hematopoiesis is a complex process, which needs a precise regulation to provide the right type and number of blood cells. In addition, to acquire lineage-specific gene expression during differentiation, hematopoietic cells need to acquire a specific adhesive and migratory behavior for proper functioning. This differentiation program is governed by transcription factors [12 ] but also by the microenvironment of specific sites such as bone marrow, where adult hematopoiesis is initiated [13 ]. These sites provide a complex mix of growth factors, cytokines, and extracellular matrix (ECM) molecules, which contribute to modulating hematopoiesis in response to body needs [14 , 15 ].
Despite extensive studies of Hox genes in diverse hematopoietic cell lineages, their exact role in hematopoiesis is not yet understood, and nothing is known about how they might be involved in the deregulated processes that lead to leukemia. In general, Hox gene functions are still poorly defined, and few of their target genes have been firmly established.
However, a growing number of studies indicate that Hox genes are regulators of genes involved in cellcell and cellECM interactions [16 , 17 ] as well as the migratory behavior of cells [18 , 19 ]. To better understand the role of Hox genes in the regulation of hematopoiesis in a context of microenvironment interactions, we took advantage of an in vitro differentiation model that we had previously developed to follow the early steps of monocytic differentiation in a context, which partially recreates the bone marrow microenvironment (ref. [20 ] and in preparation). In this model, the promyelocytic cell line HL-60 is induced to differentiate toward the monocytic lineage using stromal-like cells as a feeder layer. Differentiation can be further enhanced by granulocyte macrophage-colony stimulating factor (GM-CSF) and fibronectin, and cells enhance their adhesive and migratory capacities to become highly motile cells, as are the monocytes.
Here, we report that Hox A7, a gene overexpression of which has been associated with acute myeloid leukemias in mouse and human [21 , 22 ], is expressed in HL-60 cells and down-regulated during their monocytic differentiation. We present evidence that Hox A7-sustained expression blocks the enhancement of adhesion and migration during early monocytic differentiation as well as the up-regulation of genes involved in the regulation of these processes in monocytes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Coculture and differentiation conditions
MG-63 cells were seeded in six-well plates at a density of 70,000 cells per well in 2 mL medium and were left to grow for 3 days to condition the medium. Inserts with a polyethylene terephthalate membrane, containing high-density pores of 0.4 µM size (Falcon, Becton Dickinson, Le Pont de Claix, France), were placed over MG-63 cells. HL-60 cells (1.5x106) were seeded in the upper well. After 3 days, 1 ng/mL GM-CSF was added to the culture medium, and HL-60 cells were removed from the coculture 2 days later.
Isolation of Hox A7 cDNA, construction of Hox A7 expression vectors, and obtention of HL-60 transfectants
Hox cDNAs were cloned from a KG-1 cDNA library using degenerate oligonucleotides specific to the third helix of the homeodomain [23
]. Hox A7 cDNA was determined by sequencing. Expression vectors were constructed by inserting a 1-kb Hox A7 cDNA containing the full open reading frame (ORF) between NotI and XhoI sites for sens construct and XbaI and XhoI for antisens construct of the pcDNA I neo-mammalian expression vector (Invitrogen, San Diego, CA). Constructs were verified by restriction digest and sequencing as well as by in vitro translation using a reticulocyte lysate system. For controls, cells were transfected with the empty vector. Constructs were used to transfect HL-60 cells by electroporation at 400 v and 1500 µF (Cellject, Eurogentec S.A., Belgium), and stable transfectants were selected in the presence of 800 µg/mL G418. Stable transfectants were maintained in 400 µg/mL G418.
RNA isolation and Northern blot analysis
Total RNA was extracted from HL-60 cells by using the High Pure RNA kit (Roche, Mannheim, Germany). PolyA(+) RNA was isolated using Poly (U)-Sepharose 4B (Pharmacia Biotech, Uppsala, Sweden). RNA was fractionated on 1.2% agarose formaldehyde gels. After transfer to Hybond N+ membrane (Amersham Pharmacia Biotech, Little Chalfont, UK), RNA was linked covalently by baking the membrane at 80°C for 2 h. Probes were labeled with 32P[dCTP] by random priming [24
], and hybridizations were performed in 0.5 M phosphate buffer, pH 7.2, and 7% sodium dodecyl sulfate (SDS) at 65°C and were washed with 0.1x SSC, 0.1% SDS [or 2x SSC, 0.1% SDS for glyceraldehyde 3-phosphate dehydrogenase (GAPDH)] at 65°C. Analysis and quantification of the Northern blots were done using a PhosphorImager (Storm 840, Molecular Dynamics, Sunnyvale, CA). GAPDH probe is a rat cDNA fragment [25
]. Hox A7 probe is a 300-bp DNA fragment from the region upstream of the homeobox. Other probes are DNA fragments corresponding to the 3' end of the genes ORF. They were obtained by polymerase chain reaction (PCR) amplification and purified by low-melting agarose. Probe sizes are 538 bp for Egr1, 534 bp for CD14, and 692 bp for proline-rich tyrosine kinase 2 (Pyk2).
RNase protection assays
Hox A7 RNase protection assay was done on total RNA as described previously [25
]. Probe was a 204-n RNA fragment labeled with 32P[uridine triphosphate] and synthesized by in vitro transcription with T7 RNA polymerase using a HincIIDraII Hox A7 cDNA fragment upstream of the homeodomain cloned into pBluescript SK vector. Integrin expression was studied on total RNA using the RNase protection assay kit and multiprobe template sets from PharMingen (San Diego, CA). Sets used were human integrin (hITG)1 and hITG3, and experiments were performed following PharMingens protocol. Analysis and quantification of the results were done using a Storm 840 PhosphorImager and ImageQuant software (Molecular Dynamics).
Semiquantitative reverse transcriptase (RT)-PCR analysis
Total RNA (2 µg) was reverse-transcribed for 1 h in 20 µl reaction volume using the RT avian myloblastosis virus and oligo dT as primer (Roche). Reaction was diluted in a total volume of 100 µl. The yield of cDNA was measured using the expression of the gene coding for the ribosomal protein S26 as an internal standard [26
]. S26 linear amplification range was determined by amplifying 1 µl cDNA from 2030 cycles. Above 20 cycles was necessary to detect S26, and the volume of each cDNA was adjusted to give the same PCR signal strength for S26 after 22 and 25 cycles, i.e., in its linear amplification range. Tissue transglutaminase (tTG) and Hox A7 linear amplification ranges were tested on the adjusted cDNA volume by amplifying from 30 to 40 cycles. tTG and Hox A7 required above 33 cycles for detection, and experiments were done with 35 cycles for tTG or Hox A7 and 22 cycles for S26. The internal standard and the specific studied gene were amplified in the same tube (as described by Meadus [27
]) with S26 primers added when 22 cycles were remaining for the amplification of the specific gene. Primers used were as follows: for Hox A7, forward primer, 5' ACCGACACTGAAAGCTGCCG 3', reverse primer, 5' AGGTCCTGAAGACCGCATCC 3'; for tTG, forward primer, 5' CATGGGCAGTGACTTTGACG 3', reverse primer, 5' TGATGACATTCCGGAAGCCC 3'; for S26, forward primer, 5' GCCACGTGCAGCCTATTCGC 3', reverse primer, 5' GCACCCGCAGGTCTAAATCG 3'. Annealing was done at 59°C, and the expected fragments (410 bp for Hox A7, 598 bp for tTG, and 270 bp for S26) were visualized on a 1.5% agarose gel.
Fluorescein-activated cell sorter (FACS) analysis
HL-60 cell-surface expression of CD14 and CD11b was determined by flow cytometry analysis. Cells were incubated on ice for 30 min with CD14 (LeuM3)phycoerythrin (PE; Becton Dickinson) or CD11bfluorescein isothiocyanate (FITC; Coulter Immunotech, Marseille, France) in phosphate-buffered saline (PBS) containing 3% FBS and 5 mM EDTA. Cells were fixed in 1% paraformaldehyde in PBS. The immunophenotype of cells was analyzed on a FACScan flow cytometer with CellQuest software (Becton Dickinson Immunocytometry Systems, San Jose, CA). A gate was positioned to exclude dead cells (as determined by iodure propidium), and 10,000 events per sample gated were analyzed. Isotype controls (Coulter Immunotech) were used to determine the fluorescence background.
Migration assays
Migration assays were done using a modified Boydens chamber assay. Inserts (6.3-mM diameter) with a 8-µM pore-size membrane (Falcon, Becton Dickinson) were coated with 6.5 µg/mL human fibronectin overnight at 4°C and were blocked for nonspecific fibronectin sites with 0.01% bovine serum albumin (BSA) for 1 h at 37°C. Cells were washed with medium without FBS and were resuspended in migration buffer (medium without FBS supplemented with 0.25% BSA). Migration buffer (600 µL) was put in the lower well, and
2.5 x 105 cells in 200 µL were loaded in the upper well. Migration was done 4 h at 37°C in a 5% CO2 atmosphere. The number of cells loaded in the upper well (input) and migrated to the lower well (output) was determined by direct counting. Statistical significance was assessed using a paired t-test.
Adhesion assays
Adhesion assays were done in 96-well enzyme-linked immunosorbent assay plates (Maxisorp, Nunc International, Rochester, NY) coated overnight at 4°C with 50 µL 10 µg/mL human fibronectin and were blocked for nonspecific fibronectin sites with 0.01% BSA for 1 h at 37°C. HL-60 cells (75x103) were seeded per well and let to adhere 1 h at 37°C and 5% CO2. Nonadherent cells were removed by washing with PBS/5% FBS. Adherent cells were fixed with 20% methanol and stained with 0.5% crystal violet solution in 20% methanol. After extensive washing, cells were lysed with 1% SDS, 50% ethanol. Optical density at 590 nm was determined using a plate reader (Dynex, Dynatech, Guernsey). A standard curve was done to evaluate the corresponding HL-60 cell number. Blocking of the ß1 integrins was done using the 4B4 ß1 antibody (Coulter Immunotech). Statistical significance was assessed using a paired t-test.
| RESULTS |
|---|
|
|
|---|
|
|
M, and
X subunits, which are up-regulated early during HL-60 granulocytic or monocytic differentiation [28
, 29
], as well as Egr1 and CD14 genes, which are specifically induced early during monocytic differentiation [30
, 31
], do not have a significantly different expression in Hox A7-transfected clones compared with control clones, undifferentiated or differentiated by coculture (Fig. 2B)
. No up-regulation of ß2,
M, or
X subunit genes was observed in proliferating cells, indicating that Hox A7 overexpression is not sufficient to push the cells toward the granulocytic pathway. Furthermore, sustained expression of Hox A7 does not block the onset of monocytic differentiation, as shown by the similar expression of CD14 and Egr1 genes. FACS analysis of the cell-surface expression of the antigens CD14 and CD11b (integrin subunit
M) confirmed that they are similar between controls and Hox A7-transfected cells (Fig. 2C)
. Moreover, morphological analysis of the cells after cytospin and May-Grünwald-Giemsa staining showed that Hox A7-transfected cells reach the same monocytoid/promonocyte stage as control cells (data not shown). These data indicate that the onset of monocytic differentiation is not disturbed by the sustained expression of Hox A7.
Sustained expression of Hox A7 blocks the enhancement of the migratory behavior of HL-60 cells during monocytic differentiation
Hox genes have been shown to be involved in the regulation of the migratory behavior of cells during embryonic development and more recently, in the migration of endothelial cells during angiogenesis [19
, 32
]. Migration is important for hematopoietic cells, including during hematopoiesis, and we asked if overexpression and sustained expression of Hox A7 could affect the migratory behavior of HL-60 cells. Proliferating HL-60 cells do not migrate significantly, but when we induced them to differentiate toward the monocytic lineage by coculture, they acquired a motile behavior with almost a fivefold increase in the percentage of migrating cells (Fig. 3
). When proliferating, cells overexpressing Hox A7 migrate slightly less than control cells. More importantly, the increase in the percentage of migrating cells observed after differentiation induction was largely reduced in Hox A7-transfected cells compared with controls (Fig. 3)
. These results show that sustained expression of Hox A7 partially blocks the increase of cell-motile capacities normally observed during monocytic differentiation.
|
50% as compared with control cells (Fig. 4C) . However, we found that if cells were treated to differentiate to monocytemacrophage with PMA, no difference was observed between controls and Hox A7-transfected cells (Fig. 4D)
. These results indicate that although overexpression of Hox A7 in proliferating cells does not affect adhesion, its sustained expression partially blocks the increase in cell adhesion during early monocytic differentiation. This effect is not seen with a pharmacological agent such as PMA, which bypasses the early steps of monocytic differentiation and leads to highly adherent macrophage-like cells.
|
4,
5, and ß1 is not significantly modified by Hox A7 overexpression
4ß1 and
5ß1 belong to the fibronectin receptor family [34
], and they have been described to play a major role in the regulation of monocyte trafficking within the bone marrow [35
]. In our assay, anti-ß1 antibodies almost completely blocked the adhesion of proliferating and differentiating cells (Fig. 5A
), indicating that ß1 integrins are involved in the adhesion of HL-60 cells. This effect was not seen with anti-ß2 antibodies (data not shown). Integrin subunit
4,
5, and ß1 genes are expressed in proliferating HL-60 cells, and their expression is enhanced during monocytic differentiation. However, no significant difference in RNA levels was seen between controls and Hox A7-transfected cells (Fig. 5B)
. FACS analysis of integrin cell-surface expression confirmed that there are no significant differences between control cells and Hox A7 transfectants (data not shown). These results demonstrate that Hox A7 does not directly regulate the expression of these integrins and that its effect on cell adhesion is not a result of a blockage of integrin expression.
|
|
| DISCUSSION |
|---|
|
|
|---|
4,
5, and ß1 subunit expression is not regulated by Hox A7, but in contrast, the sustained expression of Hox A7 blocks the transcriptional up-regulation of Pyk2 and tTG genes normally observed during early monocytic differentiation. Hox A7 is one of the Hox genes, which are expressed in cell lines of all hematopoietic lineages [3 ]. It is expressed in CFUGM cells [6 ], showing that expression in HL-60 cells reflects the normal expression of Hox A7 and is not a consequence of their transformed state. We did not detect any expression of Hox A7 in monocytes isolated from the blood (data not shown), which agrees with a down-regulation of its expression during monocytic differentiation. The deregulation of Hox A7 does not have a significant impact on undifferentiated cells. Only a slightly slower growth curve was observed in cells overexpressing Hox A7, and no signs of granulocytic differentiation were found. This is in contrast with the Hox A10 gene, which is induced in the monocytic cell line U937 after vitamin D3 treatment and the overexpression of which facilitates the onset of differentiation [39 ]. However, HL-60 represents a less mature stage than U937, and differentiation probably needs additional signals. Hox A7 antisense did not significantly modify the growth curve or engage the cells toward the monocytic lineage, and sense and antisense Hox A7 did not change induction of differentiation by PMA or ATRA (data not shown). Hox A7 expression is similar to that of Hox B6 in different myeloid cell lines including HL-60, and as with Hox A7, modulation of Hox B6 expression by antisense does not induce differentiation or morphological changes and does not morphologically influence the differentiation of the cells induced by ATRA or PMA [40 ]. The phorbol ester PMA is a potent inducer of HL-60 monocytic differentiation, but it acts directly on protein kinase C [41 ], over-riding the subtle regulation given by the interplay among ECM, integrin, and growth factors from the microenvironment. Vitamin D3 induces a milder differentiation toward the monocytic lineage but does not significantly enhance cell adherence [42 ]. The differentiation model we used partially recreates the bone marrow microenvironment complexity in which the monocyte differentiation occurs over several days and is modulated by a combination of factors including GM-CSF and fibronectin. With this model, we are able to follow the early steps of differentiation as well as the enhancement of adhesion and migration.
With this model, we did not observe any effects of Hox A7 on differentiation, but cells do not differentiate further than the promonocyte stage, and we cannot exclude the possibility that differentiation would be disturbed in later stages or in pathways we did not study. It has been reported that constitutive expression of Hox A9 immortalizes a late myelomonocytic progenitor in mice, preventing it from executing terminal differentiation in the presence of GM-CSF or interleukin-3 but not M-CSF or ATRA [43 ]. Hox A7 is, with Hox A9, among the main Hox genes, which have been involved in acute myeloid leukemia (AML). In BHX2 mice, their proviral activation leads to AML, and in human, they have been found overexpressed in a majority of AML, this overexpression being associated with poor prognostic cases [21 , 22 , 44 ]. In chronic myeloid leukemia, a perturbation has been found in the signaling pathway downstream of the integrinECM interactions, leading to a reduction of adhesion on fibronectin and an increase of cell migration in the bone marrow [45 , 46 ]. In AML, the proliferation disorder is mostly the result of a differentiation blockage. Although it is difficult to extrapolate our results to what happens in leukemia, Hox A7 overexpression could participate in leukemia development by modifying the cell receptivity to fibronectin and then their adhesive and migratory behavior within the bone marrow, ultimately blocking the progression of differentiation. It is worth noting that the tTG type 1 gene, which was found to be negatively regulated by Hox A7 in keratinocytes, is a marker of differentiation, and its deregulation by Hox A7 blocks keratinocyte differentiation [38 ].
Using our model, we were able to unravel an effect of Hox A7 on the regulation of the adhesive behavior of the cells. We did not observe this effect if cells were induced to differentiate with PMA, but PMA leads to a differentiation that bypasses the early steps of monocytic differentiation (including CD14 expression) and the microenvironment interactions, leading readily to a macrophage-like cell type, highly adhesive and not very motile. The effect of Hox A7 on adhesion was less important with a reduced concentration of fibronectin, underlining the importance of this ECM molecule (data not shown). Hox gene deregulation of expression has been reported to modify adhesion or migration by deregulation of integrin expression [9
, 18
], but we did not observe any down-regulation effect of Hox A7 on the expression of integrins
4ß1 and
5ß1, known to be greatly involved in fibronectin adherence and in the migration of hematopoietic cells within bone marrow [34
, 35
]. In contrast, we show that the sustained expression of Hox A7 partially blocks the up-regulation of Pyk2 and tTG genes. Hox A7 seems to act as a negative regulator of these two genes, but more investigation needs to be done to determine the exact relationship between Hox A7 and the genes Pyk2 and tTG. In particular, if Pyk2 and tTG are direct targets of Hox A7 but also specific targets, as overexpression of a Hox gene could lead to the deregulation of target genes of other Hox genes. tTG is a likely Hox A7 target gene, as it is related to the TG type 1 gene, which has been shown to be directly inhibited by Hox A7 in keratinocytes [38
], and we have performed preliminary experiments on independent clones that point to a correlation between the extent of the blockage of tTG expression and the level of expression of the exogenous Hox A7 gene. It will also be important to compare the activity of these genes products between Hox A7-transfected cells and controls and to define their precise role in the adhesion and migration dysregulations observed. Most likely, Hox A7 deregulated other genes involved in adhesion, and the blockage on adhesion observed reflects an overall effect. Pyk2 and tTG are part of the network involved in the regulation of adhesion and migration of monocytes. The proline-rich tyrosine kinase Pyk2 is a FAK homologue, and inhibition of its phosphorylation in monocytes reduces the adhesion-induced cytoskeleton reorganization as well as cell spreading and motility [36
]. The tissue tTG interacts directly with the ß1 integrin subfamily as an adhesion coreceptor for fibronectin, and its inhibition decreases monocyte adhesion and spreading on fibronectin and reduces their migratory capacities [37
]. Both genes products are part of focal adhesion complexes, structures that allow the cell to adhere to the ECM and to sense the signals in its environment. This is the first report in hematopoietic cells of a link between a Hox gene and the regulation of migratory behavior and cell adhesion on fibronectin in correlation with the expression of genes involved in cellECM interactions and downstream signaling pathways. Hematopoietic progenitor cells regulate their differentiation in part through the modulation of adhesion interactions with ECM within the bone marrow, in particular, fibronectin [47
]. These results strengthen the hypothesis that Hox genes would be central decoders and coordinators in the cells response to the external, inductive signals influencing cell identity and behavior [48
, 49
].
| ACKNOWLEDGEMENTS |
|---|
Received May 28, 2003; revised November 18, 2003; accepted November 19, 2003.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. Leroy and K. E. Mostov Slug Is Required for Cell Survival during Partial Epithelial-Mesenchymal Transition of HGF-induced Tubulogenesis Mol. Biol. Cell, May 1, 2007; 18(5): 1943 - 1952. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Carrio, G. Arderiu, C. Myers, and N. J. Boudreau Homeobox D10 Induces Phenotypic Reversion of Breast Tumor Cells in a Three-Dimensional Culture Model Cancer Res., August 15, 2005; 65(16): 7177 - 7185. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Yu, A. Datta, P. Leroy, L. E. O'Brien, G. Mak, T.-S. Jou, K. S. Matlin, K. E. Mostov, and M. M.P. Zegers {beta}1-Integrin Orients Epithelial Polarity via Rac1 and Laminin Mol. Biol. Cell, February 1, 2005; 16(2): 433 - 445. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |