PeproTech Inc.
Originally published online as doi:10.1189/jlb.0503246 on January 2, 2004

Published online before print January 2, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0503246v1
75/4/680    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leroy, P.
Right arrow Articles by Rossi, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leroy, P.
Right arrow Articles by Rossi, B.
(Journal of Leukocyte Biology. 2004;75:680-688.)
© 2004 by Society for Leukocyte Biology

Down-regulation of Hox A7 is required for cell adhesion and migration on fibronectin during early HL-60 monocytic differentiation

Pascale Leroy1, Fréderick Berto, Isabelle Bourget and Bernard Rossi

INSERM U364, Faculty of Medicine, Nice, France

1Correspondence: UCSF, Department of Anatomy, Genentech Hall, 600 16th Street, San Francisco, CA 94143-2140. E-mail: pleroy{at}itsa.ucsf.edu


arrow
ABSTRACT
 
Hox genes, which are key regulators of cell fate and pattern formation during embryogenesis, are also important regulators of hematopoiesis, and different combinations of Hox gene products are involved in lineage commitment or maturation. However, their molecular and cellular modes of action are not yet completely understood. Recent studies have indicated that Hox genes are involved in the regulation of cell–extracellular matrix (ECM) interactions and cell migration. Here, we report that Hox A7, a gene frequently overexpressed in acute myeloid leukemia, is down-regulated during HL-60 monocytic differentiation. Using a model in which HL-60 cells are induced to differentiate toward the monocytic lineage with bone marrow stromal-like cells, we demonstrate that Hox A7-sustained expression disturbs the regulation of cell adhesive and migratory capacities on fibronectin during early differentiation. We show that this is accompanied by a partial blockage of the transcriptional induction of proline-rich tyrosine kinase 2, a gene coding for a focal adhesion kinase active in monocytes, and of tissue transglutaminase, a gene coding for a fibronectin coreceptor in monocytes. This is the first report that demonstrates the involvement of a Hox gene in the regulation of adhesion and migration of hematopoietic cells and that links it to the deregulation of genes involved in cell–ECM interactions and downstream signaling pathways.

Key Words: hematopoietic cells • bone marrow microenvironment • extracellular matrix • leukemia


arrow
INTRODUCTION
 
Genes of the Hox family are key regulatory genes encoding transcription factors, which were first discovered for their role in axis patterning and cell positional identity during embryogenesis [1 ]. More recently, Hox genes have also been shown to play a role in adult tissues. In particular, numerous studies have established that they play a key role in hematopoieisis regulation [2 , 3 ]. Most Hox genes are expressed during hematopoiesis, but they have a highly dynamic pattern of expression, and particular combinations of Hox gene products are associated with specific blood–cell lineages and with distinct maturation stages [4 5 6 ]. Modulations of the expression of Hox genes in hematopoietic cells, in vitro or in vivo, indicate that they are not only involved in cell differentiation and cell fate [5 , 7 , 8 ] but also in adhesive behavior [9 ]. Moreover, Hox genes or their regulators have been found to be involved in diverse leukemias in mouse and human, where they are usually overexpressed or part of chromosomal translocations [10 ]. Furthermore, forced overexpression of Hox genes in vivo can cause leukemia [11 ].

Hematopoiesis is a complex process, which needs a precise regulation to provide the right type and number of blood cells. In addition, to acquire lineage-specific gene expression during differentiation, hematopoietic cells need to acquire a specific adhesive and migratory behavior for proper functioning. This differentiation program is governed by transcription factors [12 ] but also by the microenvironment of specific sites such as bone marrow, where adult hematopoiesis is initiated [13 ]. These sites provide a complex mix of growth factors, cytokines, and extracellular matrix (ECM) molecules, which contribute to modulating hematopoiesis in response to body needs [14 , 15 ].

Despite extensive studies of Hox genes in diverse hematopoietic cell lineages, their exact role in hematopoiesis is not yet understood, and nothing is known about how they might be involved in the deregulated processes that lead to leukemia. In general, Hox gene functions are still poorly defined, and few of their target genes have been firmly established.

However, a growing number of studies indicate that Hox genes are regulators of genes involved in cell–cell and cell–ECM interactions [16 , 17 ] as well as the migratory behavior of cells [18 , 19 ]. To better understand the role of Hox genes in the regulation of hematopoiesis in a context of microenvironment interactions, we took advantage of an in vitro differentiation model that we had previously developed to follow the early steps of monocytic differentiation in a context, which partially recreates the bone marrow microenvironment (ref. [20 ] and in preparation). In this model, the promyelocytic cell line HL-60 is induced to differentiate toward the monocytic lineage using stromal-like cells as a feeder layer. Differentiation can be further enhanced by granulocyte macrophage-colony stimulating factor (GM-CSF) and fibronectin, and cells enhance their adhesive and migratory capacities to become highly motile cells, as are the monocytes.

Here, we report that Hox A7, a gene overexpression of which has been associated with acute myeloid leukemias in mouse and human [21 , 22 ], is expressed in HL-60 cells and down-regulated during their monocytic differentiation. We present evidence that Hox A7-sustained expression blocks the enhancement of adhesion and migration during early monocytic differentiation as well as the up-regulation of genes involved in the regulation of these processes in monocytes.


arrow
MATERIALS AND METHODS
 
Cells, cell culture, and reagents
The promyelocytic human cell line HL-60 and the osteosarcoma human cell line MG-63 were purchased from American Type Culture Collection (Manassas, VA). Cells were cultured in RPMI 1640 (Gibco-BRL Life Technologies, Cergy-Pontoise, France), supplemented with 10% heat-inactivated fetal bovine serum (FBS; BioWhittaker Europe, Verviers, Belgium), 2 mM L-glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin (Gibco-BRL Life Technologies). Cells were grown in suspension in a humid 5% CO2 atmosphere at 37°C and passaged every 3 days. Concentration of viable cells was determined by direct counting with a hemocytometer using the trypan blue exclusion method. Recombinant human GM-CSF was purchased from Shering-Plough (Levallois-Perret, France). Human fibronectin and collagen 1, phorbol 12-myristate 13-acetate (PMA), all-trans retinoic acid (ATRA), and geneticin (G418) were obtained from Sigma Chemical Co. (St. Louis, MO).

Coculture and differentiation conditions
MG-63 cells were seeded in six-well plates at a density of 70,000 cells per well in 2 mL medium and were left to grow for 3 days to condition the medium. Inserts with a polyethylene terephthalate membrane, containing high-density pores of 0.4 µM size (Falcon, Becton Dickinson, Le Pont de Claix, France), were placed over MG-63 cells. HL-60 cells (1.5x106) were seeded in the upper well. After 3 days, 1 ng/mL GM-CSF was added to the culture medium, and HL-60 cells were removed from the coculture 2 days later.

Isolation of Hox A7 cDNA, construction of Hox A7 expression vectors, and obtention of HL-60 transfectants
Hox cDNAs were cloned from a KG-1 cDNA library using degenerate oligonucleotides specific to the third helix of the homeodomain [23 ]. Hox A7 cDNA was determined by sequencing. Expression vectors were constructed by inserting a 1-kb Hox A7 cDNA containing the full open reading frame (ORF) between NotI and XhoI sites for sens construct and XbaI and XhoI for antisens construct of the pcDNA I neo-mammalian expression vector (Invitrogen, San Diego, CA). Constructs were verified by restriction digest and sequencing as well as by in vitro translation using a reticulocyte lysate system. For controls, cells were transfected with the empty vector. Constructs were used to transfect HL-60 cells by electroporation at 400 v and 1500 µF (Cellject, Eurogentec S.A., Belgium), and stable transfectants were selected in the presence of 800 µg/mL G418. Stable transfectants were maintained in 400 µg/mL G418.

RNA isolation and Northern blot analysis
Total RNA was extracted from HL-60 cells by using the High Pure RNA kit (Roche, Mannheim, Germany). PolyA(+) RNA was isolated using Poly (U)-Sepharose 4B (Pharmacia Biotech, Uppsala, Sweden). RNA was fractionated on 1.2% agarose formaldehyde gels. After transfer to Hybond N+ membrane (Amersham Pharmacia Biotech, Little Chalfont, UK), RNA was linked covalently by baking the membrane at 80°C for 2 h. Probes were labeled with 32P[dCTP] by random priming [24 ], and hybridizations were performed in 0.5 M phosphate buffer, pH 7.2, and 7% sodium dodecyl sulfate (SDS) at 65°C and were washed with 0.1x SSC, 0.1% SDS [or 2x SSC, 0.1% SDS for glyceraldehyde 3-phosphate dehydrogenase (GAPDH)] at 65°C. Analysis and quantification of the Northern blots were done using a PhosphorImager (Storm 840, Molecular Dynamics, Sunnyvale, CA). GAPDH probe is a rat cDNA fragment [25 ]. Hox A7 probe is a 300-bp DNA fragment from the region upstream of the homeobox. Other probes are DNA fragments corresponding to the 3' end of the genes’ ORF. They were obtained by polymerase chain reaction (PCR) amplification and purified by low-melting agarose. Probe sizes are 538 bp for Egr1, 534 bp for CD14, and 692 bp for proline-rich tyrosine kinase 2 (Pyk2).

RNase protection assays
Hox A7 RNase protection assay was done on total RNA as described previously [25 ]. Probe was a 204-n RNA fragment labeled with 32P[uridine triphosphate] and synthesized by in vitro transcription with T7 RNA polymerase using a HincII–DraII Hox A7 cDNA fragment upstream of the homeodomain cloned into pBluescript SK vector. Integrin expression was studied on total RNA using the RNase protection assay kit and multiprobe template sets from PharMingen (San Diego, CA). Sets used were human integrin (hITG)1 and hITG3, and experiments were performed following PharMingen’s protocol. Analysis and quantification of the results were done using a Storm 840 PhosphorImager and ImageQuant software (Molecular Dynamics).

Semiquantitative reverse transcriptase (RT)-PCR analysis
Total RNA (2 µg) was reverse-transcribed for 1 h in 20 µl reaction volume using the RT avian myloblastosis virus and oligo dT as primer (Roche). Reaction was diluted in a total volume of 100 µl. The yield of cDNA was measured using the expression of the gene coding for the ribosomal protein S26 as an internal standard [26 ]. S26 linear amplification range was determined by amplifying 1 µl cDNA from 20–30 cycles. Above 20 cycles was necessary to detect S26, and the volume of each cDNA was adjusted to give the same PCR signal strength for S26 after 22 and 25 cycles, i.e., in its linear amplification range. Tissue transglutaminase (tTG) and Hox A7 linear amplification ranges were tested on the adjusted cDNA volume by amplifying from 30 to 40 cycles. tTG and Hox A7 required above 33 cycles for detection, and experiments were done with 35 cycles for tTG or Hox A7 and 22 cycles for S26. The internal standard and the specific studied gene were amplified in the same tube (as described by Meadus [27 ]) with S26 primers added when 22 cycles were remaining for the amplification of the specific gene. Primers used were as follows: for Hox A7, forward primer, 5' ACCGACACTGAAAGCTGCCG 3', reverse primer, 5' AGGTCCTGAAGACCGCATCC 3'; for tTG, forward primer, 5' CATGGGCAGTGACTTTGACG 3', reverse primer, 5' TGATGACATTCCGGAAGCCC 3'; for S26, forward primer, 5' GCCACGTGCAGCCTATTCGC 3', reverse primer, 5' GCACCCGCAGGTCTAAATCG 3'. Annealing was done at 59°C, and the expected fragments (410 bp for Hox A7, 598 bp for tTG, and 270 bp for S26) were visualized on a 1.5% agarose gel.

Fluorescein-activated cell sorter (FACS) analysis
HL-60 cell-surface expression of CD14 and CD11b was determined by flow cytometry analysis. Cells were incubated on ice for 30 min with CD14 (LeuM3)–phycoerythrin (PE; Becton Dickinson) or CD11b–fluorescein isothiocyanate (FITC; Coulter Immunotech, Marseille, France) in phosphate-buffered saline (PBS) containing 3% FBS and 5 mM EDTA. Cells were fixed in 1% paraformaldehyde in PBS. The immunophenotype of cells was analyzed on a FACScan flow cytometer with CellQuest software (Becton Dickinson Immunocytometry Systems, San Jose, CA). A gate was positioned to exclude dead cells (as determined by iodure propidium), and 10,000 events per sample gated were analyzed. Isotype controls (Coulter Immunotech) were used to determine the fluorescence background.

Migration assays
Migration assays were done using a modified Boyden’s chamber assay. Inserts (6.3-mM diameter) with a 8-µM pore-size membrane (Falcon, Becton Dickinson) were coated with 6.5 µg/mL human fibronectin overnight at 4°C and were blocked for nonspecific fibronectin sites with 0.01% bovine serum albumin (BSA) for 1 h at 37°C. Cells were washed with medium without FBS and were resuspended in migration buffer (medium without FBS supplemented with 0.25% BSA). Migration buffer (600 µL) was put in the lower well, and ~2.5 x 105 cells in 200 µL were loaded in the upper well. Migration was done 4 h at 37°C in a 5% CO2 atmosphere. The number of cells loaded in the upper well (input) and migrated to the lower well (output) was determined by direct counting. Statistical significance was assessed using a paired t-test.

Adhesion assays
Adhesion assays were done in 96-well enzyme-linked immunosorbent assay plates (Maxisorp, Nunc International, Rochester, NY) coated overnight at 4°C with 50 µL 10 µg/mL human fibronectin and were blocked for nonspecific fibronectin sites with 0.01% BSA for 1 h at 37°C. HL-60 cells (75x103) were seeded per well and let to adhere 1 h at 37°C and 5% CO2. Nonadherent cells were removed by washing with PBS/5% FBS. Adherent cells were fixed with 20% methanol and stained with 0.5% crystal violet solution in 20% methanol. After extensive washing, cells were lysed with 1% SDS, 50% ethanol. Optical density at 590 nm was determined using a plate reader (Dynex, Dynatech, Guernsey). A standard curve was done to evaluate the corresponding HL-60 cell number. Blocking of the ß1 integrins was done using the 4B4 ß1 antibody (Coulter Immunotech). Statistical significance was assessed using a paired t-test.


arrow
RESULTS
 
Hox A7 is expressed in undifferentiated HL-60 cells but is down-regulated during monocytic differentiation
Among the Hox genes that we cloned from myeloid cells, we further studied Hox A7, as this gene has been reported to be overexpressed in acute myeloid leukemia [21 , 22 ]. Hox A7 is expressed in undifferentiated HL-60, although at low levels (Fig. 1A ). This agrees with a previous PCR study, showing expression in HL-60 but also in colony-forming units (CFU)–GM cells [6 ]. It is interesting that we found that Hox A7 expression is modulated during differentiation, being up-regulated during granulocyte differentiation induced by ATRA treatment (Fig. 1B) and also by 1.3% dimethyl sulfoxide (data not shown). In contrast, Hox A7 expression is down-regulated to undetectable levels after induction of differentiation toward the monocyte–macrophage lineage with PMA (Fig. 1C) . Figure 1D shows that Hox A7 expression is also down-regulated when HL-60 cells are differentiated by coculture. In contrast to PMA treatment, there is not a complete disappearence of Hox A7, however there is a smaller proportion of cells induced to differentiate by coculture than by PMA [20 ]. This dynamic regulation of Hox A7 suggests a role for Hox A7 during granulocytic–monocytic differentiation.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Expression of Hox A7 in undifferentiated and differentiating HL-60 cells. (A) Northern blot analysis of Hox A7 expression on poly(A)+ RNA prepared from 200 µg total RNA from undifferentiated HL-60 cells. (B and C) RNase protection assay studies of Hox A7 expression during HL-60 differentiation induced by ATRA or PMA. (B) Granulocyte differentiation was induced by treatment with 106 mol/L ATRA. (C) Monocyte–macrophage differentiation was induced by treatment with 1.6 x 108 mol/L PMA. Total RNA (20 µg) was used, and quantification was done using the expression of elongation factor 1{alpha} (EF1{alpha}) as a constant internal marker. tRNA is yeast RNA used as a negative control. (D) Hox A7 expression during HL-60 differentiation induced by coculture. UD, Undifferentiated cells; Diff, cells differentiated toward the monocytic pathway by coculture treatment, as described in Materials and Methods. Analysis was done by semiquantitative PCR, as described in Materials and Methods. S26 was used to standardize cDNA amounts, and RT– is a negative control without RT. The experiment presented is representative of at least three experiments.

Overexpression of Hox A7 slightly reduces the growth of HL-60 cells but does not change the onset of monocytic differentiation
To determine the consequences of an overexpression and sustained expression of Hox A7 for monocytic differentiation, the HL-60 cell line was stably transfected with a cytomegalovirus-driven human Hox A7 cDNA expression plasmid. Growth and differentiation were analyzed in pooled cell populations. Compared with cells transfected with the vector alone, cells transfected with Hox A7 have a similar growth curve, although slightly slower (Fig. 2A ).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Effect of Hox A7 overexpression on HL-60 growth curve and onset of monocytic differentiation. (A) Growth curves of HL-60 cells transfected with the control plasmid ({circ}) or with the plasmid (p)Hox A7 ({blacktriangleup}). Results are mean ± SD of three experiments. (B) Expression analysis by Northern blot analysis [early gene response (Egr)1, CD14, and Hox A7 genes] or RNase protection assay [integrin (Int) {alpha}M, {alpha}X, and ß2 genes] on HL-60 cells transfected with the control plasmid (lanes 1) or with pHox A7 (lanes 2). HL-60 cells were undifferentiated (UD) or induced to differentiate (Diff) toward the monocytic pathway after coculture treatment, as described in Materials and Methods. Northern blot analysis was done with 15 µg total RNA, and in these conditions, only Hox A7 transcripts from the exogenous gene are detected. RNase protection assays were done with 2.5 µg total RNA using the hITG3 kit from PharMingen. GAPDH was used to standardize RNA amounts. (C) FACS analysis of the cell-surface expression of antigens CD14 and CD11b (integrin subunit {alpha}M) on undifferentiated (UD) and differentiating (Diff) cells. Comparison between control and Hox A7-transfected cells. The anti-CD14 was coupled to PE, and the anti-CD11b was coupled to FITC.

Genes coding for integrins ß2, {alpha}M, and {alpha}X subunits, which are up-regulated early during HL-60 granulocytic or monocytic differentiation [28 , 29 ], as well as Egr1 and CD14 genes, which are specifically induced early during monocytic differentiation [30 , 31 ], do not have a significantly different expression in Hox A7-transfected clones compared with control clones, undifferentiated or differentiated by coculture (Fig. 2B) . No up-regulation of ß2, {alpha}M, or {alpha}X subunit genes was observed in proliferating cells, indicating that Hox A7 overexpression is not sufficient to push the cells toward the granulocytic pathway. Furthermore, sustained expression of Hox A7 does not block the onset of monocytic differentiation, as shown by the similar expression of CD14 and Egr1 genes. FACS analysis of the cell-surface expression of the antigens CD14 and CD11b (integrin subunit {alpha}M) confirmed that they are similar between controls and Hox A7-transfected cells (Fig. 2C) . Moreover, morphological analysis of the cells after cytospin and May-Grünwald-Giemsa staining showed that Hox A7-transfected cells reach the same monocytoid/promonocyte stage as control cells (data not shown). These data indicate that the onset of monocytic differentiation is not disturbed by the sustained expression of Hox A7.

Sustained expression of Hox A7 blocks the enhancement of the migratory behavior of HL-60 cells during monocytic differentiation
Hox genes have been shown to be involved in the regulation of the migratory behavior of cells during embryonic development and more recently, in the migration of endothelial cells during angiogenesis [19 , 32 ]. Migration is important for hematopoietic cells, including during hematopoiesis, and we asked if overexpression and sustained expression of Hox A7 could affect the migratory behavior of HL-60 cells. Proliferating HL-60 cells do not migrate significantly, but when we induced them to differentiate toward the monocytic lineage by coculture, they acquired a motile behavior with almost a fivefold increase in the percentage of migrating cells (Fig. 3 ). When proliferating, cells overexpressing Hox A7 migrate slightly less than control cells. More importantly, the increase in the percentage of migrating cells observed after differentiation induction was largely reduced in Hox A7-transfected cells compared with controls (Fig. 3) . These results show that sustained expression of Hox A7 partially blocks the increase of cell-motile capacities normally observed during monocytic differentiation.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 3. Migration capacities of HL-60 cells, which control (open bars) or overexpress Hox A7 (solid bars), were studied for their migration capacities using a modified Boyden’s chamber assay, as described in Materials and Methods. The cells were undifferentiated (UD) or induced to differentiate (Diff) as described in Materials and Methods. Cell migration is shown as the percent of input cells. Results are mean ± SD of three experiments done in triplicate. **, Significantly different from the control with P< 0.01.

HL-60 cell adhesion on fibronectin is modified by Hox A7 expression but only when cells are differentiating
Hox genes have been involved in the regulation of adhesion molecules [16 ] and in one report, in the adhesion of hematopoietic cells [9 ]. Moreover, migration is dependent on adhesion [33 ]. HL-60 cells, induced to differentiate toward the monocytic pathway by coculture and treated with GM-CSF, increased their adhesive capacities, and this enhancement was significantly more important on fibronectin (Fig. 4A ). Proliferating HL-60 cells barely adhered on fibronectin, and Hox A7 overexpression did not modify their adhesiveness. However, the increase of cell adhesion on fibronectin seen in differentiating cells was significantly less important for Hox A7-transfected cells (Fig. 4B) . Individual clones were studied, and adhesion of each Hox A7-transfected clone was reduced by ~50% as compared with control cells (Fig. 4C) . However, we found that if cells were treated to differentiate to monocyte–macrophage with PMA, no difference was observed between controls and Hox A7-transfected cells (Fig. 4D) . These results indicate that although overexpression of Hox A7 in proliferating cells does not affect adhesion, its sustained expression partially blocks the increase in cell adhesion during early monocytic differentiation. This effect is not seen with a pharmacological agent such as PMA, which bypasses the early steps of monocytic differentiation and leads to highly adherent macrophage-like cells.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Adhesion of HL-60 cells on fibronectin. Adhesion is shown as the percent of loaded cells, which have adhered. (A) Comparison of the adhesion of differentiating control cells on different types of coating. Bare, Without coating; Col1, collagen 1; FN, fibronectin. (B–D) Adhesion of HL-60 cells on fibronectin, control (open bars) or overexpressing Hox A7 (solid bars), was studied using a 96-well assay as described in Materials and Methods. The cells were undifferentiated (UD) or induced to differentiate (Diff). (B and C) Cells are induced to differentiate by coculture as described in Materials and Methods and are treated by 10 ng/ml GM-CSF before adhesion. (B) Adhesion of pools of cells. (C) Adhesion of three individual clones overexpressing Hox A7 (clones "e") compared with pools of control cells (differentiating cells). (D) Adhesion of cells induced to differentiate with 1.6 108 M PMA for 24 h. Results are mean ± SD of at least three experiments. **, Significantly different from the control with P < 0.001.

Expression of the integrin subunits {alpha}4, {alpha}5, and ß1 is not significantly modified by Hox A7 overexpression
To find putative Hox A7 target genes, we first studied integrin gene expression, as Hox genes have been reported to regulate the expression of integrins in hematopoietic cells and other cell types [9 , 18 ]. Integrins {alpha}4ß1 and {alpha}5ß1 belong to the fibronectin receptor family [34 ], and they have been described to play a major role in the regulation of monocyte trafficking within the bone marrow [35 ]. In our assay, anti-ß1 antibodies almost completely blocked the adhesion of proliferating and differentiating cells (Fig. 5A ), indicating that ß1 integrins are involved in the adhesion of HL-60 cells. This effect was not seen with anti-ß2 antibodies (data not shown). Integrin subunit {alpha}4, {alpha}5, and ß1 genes are expressed in proliferating HL-60 cells, and their expression is enhanced during monocytic differentiation. However, no significant difference in RNA levels was seen between controls and Hox A7-transfected cells (Fig. 5B) . FACS analysis of integrin cell-surface expression confirmed that there are no significant differences between control cells and Hox A7 transfectants (data not shown). These results demonstrate that Hox A7 does not directly regulate the expression of these integrins and that its effect on cell adhesion is not a result of a blockage of integrin expression.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 5. Expression of ß1 integrins. (A) Blockage of adhesion by an anti-ß1 antibody. Adhesion assay was done using different dilutions of an anti-ß1 antibody on differentiating cells, which were treated 1 h before the adhesion assay. Results are expressed as a percent of adherent cells compared with cells not treated with the antibody (control) and are mean ± SD of three experiments. (B) Expression analysis of {alpha}4, {alpha}5, and ß1 integrin (Int) subunit genes. Analysis was done by RNase protection assay on HL-60 cells transfected with the control plasmid (lanes 1) or with Hox A7 (lanes 2). HL-60 cells were undifferentiated (UD) or induced to differentiate (Diff) toward the monocytic pathway after coculture treatment, as described in Materials and Methods. RNase protection assays were done on 2.5 µg total RNA using the hITG1 kit from PharMingen. L32, a ribosomal protein gene, was used to standardize for RNA amounts.

Sustained expression of Hox A7 blocks the transcriptional up-regulation of Pyk2, a focal adhesion protein tyrosine kinase (PTK), and of tissue tTG, a coreceptor for fibronectin
We then studied the expression of genes that are involved in the regulation of cell adhesion and migration. Expression of the Pyk2 gene, which codes for a focal adhesion PTK found in monocytes, was studied, as it makes a link between adhesion and subsequent migration [36 ]. Pyk2 transcriptional expression was not different between undifferentiated controls and Hox A7-transfected cells (Fig. 6A ). However, the up-regulation of Pyk2 observed during differentiation was partially blocked in Hox A7-transfected cells (Fig. 6A) . The tissue TG gene was a good candidate for a Hox A7-target gene, as it encodes an integrin-binding adhesion coreceptor for fibronectin and is up-regulated during monocytic differentiation and involved in adhesion and migration of monocytes [37 ]. Moreover, this gene was particularly interesting as it is related to the TG type 1 gene, which is directly repressed by Hox A7 in keratinocytes [38 ]. Tissue tTG was not found expressed in undifferentiated HL-60 cells but was induced during differentiation. As for Pyk2, its up-regulation was partially blocked by Hox A7 expression (Fig. 6B) . These results show that the sustained expression of Hox A7 during early monocytic differentiation partially blocks the up-regulation of genes important for the regulation of adhesion on fibronectin and subsequent migration of monocytes.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 6. Expression of Pyk2 and tTG genes in Hox A7 transfectants. Analysis was done on HL-60 cells transfected with the control plasmid (lanes 1) or with Hox A7 (lanes 2), and cells were undifferentiated (UD) or differentiating (Diff). (A) Expression of Pyk2 gene. Northern blot analysis was done with 15 µg total RNA. GAPDH was used to standardize for RNA amounts, and the same Northern was stripped and rehybridized for GAPDH. (B) Expression of tTG gene. Analysis was done by semiquantitative RT-PCR, as described in Materials and Methods. S26 was used to standardize cDNA amounts, and RT– is a negative control without RT. The experiment presented is representative of at least three experiments.


arrow
DISCUSSION
 
Hox A7 gene is expressed in undifferentiated HL-60 cells, and we show that its expression is down-regulated when cells are induced to differentiate toward the monocytic lineage and in contrast, is up-regulated when cells are differentiating toward the granulocytic lineage. Using a differentiation model in which stromal-like cells are used as a feeder layer, we are able to demonstrate that the sustained expression of Hox A7 during early monocytic differentiation blocks the increase of cell adhesion on fibronectin as well as the enhancement of cell migratory capacity that is observed during differentiation. However, no effect of Hox A7 was seen on the expression of markers characteristic of early differentiation. Searching for putative target genes of Hox A7, we found that {alpha}4, {alpha}5, and ß1 subunit expression is not regulated by Hox A7, but in contrast, the sustained expression of Hox A7 blocks the transcriptional up-regulation of Pyk2 and tTG genes normally observed during early monocytic differentiation.

Hox A7 is one of the Hox genes, which are expressed in cell lines of all hematopoietic lineages [3 ]. It is expressed in CFU–GM cells [6 ], showing that expression in HL-60 cells reflects the normal expression of Hox A7 and is not a consequence of their transformed state. We did not detect any expression of Hox A7 in monocytes isolated from the blood (data not shown), which agrees with a down-regulation of its expression during monocytic differentiation. The deregulation of Hox A7 does not have a significant impact on undifferentiated cells. Only a slightly slower growth curve was observed in cells overexpressing Hox A7, and no signs of granulocytic differentiation were found. This is in contrast with the Hox A10 gene, which is induced in the monocytic cell line U937 after vitamin D3 treatment and the overexpression of which facilitates the onset of differentiation [39 ]. However, HL-60 represents a less mature stage than U937, and differentiation probably needs additional signals. Hox A7 antisense did not significantly modify the growth curve or engage the cells toward the monocytic lineage, and sense and antisense Hox A7 did not change induction of differentiation by PMA or ATRA (data not shown). Hox A7 expression is similar to that of Hox B6 in different myeloid cell lines including HL-60, and as with Hox A7, modulation of Hox B6 expression by antisense does not induce differentiation or morphological changes and does not morphologically influence the differentiation of the cells induced by ATRA or PMA [40 ]. The phorbol ester PMA is a potent inducer of HL-60 monocytic differentiation, but it acts directly on protein kinase C [41 ], over-riding the subtle regulation given by the interplay among ECM, integrin, and growth factors from the microenvironment. Vitamin D3 induces a milder differentiation toward the monocytic lineage but does not significantly enhance cell adherence [42 ]. The differentiation model we used partially recreates the bone marrow microenvironment complexity in which the monocyte differentiation occurs over several days and is modulated by a combination of factors including GM-CSF and fibronectin. With this model, we are able to follow the early steps of differentiation as well as the enhancement of adhesion and migration.

With this model, we did not observe any effects of Hox A7 on differentiation, but cells do not differentiate further than the promonocyte stage, and we cannot exclude the possibility that differentiation would be disturbed in later stages or in pathways we did not study. It has been reported that constitutive expression of Hox A9 immortalizes a late myelomonocytic progenitor in mice, preventing it from executing terminal differentiation in the presence of GM-CSF or interleukin-3 but not M-CSF or ATRA [43 ]. Hox A7 is, with Hox A9, among the main Hox genes, which have been involved in acute myeloid leukemia (AML). In BHX2 mice, their proviral activation leads to AML, and in human, they have been found overexpressed in a majority of AML, this overexpression being associated with poor prognostic cases [21 , 22 , 44 ]. In chronic myeloid leukemia, a perturbation has been found in the signaling pathway downstream of the integrin–ECM interactions, leading to a reduction of adhesion on fibronectin and an increase of cell migration in the bone marrow [45 , 46 ]. In AML, the proliferation disorder is mostly the result of a differentiation blockage. Although it is difficult to extrapolate our results to what happens in leukemia, Hox A7 overexpression could participate in leukemia development by modifying the cell receptivity to fibronectin and then their adhesive and migratory behavior within the bone marrow, ultimately blocking the progression of differentiation. It is worth noting that the tTG type 1 gene, which was found to be negatively regulated by Hox A7 in keratinocytes, is a marker of differentiation, and its deregulation by Hox A7 blocks keratinocyte differentiation [38 ].

Using our model, we were able to unravel an effect of Hox A7 on the regulation of the adhesive behavior of the cells. We did not observe this effect if cells were induced to differentiate with PMA, but PMA leads to a differentiation that bypasses the early steps of monocytic differentiation (including CD14 expression) and the microenvironment interactions, leading readily to a macrophage-like cell type, highly adhesive and not very motile. The effect of Hox A7 on adhesion was less important with a reduced concentration of fibronectin, underlining the importance of this ECM molecule (data not shown). Hox gene deregulation of expression has been reported to modify adhesion or migration by deregulation of integrin expression [9 , 18 ], but we did not observe any down-regulation effect of Hox A7 on the expression of integrins {alpha}4ß1 and {alpha}5ß1, known to be greatly involved in fibronectin adherence and in the migration of hematopoietic cells within bone marrow [34 , 35 ]. In contrast, we show that the sustained expression of Hox A7 partially blocks the up-regulation of Pyk2 and tTG genes. Hox A7 seems to act as a negative regulator of these two genes, but more investigation needs to be done to determine the exact relationship between Hox A7 and the genes Pyk2 and tTG. In particular, if Pyk2 and tTG are direct targets of Hox A7 but also specific targets, as overexpression of a Hox gene could lead to the deregulation of target genes of other Hox genes. tTG is a likely Hox A7 target gene, as it is related to the TG type 1 gene, which has been shown to be directly inhibited by Hox A7 in keratinocytes [38 ], and we have performed preliminary experiments on independent clones that point to a correlation between the extent of the blockage of tTG expression and the level of expression of the exogenous Hox A7 gene. It will also be important to compare the activity of these genes’ products between Hox A7-transfected cells and controls and to define their precise role in the adhesion and migration dysregulations observed. Most likely, Hox A7 deregulated other genes involved in adhesion, and the blockage on adhesion observed reflects an overall effect. Pyk2 and tTG are part of the network involved in the regulation of adhesion and migration of monocytes. The proline-rich tyrosine kinase Pyk2 is a FAK homologue, and inhibition of its phosphorylation in monocytes reduces the adhesion-induced cytoskeleton reorganization as well as cell spreading and motility [36 ]. The tissue tTG interacts directly with the ß1 integrin subfamily as an adhesion coreceptor for fibronectin, and its inhibition decreases monocyte adhesion and spreading on fibronectin and reduces their migratory capacities [37 ]. Both genes’ products are part of focal adhesion complexes, structures that allow the cell to adhere to the ECM and to sense the signals in its environment. This is the first report in hematopoietic cells of a link between a Hox gene and the regulation of migratory behavior and cell adhesion on fibronectin in correlation with the expression of genes involved in cell–ECM interactions and downstream signaling pathways. Hematopoietic progenitor cells regulate their differentiation in part through the modulation of adhesion interactions with ECM within the bone marrow, in particular, fibronectin [47 ]. These results strengthen the hypothesis that Hox genes would be central decoders and coordinators in the cell’s response to the external, inductive signals influencing cell identity and behavior [48 , 49 ].


arrow
ACKNOWLEDGEMENTS
 
This work was supported by grants from the French National Institute for Health and Medical Research (INSERM) and the French National Center for Scientific Research (CNRS). The authors thank J. Auwerx for providing the KG-1 cDNA library and G. Pagès for the pCDNA I neo vector and are grateful to B. Rosen and M. Teboul for helpful comments about the manuscript.

Received May 28, 2003; revised November 18, 2003; accepted November 19, 2003.


arrow
REFERENCES
 
    1
  1. McGinnis, W., Krumlauf, R. (1992) Homeobox genes and axial patterning Cell 68,283-302[CrossRef][Medline]
  2. 2
  3. Magli, M. C., Largman, C., Lawrence, H. J. (1997) Effects of HOX homeobox genes in blood cell differentiation J. Cell. Physiol. 173,168-177[CrossRef][Medline]
  4. 3
  5. van Oostveen, J., Bijl, J., Raaphorst, F., Walboomers, J., Meijer, C. (1999) The role of homeobox genes in normal hematopoiesis and hematological malignancies Leukemia 13,1675-1690[CrossRef][Medline]
  6. 4
  7. Kongsuwan, K., Webb, E., Housiaux, P., Adams, J. M. (1988) Expression of multiple homeobox genes within diverse mammalian haemopoietic lineages EMBO J. 7,2131-2138[Medline]
  8. 5
  9. Shen, W. F., Largman, C., Lowney, P., Corral, J. C., Detmer, K., Hauser, C. A., Simonitch, T. A., Hack, F. M., Lawrence, H. J. (1989) Lineage-restricted expression of homeobox-containing genes in human hematopoietic cell lines Proc. Natl. Acad. Sci. USA 86,8536-8540[Abstract/Free Full Text]
  10. 6
  11. Sauvageau, G., Lansdorp, P. M., Eaves, C. J., Hogge, D. E., Dragowska, W. H., Reid, D. S., Largman, C., Lawrence, H. J., Humphries, R. K. (1994) Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells Proc. Natl. Acad. Sci. USA 91,12223-12227[Abstract/Free Full Text]
  12. 7
  13. Lill, M. C., Fuller, J. F., Herzig, R., Crooks, G. M., Gasson, J. C. (1995) The role of the homeobox gene, HOX B7, in human myelomonocytic differentiation Blood 85,692-697[Abstract/Free Full Text]
  14. 8
  15. Lawrence, H. J., Helgason, C. D., Sauvageau, G., Fong, S., Izon, D. J., Humphries, R. K., Largman, C. (1997) Mice bearing a targeted interruption of the homeobox gene HOXA9 have defects in myeloid, erythroid, and lymphoid hematopoiesis Blood 89,1922-1930[Abstract/Free Full Text]
  16. 9
  17. Taniguchi, Y., Komatsu, N., Moriuchi, T. (1995) Overexpression of the HOX4A (HOXD3) homeobox gene in human erythroleukemia HEL cells results in altered adhesive properties Blood 85,2786-2794[Abstract/Free Full Text]
  18. 10
  19. Buske, C., Humphries, R. K. (2000) Homeobox genes in leukemogenesis Int. J. Hematol. 71,301-308[Medline]
  20. 11
  21. Thorsteinsdottir, U., Sauvageau, G., Hough, M. R., Dragowska, W., Lansdorp, P. M., Lawrence, H. J., Largman, C., Humphries, R. K. (1997) Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia Mol. Cell. Biol. 17,495-505[Abstract]
  22. 12
  23. Shivdasani, R. A., Orkin, S. H. (1996) The transcriptional control of hematopoieis Blood 87,4025-4039[Free Full Text]
  24. 13
  25. Wolf, N. S., Trentin, J. J. (1968) Hemopoietic colony studies. V. Effect of hemopoietic organ stroma on differentiation of pluripotent stem cells J. Exp. Med. 127,205-214[Abstract]
  26. 14
  27. Tavassoli, M., Friedenstein, A. (1983) Hemopoietic stromal microenvironment Am. J. Hematol. 15,195-203[Medline]
  28. 15
  29. Metcalf, D. (1993) Hematopoietic regulators: redundancy or subtlety? Blood 82,3515-3523[Free Full Text]
  30. 16
  31. Jones, F. S., Prediger, E. A., Bittner, D. A., De Robertis, E. M., Edelman, G. M. (1992) Cell adhesion molecules as targets for Hox genes: neural cell adhesion molecule promoter activity is modulated by cotransfection with Hox-2.5 and -2.4 Proc. Natl. Acad. Sci. USA 89,2086-2090[Abstract/Free Full Text]
  32. 17
  33. Srebrow, A., Friedmann, Y., Ravanpay, A., Daniel, C. W., Bissell, M. J. (1998) Expression of Hoxa-1 and Hoxb-7 is regulated by extracellular matrix-dependent signals in mammary epithelial cells J. Cell. Biochem. 69,377-391[CrossRef][Medline]
  34. 18
  35. Boudreau, N., Andrews, C., Srebrow, A., Ravanpay, A., Cheresh, D. A. (1997) Induction of the angiogenic phenotype by Hox D3 J. Cell Biol. 139,257-264[Abstract/Free Full Text]
  36. 19
  37. Myers, C., Charboneau, A., Boudreau, N. (2000) Homeobox B3 promotes capillary morphogenesis and angiogenesis J. Cell Biol. 148,343-351[Abstract/Free Full Text]
  38. 20
  39. Rochet, N., Leroy, P., Farahi Far, D., Ollier, L., Loubat, A., Rossi, B. (2003) CAL72: a human osteosarcoma cell line with unique effects on hematopoietic cells Eur. J. Haematol. 70,43-52[CrossRef][Medline]
  40. 21
  41. Nakamura, T., Largaespada, D. A., Shaughnessy, J. D., Jr, Jenkins, N. A., Copeland, N. G. (1996) Cooperative activation of Hoxa and Pbx1-related genes in murine myeloid leukaemias Nat. Genet. 12,149-153[CrossRef][Medline]
  42. 22
  43. Afonja, O., Smith, J. E., Jr, Cheng, D. M., Goldenberg, A. S., Amorosi, E., Shimamoto, T., Nakamura, S., Ohyashiki, K., Ohyashiki, J., Toyama, K., Takeshita, K. (2000) MEIS1 and HOXA7 genes in human acute myeloid leukemia Leuk. Res. 24,849-855[CrossRef][Medline]
  44. 23
  45. Blumberg, B., Wright, C. V., De Robertis, E. M., Cho, K. W. (1991) Organizer-specific homeobox genes in Xenopus laevis embryos Science 253,194-196[Abstract/Free Full Text]
  46. 24
  47. Feinberg, A. P., Vogelstein, B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity Anal. Biochem. 132,6-13[CrossRef][Medline]
  48. 25
  49. Leroy, P., Dessolin, S., Villageois, P., Moon, B. C., Friedman, J. M., Ailhaud, G., Dani, C. (1996) Expression of ob gene in adipose cells. Regulation by insulin J. Biol. Chem. 271,2365-2368[Abstract/Free Full Text]
  50. 26
  51. Vincent, S., Marty, L., Fort, P. (1993) S26 ribosomal protein RNA: an invariant control for gene regulation experiments in eukaryotic cells and tissues Nucleic Acids Res. 21,1498[Free Full Text]
  52. 27
  53. Meadus, W. J. (2003) A semi-quantitative RT-PCR method to measure the in vivo effect of dietary conjugated linoleic acid on porcine muscle PPAR gene expression Biol. Proced. Online 5,20-28[CrossRef][Medline]
  54. 28
  55. Rosmarin, A. G., Weil, S. C., Rosner, G. L., Griffin, J. D., Arnaout, M. A., Tenen, D. G. (1989) Differential expression of CD11b/CD18 (Mo1) and myeloperoxidase genes during myeloid differentiation Blood 73,131-136[Abstract/Free Full Text]
  56. 29
  57. Miller, L. J., Schwarting, R., Springer, T. A. (1986) Regulated expression of the Mac-1, LFA-1, p150,95 glycoprotein family during leukocyte differentiation J. Immunol. 137,2891-2900[Abstract]
  58. 30
  59. Nguyen, H. Q., Hoffman-Liebermann, B., Liebermann, D. A. (1993) The zinc finger transcription factor Egr-1 is essential for and restricts differentiation along the macrophage lineage Cell 72,197-209[CrossRef][Medline]
  60. 31
  61. Goyert, S. M., Ferrero, E., Rettig, W. J., Yenamandra, A. K., Obata, F., Le Beau, M. M. (1988) The CD14 monocyte differentiation antigen maps to a region encoding growth factors and receptors Science 239,497-500[Abstract/Free Full Text]
  62. 32
  63. Studer, M., Lumsden, A., Ariza-McNaughton, L., Bradley, A., Krumlauf, R. (1996) Altered segmental identity and abnormal migration of motor neurons in mice lacking Hoxb-1 Nature 384,630-634[CrossRef][Medline]
  64. 33
  65. Strobel, E. S., Mobest, D., von Kleist, S., Dangel, M., Ries, S., Mertelsmann, R., Henschler, R. (1997) Adhesion and migration are differentially regulated in hematopoietic progenitor cells by cytokines and extracellular matrix Blood 90,3524-3532[Abstract/Free Full Text]
  66. 34
  67. Oostendorp, R. A., Dormer, P. (1997) VLA-4-mediated interactions between normal human hematopoietic progenitors and stromal cells Leuk. Lymphoma 24,423-435[Medline]
  68. 35
  69. Coulombel, L., Auffray, I., Gaugler, M. H., Rosemblatt, M. (1997) Expression and function of integrins on hematopoietic progenitor cells Acta Haematol. 97,13-21[Medline]
  70. 36
  71. Watson, J. M., Harding, T. W., Golubovskaya, V., Morris, J. S., Hunter, D., Li, X., Haskill, J. S., Earp, H. S. (2001) Inhibition of the calcium-dependent tyrosine kinase (CADTK) blocks monocyte spreading and motility J. Biol. Chem. 276,3536-3542[Abstract/Free Full Text]
  72. 37
  73. Akimov, S. S., Belkin, A. M. (2001) Cell surface tissue transglutaminase is involved in adhesion and migration of monocytic cells on fibronectin Blood 98,1567-1576[Abstract/Free Full Text]
  74. 38
  75. La Celle, P. T., Polakowska, R. R. (2001) Human homeobox HOXA7 regulates keratinocyte transglutaminase type 1 and inhibits differentiation J. Biol. Chem. 276,32844-32853[Abstract/Free Full Text]
  76. 39
  77. Rots, N. Y., Liu, M., Anderson, E. C., Freedman, L. P. (1998) A differential screen for ligand-regulated genes: identification of HoxA10 as a target of vitamin D3 induction in myeloid leukemic cells Mol. Cell. Biol. 18,1911-1918[Abstract/Free Full Text]
  78. 40
  79. Ohnishi, K., Tobita, T., Sinjo, K., Takeshita, A., Ohno, R. (1998) Modulation of homeobox B6 and B9 genes expression in human leukemia cell lines during myelomonocytic differentiation Leuk. Lymphoma 31,599-608[Medline]
  80. 41
  81. Homma, Y., Henning-Chubb, C. B., Huberman, E. (1986) Translocation of protein kinase C in human leukemia cells susceptible or resistant to differentiation induced by phorbol 12-myristate 13-acetate Proc. Natl. Acad. Sci. USA 83,7316-7319[Abstract/Free Full Text]
  82. 42
  83. Liu, M., Lee, M. H., Cohen, M., Bommakanti, M., Freedman, L. P. (1996) Transcriptional activation of the Cdk inhibitor p21 by vitamin D3 leads to the induced differentiation of the myelomonocytic cell line U937 Genes Dev. 10,142-153[Abstract/Free Full Text]
  84. 43
  85. Calvo, K. R., Sykes, D. B., Pasillas, M., Kamps, M. P. (2000) Hoxa9 immortalizes a granulocyte-macrophage colony-stimulating factor-dependent promyelocyte capable of biphenotypic differentiation to neutrophils or macrophages, independent of enforced meis expression Mol. Cell. Biol. 20,3274-3285[Abstract/Free Full Text]
  86. 44
  87. Drabkin, H. A., Parsy, C., Ferguson, K., Guilhot, F., Lacotte, L., Roy, L., Zeng, C., Baron, A., Hunger, S. P., Varella-Garcia, M., Gemmill, R., Brizard, F., Brizard, A., Roche, J. (2002) Quantitative HOX expression in chromosomally defined subsets of acute myelogenous leukemia Leukemia 16,186-195[CrossRef][Medline]
  88. 45
  89. Verfaillie, C. M., Hurley, R., Lundell, B. I., Zhao, C., Bhatia, R. (1997) Integrin-mediated regulation of hematopoiesis: do BCR/ABL-induced defects in integrin function underlie the abnormal circulation and proliferation of CML progenitors? Acta Haematol. 97,40-52[Medline]
  90. 46
  91. Bhatia, R., Munthe, H. A., Forman, S. J. (2001) Abnormal growth factor modulation of ß1-integrin-mediated adhesion in chronic myelogenous leukaemia haematopoietic progenitors Br. J. Haematol. 115,845-853[CrossRef][Medline]
  92. 47
  93. Coulombel, L., Vuillet, M. H., Leroy, C., Tchernia, G. (1988) Lineage- and stage-specific adhesion of human hematopoietic progenitor cells to extracellular matrices from marrow fibroblasts Blood 71,329-334[Abstract/Free Full Text]
  94. 48
  95. Boudreau, N., Bissell, M. J. (1998) Extracellular matrix signaling: integration of form and function in normal and malignant cells Curr. Opin. Cell Biol. 10,640-646[CrossRef][Medline]
  96. 49
  97. Cillo, C., Cantile, M., Faiella, A., Boncinelli, E. (2001) Homeobox genes in normal and malignant cells J. Cell. Physiol. 188,161-169[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
P. Leroy and K. E. Mostov
Slug Is Required for Cell Survival during Partial Epithelial-Mesenchymal Transition of HGF-induced Tubulogenesis
Mol. Biol. Cell, May 1, 2007; 18(5): 1943 - 1952.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Carrio, G. Arderiu, C. Myers, and N. J. Boudreau
Homeobox D10 Induces Phenotypic Reversion of Breast Tumor Cells in a Three-Dimensional Culture Model
Cancer Res., August 15, 2005; 65(16): 7177 - 7185.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
W. Yu, A. Datta, P. Leroy, L. E. O'Brien, G. Mak, T.-S. Jou, K. S. Matlin, K. E. Mostov, and M. M.P. Zegers
{beta}1-Integrin Orients Epithelial Polarity via Rac1 and Laminin
Mol. Biol. Cell, February 1, 2005; 16(2): 433 - 445.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0503246v1
75/4/680    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leroy, P.
Right arrow Articles by Rossi, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leroy, P.
Right arrow Articles by Rossi, B.