Published online before print January 14, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Microbiology, Immunology and Molecular Genetics, University of Kentucky College of Medicine, Lexington
1Correspondence: Department of Microbiology, Immunology and Molecular Genetics, University of Kentucky College of Medicine, 800 Rose Street, Room MS419, Lexington, Kentucky 40536-0084. E-mail: dcohen{at}pop.uky.edu
|
|
|---|
Key Words: depletion c-fms dendritic cell GFP peritoneal adhesion Yersinia pestis
|
|
|---|
Several promoters could be used to drive expression of a suicide gene in a macrophage-specific manner such as the PU.1 transcription factor [5 , 6 ], macrosialin (CD68) [8 ], and macrophage colony-stimulating factor (CSF)-1 receptor (c-fms) [9 , 10 ]. For construction of transgenic mice, we selected the c-fms promoter, which is known to promote expression of the CSF-1 receptor predominantly on cells of the mononuclear phagocyte system in the mouse, including monocytes, macrophages, dendritic cells (DC), Kuppfer cells, Langerhans cells, osteoclasts, and microglial cells [11 ]. Intron 2 of the c-fms promoter is required for macrophage-specific expression [10 ]. In recent studies [12 ], expression of an enhanced green fluorescent protein (EGFP) reporter gene driven by a 7.2-kb murine c-fms promoter fragment inclusive of intron 2 and EGFP was detected in cells of the macrophage lineage in all tissues analyzed.
The herpes simplex virus thymidine kinase (HSVtk) gene has been used as a suicide gene in transgenic mice for in vivo depletion of thymocytes [13 ], T cells [14 ], B cells [15 ], and DC [16 ]. Upon activation by HSVtk, the antiviral gancyclovir is converted into a metabolite, resulting in cellular death of mitotically active HSVtk-expressing cells. HSVtk is less than ideal for systemic depletion of macrophages, as HSVtk does not cause cell death in resting cells. Conversely, a system capable of activating proteins in an apoptosis cascade can deplete cycling and noncycling cells.
Cross-linking the human Fas receptor (CD95, APO-1) results in activation of the caspase-8 pathway, which ultimately leads to apoptosis [17
]. Spencer et al. [18
] previously described construction of a suicide gene consisting of the cytoplasmic domain of Fas linked to two copies of the FK506-binding protein (FKBP) and a myristolation-targeting peptide for in vivo depletion of T cells. The cytoplasmic Fas was membrane-tethered by the myristolation-targeting peptide, and FK1012, a covalently linked dimer of FK506, induced Fas-mediated apoptosis by dimerization of proximal transgene proteins. Another similar construct was developed with the FKBPFas segment but replaced the myristolation region with the human low-affinity nerve growth factor receptor (
LNGFR) for membrane insertion and to serve as an otherwise nonfunctional epitope tag [19
]. Ariad Pharmaceuticals (Cambridge, MA) developed AP20187 as a modified, improved form of FK1012 for dimerization of the suicide protein to activate the cytoplasmic Fas fragments and induce apoptosis in trangene-expressing cells without affecting endogenous FKBP.
Using genes for the macrophage-specific c-fms promoter EGFP and the
LNGFRFKBPFas suicide construct, we developed transgenic macrophage Fas-induced apoptosis (Mafia) mice on a C57Bl/6J background in which conditional macrophage ablation can be induced. Bicistronic expression of EGFP and the suicide gene allows for identification of transgene-expressing cells in all tissues by EGFP expression and systemic depletion of macrophage-related cells by exposure to the AP20187 dimerizer.
|
|
|---|
Transgene construction
The Fas-inducing segment of the transgene was kindly provided by Ariad Pharmaceuticals and contained the modified
LNGFR linked directly to two copies of the human FKBP and the cytoplasmic portion of human Fas protein. An internal ribosome entry site (IRES) sequence was inserted at the start codon of
LNGFR using NcoI. Dr. David Hume (University of Queensland, Australia) kindly provided the modified pGL-2 plasmid containing EGFP driven by the c-fms promoter [12
]. The entire 11.1-kb Mafia transgene was generated by inserting a cassette containing IRES
LNGFRFKBPFKBPFas into the NotI site immediately downstream from EGFP in the pGL-2 plasmid containing the c-fms promotor. The final plasmid containing the Mafia transgene was submitted to ACGT, Inc. (Northbrook, IL) for sequencing of overlapping regions at all ligation sites. The transgene (Fig. 1A
) was excised from the plasmid by FspI and partial SalI digestion and injected into pronuclei of fertilized eggs from superovulated C57Bl/6J mice, which had been mated with C57Bl/6J males. The University of Kentucky Transgenic Mouse Core Facility performed egg harvesting, microinjection, and implantation.
![]() View larger version (46K): [in a new window] |
Figure 1. Elements of the Mafia transgene and coexpression of EGFP and the suicide protein. (A) Schematic representation of the Mafia transgene. Elements include: c-fms= 7.2 kb macrophage-specific promotor for CSF-1 receptor including intron 2; EGFP; IRES; LNGFR; FKBP; Fas, human cytoplasmic domain of Fas; SV40 poly A, SV40 early mRNA polyadenylylation signal. The transgene product functions when exposed to the synthetic dimerizer, AP20187, which binds FKBP subunits of neighboring suicide proteins for dimerization and activation of the Fas subunits to initiate apoptosis. (B) Peritoneal cells from a WT and a Mafia mouse were stained with LNGFRAPC and analyzed by flow cytometry.
|
Dimerizer
AP20187 was a gift from Ariad Pharmaceuticals. Lyophilized AP20187 was dissolved in 100% ethanol at a concentration of 13.75 mg/ml or as a 1-mM stock solution in ethanol and stored at −20°C. For in vitro use, the 1-mM ethanol stock was diluted in complete culture medium to the desired concentration immediately before use. The final concentration of ethanol in the culture medium was below 0.5%. For in vivo use, peritoneal injections were prepared from the 13.75 mg/ml ethanol stock diluted to 0.55 mg/ml in an injection solution consisting of 4% ethanol, 10% PEG-400, and 1.7% Tween in water. All injections were administered to mice within 30 min of dilution into the injection solution. The volume of injection solution was adjusted according to mouse body weight to deliver 10 mg AP20187 per kg mouse. The average injection volume was 300 µl per mouse. Depletion data represent nine mice per tissue (combined from three independent studies) for 24 h data and seven mice per tissue (combined from two independent studies) for 7-day rest data.
Tissue collection
Animals were killed by CO2 asphyxiation. For single-cell preparations, fragments of liver, spleen, thymus, and brain were homogenized in 2 ml complete medium in a stomacher tissue homogenizer and then washed in complete medium or PBS before culture or analysis, respectively. Blood was obtained by cardiac puncture immediately following euthanasia. Lung tissue was digested in complete medium containing 1 µg/ml type I DNase and 20 units/ml collagenase for 45 min at 37°C before homogenization. Bone marrow was homogenized by passing marrow aspirates through a 26-gauge needle. Peritoneal lavage in killed mice was performed with 5 ml PBS. Cell preparations that contained blood were pelleted, resuspended in Tris-buffered ammonium chloride for 2 min, rinsed with 1% bovine serum albumin, 0.1% azide in PBS, filtered through a 70-µ pore-size filter, and rinsed again before staining for flow cytometric analysis. For immunohistological evaluation, fragments of liver, spleen, and lung were placed in histology cassettes and submerged in 4% paraformaldehyde overnight before embedding and staining.
Flow cytometry and cytospin
Flow cytometric analysis and sorting were performed on a MoFlo cell sorter (Cytomation, Fort Collins, CO), and collected data were analyzed using Cytomation Summit software. APC-labeled anti-
LNGFR antibody was obtained from Chromaprobe (Aptos, CA). Retinal pigment epithelial-Cy5-labeled F4/80 antibody was obtained from Serotec (Raleigh, NC). All other antibodies were obtained from BD PharMingen (Torrey Pines, CA). Cells were incubated on ice with anti-CD16/32 Fc
III/II receptor antibody for 10 min and then with an appropriate saturating concentration of labeled antibody for an additional 15 min. Cells were rinsed once in PBS before analysis. Depletion data for EGFP+ cells are based on data from regions, including only the EGFPhigh population. Sorted cells were centrifuged onto slides in a Cytospin3 (Shandon, Pittsburgh, PA) and stained with DiffQuick (Baxter Healthcare, Miami, FL).
Epidermal sheet preparation
EGFP+ Langerhans cells were visualized in wet mounts of freshly isolated epidermal sheets. Hair was removed from ears of killed mice with the use of a commercial depilation solution. Dissected ears were incubated for 2 h at 37ºC in PBS containing 1 µg/ml type I DNase and 20 units/ml collagenase. Epidermal sheets were then manually separated from the dermal layer and mounted in glycerol under a coverslip for immediate evaluation in a Zeiss Axiophot epifluorescent microscope.
PCR
DNA was extracted from tail snips by proteinase K (100 µg/ml) digestion at 56°C overnight. The Fast Start DNA Master SYBR Green I kit (Roche Molecular Biochemicals, Indianapolis, IN) was used for real-time PCR in a Roche LightCycler. Primers were custom-synthesized by Integrated DNA Technologies (Coralville, IA). Primer sequences for EGFP were 5' AGCTGACCCTGAAGTTCATCTG 3' forward and 5' ACGTTGTGGCTGTTGTAGTTGT 3' reverse; ß-actin primer sequences were intron-spanning 5' GTGGGCCGCTCTAGGCACCA 3' forward and 5' CGGTTGGCCTTAGGGTTCAGGGGGG 3' reverse. PCR was performed for 45 cycles at 95°C for 10 s, 60°C for 20 s, and 72°C for 10 s. Linearized plasmid DNA containing the Mafia transgene was used as a positive control for EGFP and as a negative control for ß-actin. PCR for EGFP and ß-actin was performed on DNA samples from pups derived from the founder line to identify EGFP+ mice.
Immunohistochemistry (IHC)
Paraformaldehyde-fixed tissues were fixed, embedded, sectioned, and stained according to protocols for Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA) and the Antigen Retrieval Citra Solution (BioGenex, San Ramon, CA). As a result of the high-background fluorescence and an observed quench in EGFP fluorescence in formalin-fixed and paraffin-imbedded tissues, samples were stained with anti-GFP rather than directly observed for EGFP fluorescence. The anti-GFPbiotin (Vector Laboratories) primary antibody was used at a 1:200 dilution.
Bacterial infection study
Mice were treated 5 days with 10 mg/kg AP20187 or a mock-injection solution. Twenty-four hours after the fifth injection, mice were anesthetized with isoflurane and retro-orbitally injected with 100 µl PBS containing 5 x 104
pgm Yersinia pestis KIM5 [21
]. This strain of Y. pestis is conditionally virulent in that it is avirulent via a peripheral route of infection but fully virulent by the intravenous (i.v.) route. The bacteria were cultured at 26°C in heart infusion broth (BD Biosciences, Franklin Kales, NJ) for at least seven generations in exponential phase before use. They were washed once in PBS and resuspended in PBS to the desired density based on A620 (where an A620 of 1 equals 6x108 cells/ml). The actual dose given to the mice was determined by plating for viable numbers [colony-forming units (CFU)] on tryptose blood agar (BD Biosciences). For blood clearance studies, mice were killed 15 min postinfection, and 50 µl blood was diluted into 450 µl dH2O, spread onto nutrient agar plates, and cultured for 48 h before colony counting. For bacterial growth studies, infected mice were killed at 15 min and 3, 6, 9, and 24 h after infection. Livers were homogenized in water and plated on nutrient agar plates for colony enumeration. Four mice/treatment group were evaluated for each time point. Both studies were repeated to confirm data presented.
Statistical methods
Depletion data were first analyzed by ANOVA with tests for multiple comparisons. Data presented for flow cytometric and bacterial growth data are the result of Students t-tests on raw percentages of populations. Data are expressed as the mean ± SEM using the "nonbiased" standard deviation method. Percent depletion was calculated by normalizing all data to mock-treated controls before calculating means and standard deviations. Significance was defined only according to Students t results of untransformed data. Level of significance (P value) is indicated where data are presented.
|
|
|---|
LNGFR, and Fas to pGL-2. Sequence alignment from the Mafia transgene matched published sequences of each cassette. The 11.1-kb transgene was excised from the pGL-2 plasmid and microinjected into the pronuclei of fertilized C57Bl/6J eggs. Pups were screened for the presence of the Mafia transgene in genomic DNA by real-time PCR and for EGFP expression by flow cytometric analysis of peritoneal macrophages. Flow cytometric analysis of EGFP expression in freshly isolated peritoneal cells demonstrated that 84% of the cells from Mafia mice were EGFP+ (Fig. 1B
, lower right panel). When EGFP-positive peritoneal macrophages from Mafia mice were also stained with anti-nerve growth factor receptor antibody to identify expression of the
LNGFR epitope tag of the suicide protein, 78% of freshly isolated peritoneal cells were double-positive for EGFP and
LNGFR, indicating that proteins for each of the bicistronic mRNAs were constitutively expressed in Mafia peritoneal macrophages (Fig. 1B
, upper right panel).
A small population of peritoneal cells from the Mafia mouse exhibited an intermediate level of EGFP expression as observed in Figure 1B
, right panels. Within this minor population of EGFPlow-expressing cells, 34.4% were also positive for
LNGFR, suggesting low-level expression of the Mafia transgene by a subset of the EGFPlow cells. In contrast, 95.1% of the EGFPhigh population coexpressed
LNGFR (Fig. 1B
, upper right panel).
Tissue distribution and cell specificity of Mafia transgene expression
EGFP expression was analyzed in single-cell suspensions from the peritoneum, blood, spleen, lung, lymph node, thymus, bone marrow, and brain to determine the distribution of EGFP+ cells in various tissues from Mafia mice (Fig. 2
). All tissues displayed a population of EGFP+ cells consistent with the expected percentage of macrophages in those tissues. The brightness of EGFP expression varied among different tissues, and the brightest cells were seen in the peritoneum and lung, where cells were five to 10 times brighter than for other tissues analyzed.
![]() View larger version (26K): [in a new window] |
Figure 2. Distribution of EGFP expression. (AH) Cells from tissues of a Mafia mouse (shaded) and a WT mouse (solid line) were analyzed by flow cytometry for EGFP expression. Histograms were graphed from events gated by forward- and side-scatter (FSC and SSC, respectively) to the region where macrophages and lymphocytes would be found.
|
![]() View larger version (32K): [in a new window] |
Figure 3. Specificity of EGFP expression. Cells from a Mafia mouse (shaded) or from a WT mouse (solid line) were stained for specific cell-surface markers. Histograms of EGFP expression were graphed from events gated by cells in the regions expressing (A) F4/80, (B) CD11b, (C) GR-1 from a peritoneal lavage, (D) CD11c, (E) B220, and (F) CD3 from spleen and (G) F4/80, (H) CD11b, (I) GR1, and (J) CD11c from whole lung.
|
In preliminary in vivo studies, it was observed that single injections with doses as high as 50 mg/kg were insufficient to cause major depletion of macrophages in Mafia mice within 72 h of treatment. However, with administration of daily injections with a dose of 10 mg/kg, depletion became evident as early as 24 h after the third injection. To determine the ability of the dimerizer to deplete macrophages in vivo, Mafia mice were given intraperitoneal (i.p.) injections for 5 consecutive days with AP20187 at a dose of 10 mg/kg or with a diluent control. It should be noted that AP20187-treated Mafia mice lost an average of 18.1 ± 6.7% of their body weight by the end of the 5-day treatment protocol. However, mock-treated Mafia, AP20187-treated WT, and mock-treated WT mice did not lose weight during the study period, indicating that the dimerizer was not generally toxic and that weight loss in dimerizer-treated Mafia mice was likely related to macrophage depletion in vivo.
Twenty-four hours after the last of the five injections, the percentage of EGFP+ cells was analyzed by flow cytometry in single-cell suspensions from a variety of tissues (Table 1 ). Viable F4/80+ cells in the peritoneal lavage decreased 86.9 ± 7.5% after the 5-day treatment. This change is different (P<0.05) from the percent loss when determined only by EGFP detection as presented in Table 1 . Compared with diluent control, AP20187 treatment reduced EGFP+ cells by greater than 90% in bone marrow and peritoneum and greater than 70% in the blood, spleen, lung, and thymus. No significant loss of EGFP+ cells was observed in the brain or lymph nodes by flow cytometry. At 24 h post-treatment, spleens exhibited no significant changes in B220+ or CD3+ cell percentages within the CD45+ population.
|
View this table: [in a new window] |
Table 1. Percent EGFP+ Cells in Mafia Mice Following Treatment with AP20187 Dimerizer
|
To determine if depleted EGFP+ cells would be re-established in tissues after completion of the dimerizer treatment protocol, Mafia mice were rested for 7 days after the last dimerizer injection and then analyzed by flow cytometry for expression of EGFP (Table 1) . Although the level of depletion was still significant on day 7, the percentage of EGFP+ cells was beginning to return in some tissues. The greatest return of EGFP+ cells occurred in the bone marrow and peritoneal cells. In contrast to the depletion of macrophages, CD11c+ splenic DC exhibited a delay in depletion. Flow cytometric analysis CD11c+ splenic cell populations at 24 h and 7 days after the 5-day AP20187 exposure indicated that DC depletion increased from 48.3 ± 13.2% to 96.8 ± 2.2% of CD11c+ cells, whereas macrophage depletion in the spleen showed no increase during that time.
As an EGFPlow population of cells was observed in the peritoneum of Mafia mice, the effect of dimerizer treatment on this population was also evaluated. At 24 h post-treatment, the low-expressing EGFP+ population in the peritoneum increased to 38.0 ± 16.3% in AP20187-treated Mafia mice, which was significantly higher (P<0.001) than the 11.8 ± 5.3% in mock-treated mice. The EGFPlow cells in the peritoneum remained elevated at 1 week post-treatment with no significant change from the increase observed at 24 h post-treatment. Fluorescent antibody staining of the EGFPlow cells in AP20187-treated mice revealed that 94.4 ± 1.9% of these cells were GR1+. The population of GR1+ GFP cells observed in untreated mice (Fig. 3)
was still present in AP20187-treated mice, and 3.1 ± 5.2% of the GFPhigh cells were GR1+. To better understand the nature of the EGFPlow cells, the EGFPhigh and EGFPlow cells from untreated and AP20187-treated Mafia mice were sorted, and cytospin preparations were observed for morphologic characterisitics (Fig. 4
). The EGFPhigh and EGFPlow subsets from normal Mafia mice had characteristics of normal macrophage morphology. The EGFPhigh cells from dimerizer-treated mice exhibited a mononuclear morphology; however, most cells displayed highly vesiculated cytoplasms with membrane blebbing characteristic of cells undergoing apoptosis. Conversely, the EGFPlow cells from treated Mafia mice exhibited characteristic neutrophil morphology including band neutrophils. By flow analysis, only 3.4 ± 1.2% of the EGFPlow neutrophils in treated Mafia mice expressed
LNGFR.
![]() View larger version (28K): [in a new window] |
Figure 4. Cytospin preparations of sorted EGFP+ cells. Cells were obtained from untreated Mafia-sorted populations of (A) EGFPhigh and (B) EGFPlow cells and from AP20187-treated Mafia-sorted populations of (C) EGFPhigh and EGFPlow cells. Cytospin samples were stained with DiffQuick.
|
![]() View larger version (136K): [in a new window] |
Figure 5. IHC detection of EGFP expression and depletion within tissues. Mafia miced were treated with diluent or 10 mg/kg AP20187 for 5 days, and tissue sections from (A, B) spleen, (C, D) liver, and (E, F) lung were stained with anti-GFPbiotin and antibiotinhorseradish peroxidase. Macrophages stained dark brown (arrows).
|
![]() View larger version (123K): [in a new window] |
Figure 6. Epifluoresence of epidermal sheet wet-mount preparations from ears. Samples were collected from mock-treated WT mice (A, B), mock-treated Mafia mice (C, D), and AP20187-treated Mafia mice (E, F) 1 week post-treatment. (F) Arrows identify residual cell bodies that expressed low levels of EGFP.
|
![]() View larger version (25K): [in a new window] |
Figure 7. Macrophage depletion and bacterial infection. (A) Bacterial clearance from blood. AP20187-treated and mock-treated WT and Mafia mice were challenged with Y. pestis by i.v. injection. Mice were killed after 15 min, and blood samples were plated to determine the viable bacteria numbers as CFU per ml blood. CFU of AP20187-treated Mafia mice were significantly higher than the three control groups, whether compared individually or collectively (P=0.018). (B) Bacterial growth in liver. At various time-points after i.v. infection of Y. pestis, homogenized liver extracts from AP20187-treated and mock-treated Mafia mice were plated to determine the viable numbers as CFU per gram of liver. *, P< 0.05; #, P< 0.01. N.S., Not significant.
|
In a separate study, the bacterial load was determined in livers of AP20187-treated and mock-treated Mafia mice at various times after infection (Fig. 7B) . Fifteen minutes after infection, the amount of bacteria in the liver was similar for mock-treated and macrophage-depleted mice. However, at all subsequent time-points, the amount of bacteria in the liver was significantly higher in AP20187-treated Mafia mice.
Abnormalities in Mafia mice after macrophage/DC depletion
Treatment of Mafia mice with AP20187 caused the development of several gross abnormalities, which may suggest unexpected roles for macrophages and/or DC during homeostatic conditions in the immune system. Mafia mice experienced severe splenomegaly, lymphadenopathy, and thymic atrophy following depletion of macrophages and DC. Twenty-four hours after the last injection of AP20187, spleens were significantly enlarged 1.6 ± 0.4-fold compared with Mafia mice treated with diluent. Splenomegaly continued following completion of the dimerizer treatment protocol, increasing to 7.6 ± 2.3-fold larger spleens 7 days after treatment. Histological evaluation indicated that extensive extramedullary hematopoiesis was occurring in the spleens of macrophage/DC-depleted mice (Fig. 8A
). At 24 h and 7 days after the depletion protocol, 100% of spleens exhibited islands of extramedullary hematopoiesis with megakaryocytosis and severe or moderate disruption of follicular morphology. Islands of extramedullary hematopoiesis were also observed in the livers of depleted Mafia mice; however, the extent of tissue morphology disruption was not as severe as in the spleen. Spleens from diluent-treated Mafia mice displayed only occasional and very minor extramedullary hematopoiesis, which was no greater than that observed in diluent-treated or AP20187-treated WT mice, indicating that the hematopoietic response in AP20187-treated Mafia mice was related to the systemic depletion of macrophages and DC.
![]() View larger version (127K): [in a new window] |
Figure 8. Altered splenic structure and peritoneal adhesions. (A) Spleens from mock-treated and 10 mg/kg AP20187-treated Mafia mice were harvested 24 h after the 5-day treatment and stained with hematoxalin and eosin to observe splenic structure. Disruption of follicles was observed in the treated mouse (brackets), and zones of extramedullary hematopoiesis were also identifiable (arrows). (B) Peritoneal adhesions firmly attached the liver of a treated Mafia mouse to its diaphragm (left panel) and the spleen to the peritoneal wall (right panel). The adhesions developed 12 weeks post-treatment and were opaque and fibrous in appearance (arrows).
|
Enlarged lymph nodes were also evident in macrophage/DC-depleted mice. In histological sections, the lymphadenopathy appeared as a result of an increase in cell number rather than fluid accumulation. However, the morphology of follicular, paracortical, and medullary regions of the lymph nodes appeared normal, and there was no evidence of extracellular hematopoiesis.
Severe thymic atrophy was observed in AP20187-treated Mafia mice but not in the diluent-treated Mafia or any group of treated WT mice. Twenty-four hours after the depletion protocol, thymi were decreased in weight 60.3 ± 18.7% compared with those from diluent-treated Mafia mice. Moreover, 7 days after depletion, fewer than 25% of AP20187-treated Mafia mice possessed any evidence of an identifiable thymus.
An unexpected abnormality was the development of peritoneal adhesions in
80% of adult Mafia mice within 7 days after completion of the depletion protocol. The most prominent site of peritoneal adhesions was between the superior surface of the liver and the inferior surface of diaphragm (Fig. 8B)
. Evidence of adhesions was observed at many other locations within the peritoneum, including between the lateral or dorsal side of the spleen to the peritoneal wall. In spite of the frequency of observation for peritoneal adhesions, pericardial adhesions were rarely observed, although the pericardial sac appeared increased in thickness and more opaque following AP20187 treatment.
|
|
|---|
LNGFRFKBPFas construct expressed under control of the c-fms promoter containing intron 2 for specific expression in cells of the macrophage lineage. Maximal depletion of macrophages in vivo required multiple daily injections of the AP20187 dimerizer. Depletion appeared to be reversible in that EGFP+ cells began to return by 7 days after cessation of treatment. Expression of the Mafia transgene occurred primarily in macrophages and DC. A similar pattern of expression was previously observed in transgenic mice containing the c-fms promoter and EGFP [12
]. Mafia mice did not express EGFP in B cells or T cells as determined by flow cytometry analysis of B220 and CD3 expression.
Cytospin preparations of sorted EGFPlow cells in our laboratory indicated that neutrophils are the primary cell type present in the EGFPlow population of treated Mafia mice. The large influx of these granulocytes was not surprising, as macrophages have been shown to release neutrophil chemotactic factors when undergoing Fas-induced apoptosis [22
]. In addition, it was not unexpected to see some EGFP expression in neutrophils, as macrophages and granulocytes share a common progenitor cell, which is dependent on CSF-1 [5
, 6
, 12
]. However, mature granulocytes do not express the CSF-1 receptor [23
], suggesting that EGFP protein in neutrophils was not likely a result of continued transcription of the transgene. Sasmono et al. [12
] also detected c-fms-driven EGFP expression in tissue-resident granulocytes, although previous studies have shown no expression of c-fms mRNA or protein in these cells [24
, 25
]. These authors suggested that the half-life of EGFP is long and that EGFP protein may consequently persist in mature granulocytes, although the c-fms promoter is inactive. Three separate populations of neutrophils were observed in Mafia mice. In untreated Mafia mice, the only population observed was GR1+ EGFP. However, following treatment, two EGFPlow populations of neutrophils were also observed. The predominant EGFPlow fraction did not coexpress the suicide gene, as indicated by the lack of the
LNGFR epitope tag and is presumed to be derived from an earlier influx of neutrophils from the bone marrow in which the suicide protein has decayed. A minor population of EGFPlow neutrophils (less than 3% of the EGFPlow population) also expressed the suicide protein and is assumed to be the most recent emigrants from the marrow in which the suicide protein has yet to turn over. These data suggest that the membrane-bound suicide protein, as with the CSF-1 receptor, may have a higher turnover rate than the cytoplasmic EGFP protein. It is important to note that dimerizer treatment only depleted macrophages and DC, and the level of granulocytes in the peritoneal cavity increased.
The c-fms gene is expressed in macrophages and DC [20 ]; thus, expression of EGFP and the FKBPFas suicide gene in DC of Mafia mice was expected. Likewise, in studies by Sasmono et al. [12 ], transgenic mice expressing EGFP under the c-fms promoter expressed EGFP in DC in the spleen and skin. CD11c+ DC in the spleen were observed to express the Mafia transgene; however, the level of EGFP expression was tenfold lower than in macrophages. Langerhans cells in epidermal sheets from Mafia mice expressed visible amounts of EGFP, and peritoneal treatment with AP20187 caused nearly complete loss of Langerhans cells by 1 week post-treatment. It is possible that dimerizer treatment induced migration of Langerhans cells from the skin; however, we suggest that migration is not the cause of the loss of these cells, as a concomitant increase in DC within lymph nodes and spleen was not observed and as areas of the epidermal sheets contained what appeared to be amorphous residual bodies, which were weakly EGFP+ and were likely to be dead or dying Langerhans cells. Hume et al. [23 ] also demonstrated c-fms EGFP transgene expression in Langerhans cells in skin, presumably immature DC, and in myeloid DC in lymph nodes.
Activation of immature DC can down-regulate expression of the c-fms gene, which may help in the commitment of immature DC into functional APC [24 , 26 ]. It is possible that the CD11c+ EGFP+ cells analyzed in the spleen of Mafia mice are of a more mature or activated phenotype, which has down-regulated c-fms expression, causing a lower level of EGFP expression than observed in macrophages. As extensive analysis of DC subpopulations has not yet been performed in Mafia mice, it is unknown whether EGFP expression is low in all DC populations. Reduced expression of the Mafia transgene did not prevent elimination of CD11c+ DC by AP20187 treatment; however, the elimination of DC in the spleen was slower than the loss of macrophages. It is possible that the lower transgene expression level in DC is responsible for the slower rate of cell depletion. Kamath et al. [27 ] demonstrated that CD8+ DC in the spleen have a 3-day turnover rate, which makes it equally possible that depletion of macrophages removed a source of DC precursors, and the natural turnover of DC leads to an effective loss. Regardless of the mechanism, the depletion level of DC in the spleen and Langerhans cells in the skin was dramatic, approaching 100% by day 7 after completion of dimerizer treatment.
EGFP+ cells were reduced in all organs evaluated, except for the brain and lymph nodes. Currently, no information has been reported regarding the in vivo distribution of AP20187. It is possible that the dimerizer cannot effectively penetrate the blood-brain barrier and that another mode of administration may be necessary for effective distribution to the brain. Similarly, AP20187 may not reach the lymphatic drainage in sufficient amounts to induce depletion of EGFP+ cells in lymph nodes. Preliminary studies of alternate routes of AP20187 treatment suggest that at least partial depletion (
50%) can be achieved in the brain using an i.v. route. Additional studies will be needed to optimize the dimerizer treatment protocol to achieve depletion in lymph nodes.
The cause of thymic atrophy in AP20187-treated Mafia mice is not yet determined. Flow cytometric analysis showed that the predominant cell population lost at 24 h post-treatment was the CD4+CD8+ double-positive thymocyte fraction, suggesting that thymic atrophy in macrophage/DC-depleted mice may be a result of a stress response during depletion. Glucocorticoid-dependent and -independent processes can cause thymic atrophy [28
, 29
]. Lipopolysaccharide can induce apoptosis of lymphocytes in a tumor necrosis factor
(TNF-
)-dependent manner [30
], and liver injury by Fas-induced apoptosis has been shown to result in elevated TNF-
serum levels [31
]. However, analysis of serum TNF-
by enzyme-linked immunsorbent assay indicated that TNF-
levels were not significantly different in AP20187-treated Mafia mice compared with other treatment groups (data not shown), suggesting that thymic atrophy was not caused by a release of TNF-
. Further investigation is needed to determine if glucocorticoids are released during dimerizer treatment to contribute to thymic atrophy in Mafia mice or whether atrophy occurs as a direct result of macrophage/DC depletion.
Billia et al. [32 ] reported expression of c-fms in TER119+ erythroid precursor cells as well as in multipotent stem cells, which is in agreement with the EGFP expression in TER119+ cells and lin c-kit+ sca-I+ cells in the bone marrow of Mafia mice. Considering that only 14% of lin c-kit+ sca-I+ cells expressed EGFP by flow cytometric analysis, the significant loss in this population at 1 week post-depletion may be a result of more than the depletion of EGFP+ cells by dimerizer. Likewise, although only 18% of TER119+ bone marrow cells expressed EGFP, 97% of all TER119+ erythrocyte precursors were lost by 1 week post-depletion. These observations may indicate that resident macrophages and/or DC could act as important regulators of hematopoiesis and that in their absence, hematopoietic cell development in the marrow may not proceed normally. Studies are in progress to address the role of resident marrow macrophages and DC in the regulation of hematopoeisis.
Depletion successfully impaired the ability of Mafia mice to clear bacteria from the blood and to control bacterial growth in the liver. It has previously been shown that mice with competent immune systems clear bacteria such as Listeria monocytogenes, Salmonella typhimurium, and Yersinia enterocolitica from blood within 15 min of i.v. exposure [33 , 34 ]. Bacterial clearance from blood is assumed to be primarily a result of macrophages [33 ], and control of bacterial growth in tissues is dependent in part on resident and inflammatory macrophages. Dimerizer-treated Mafia mice did not clear the challenge bacteria from the blood at the same rate as mock-treated mice. Although bacterial clearance from the blood was altered, bacteria still accumulated in the liver, and AP20187-treated mice exhibited a more aggressive bacterial growth pattern in the liver compared with mock-treated Mafia, thus demonstrating a functional loss in vivo as a result of macrophage depletion. Additional functional studies are currently underway to investigate other aspects of the inductive and effector phases of the immune response in macrophage-depleted Mafia mice.
Previous reports of knockouts of the CSF-1 gene (Csf1op/Csf1op) or the CSF-1 receptor gene (Csf1r/Csf1r) have demonstrated embryonic deficiencies in macrophage development [11 , 35 ]. In both studies, a variety of gross abnormalities were evident in the off-spring mice, including low body weight, low growth rate, skeletal abnormalities, poor fertility, lack of tooth development, and developmental problems in neural and dermal tissues. None of these phenotypes was present in Mafia mice, and mice remain normal throughout adulthood, as macrophages remain at normal levels until administration of dimerizer. However, following dimerizer treatment, several abnormalities were evident in Mafia mice, which are likely related to the loss of macrophages and DC.
Preliminary studies not presented in this report have indicated that depleted Mafia mice display reduced bone resorptive activity within 7 days following dimerizer treatment. A similar loss in activity was seen in Csf1op/Csf1op) and (Csf1r/Csf1r) mice, which led to increased bone density in the first few months of age. Studies in Mafia mice exposed to prolonged dimerizer treatment will be necessary to determine the effects of chronic depletion on bone metabolism.
An intriguing observation in (Csf1op/Csf1op) and (Csf1r/Csf1r) mice is the finding of CSF-1-independent macrophage populations. Although circulating levels of CSF-1 were undetectable in (Csf1op/Csf1op) mice, some tissues still exhibited a small number of macrophages, which were interpreted as the existence of a macrophage population whose development is independent of CSF-1. Not all F4/80+ macrophages in Mafia mice were EGFP+. Furthermore, macrophage depletion was not complete in all tissues from dimerizer-treated Mafia mice, and a comparison of F4/80+ versus EGFP+ populations demonstrated that a greater portion of F4/80+ cells survived the treatment than EGFP+ cells. Whether the failure to completely eliminate macrophages in some tissues is a result of a subpopulation of macrophages in Mafia mice, which never expressed or lost the ability to express c-fms and/or the suicide gene, remains to be determined. It is interesting that DC-rich regions in lymphoid organs and in skin were unaltered in (Csf1op/Csf1op) mice, suggesting that c-fms expression may not be necessary for maintenance of DC.
An unexpected finding was the development of peritoneal adhesions in most Mafia mice following dimerizer treatment. Peritoneal adhesions are an important complication associated with abdominal or pelvic surgery, occurring in more than 90% of patients after major abdominal surgery and in 55100% of the patients after pelvic surgery [36 ]. The role of macrophages in the pathogenesis of adhesions is unclear, and studies with conflicting conclusions have reported that macrophages protect from or promote adhesion development [37 , 38 ]. Induction of adhesions is thought to occur at sites of injury to the mesothelial layer covering peritoneal tissues. Deposition of fibrin at injured sites and a concurrent decrease in fibrinolytic activity contribute to adhesion development. Macrophages appear to be a major source of fibrinolytic activity in the peritoneal cavity, and this activity is decreased by peritoneal trauma [39 , 40 ]. In one study, post-operative adhesion formation was reduced in a rabbit model when peritoneal macrophage numbers were increased before peritoneal injury [41 ]. The mesothelium appears to play an important role in the regulation of coagulation and fibrin formation on serosal surfaces [42 , 43 ]. Resident peritoneal macrophages constitutively produce high levels of plasminogen-activator inhibitor [44 ] and thus, under homeostatic conditions, would be protective against fibrin deposition in the peritoneal cavity. The observation of adhesion development in dimerizer-treated Mafia mice suggests that macrophages play a protective role and that depletion contributes to the development of peritoneal adhesions. Mock-treated Mafia mice as well as AP20187-treated WT mice did not develop adhesions, and the adhesions in treated Mafia mice occurred in regions not directly at the site of i.p. injection. Adhesion formation has not been reported in mice treated with chlodronate for macrophage depletion. It is possible that i.p.injection of AP20187 might more efficiently eliminate peritoneal macrophages and macrophages residing within the mesothelium, allowing a threshold to be reached that permits adhesion development. Preliminary histological evaluation of liver and spleen in dimerizer-treated Mafia mice indicated that the mesothelial layer was disrupted in the areas of adhesion development but appeared intact at other regions of the mesothelium. It is unknown whether this disruption was an initiation event for adhesion formation or whether it was a consequence of adhesion development. However, it remains a possibility that dimerizer treatment also causes injury to mesothelial cells and that adhesions develop as a result of a combined effect of macrophage loss and mesothelial damage. Additional studies will be required to determine if macrophages resident in the peritoneal cavity and/or mesothelial lining are playing a direct role in protecting the peritoneum from adhesion formation during homeostatic conditions and whether mesothelial cells are being injured during dimerizer treatment.
In conclusion, systemic depletion of macrophages and DC can be transiently induced in Mafia mice following cell-specific activation of transgene-associated Fas activity. Studies with this new, transgenic mouse line should enable elucidation of macrophage/DC functions in tissues not easily affected by other depletion approaches. The constitutive expression of EGFP in these cells also allows easy identification in tissues, as well as flow cytometric sorting to purify macrophages and DC from any tissue. Adoptive transfer of purifed EGFP+ cells, monitoring of cell migration, and subsequent depletion of transferred cells should enhance the ability of investigators to better define the immunological and physiological functions of macrophages and DC in vivo.
Received September 24, 2003; revised December 16, 2003; accepted December 18, 2003.
|
|
|---|
This article has been cited by other articles:
![]() |
K. A. Markey, T. Banovic, R. D. Kuns, S. D. Olver, A. L. J. Don, N. C. Raffelt, Y. A. Wilson, L. J. Raggatt, A. R. Pettit, J. S. Bromberg, et al. Conventional dendritic cells are the critical donor APC presenting alloantigen after experimental bone marrow transplantation Blood, May 28, 2009; 113(22): 5644 - 5649. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Chinnery, E. C. Carlson, Y. Sun, M. Lin, S. H. Burnett, V. L. Perez, P. G. McMenamin, and E. Pearlman Bone Marrow Chimeras and c-fms Conditional Ablation (Mafia) Mice Reveal an Essential Role for Resident Myeloid Cells in Lipopolysaccharide/TLR4-Induced Corneal Inflammation J. Immunol., March 1, 2009; 182(5): 2738 - 2744. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. C. Peters, J. G. Egen, N. Secundino, A. Debrabant, N. Kimblin, S. Kamhawi, P. Lawyer, M. P. Fay, R. N. Germain, and D. Sacks In Vivo Imaging Reveals an Essential Role for Neutrophils in Leishmaniasis Transmitted by Sand Flies Science, August 15, 2008; 321(5891): 970 - 974. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Albee, B. Shi, and H. Perlman Aspartic protease and caspase 3/7 activation are central for macrophage apoptosis following infection with Escherichia coli J. Leukoc. Biol., January 1, 2007; 81(1): 229 - 237. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Qualls, A. M. Kaplan, N. van Rooijen, and D. A. Cohen Suppression of experimental colitis by intestinal mononuclear phagocytes J. Leukoc. Biol., October 1, 2006; 80(4): 802 - 815. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Schwertfeger, W. Xian, A. M. Kaplan, S. H. Burnett, D. A. Cohen, and J. M. Rosen A Critical Role for the Inflammatory Response in a Mouse Model of Preneoplastic Progression Cancer Res., June 1, 2006; 66(11): 5676 - 5685. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Tabas Consequences and Therapeutic Implications of Macrophage Apoptosis in Atherosclerosis: The Importance of Lesion Stage and Phagocytic Efficiency Arterioscler. Thromb. Vasc. Biol., November 1, 2005; 25(11): 2255 - 2264. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Colombo and A. Mantovani Targeting Myelomonocytic Cells to Revert Inflammation-Dependent Cancer Promotion Cancer Res., October 15, 2005; 65(20): 9113 - 9116. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Philipovskiy, C. Cowan, C. R. Wulff-Strobel, S. H. Burnett, E. J. Kerschen, D. A. Cohen, A. M. Kaplan, and S. C. Straley Antibody against V Antigen Prevents Yop-Dependent Growth of Yersinia pestis Infect. Immun., March 1, 2005; 73(3): 1532 - 1542. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Cailhier, M. Partolina, S. Vuthoori, S. Wu, K. Ko, S. Watson, J. Savill, J. Hughes, and R. A. Lang Conditional Macrophage Ablation Demonstrates That Resident Macrophages Initiate Acute Peritoneal Inflammation J. Immunol., February 15, 2005; 174(4): 2336 - 2342. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||