Journal of Leukocyte Biology Myeloid cells, immune suppression, tumor immunology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0803388 on December 4, 2003

Published online before print December 4, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0803388v1
75/3/460    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Báfica, A.
Right arrow Articles by Sher, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Báfica, A.
Right arrow Articles by Sher, A.
(Journal of Leukocyte Biology. 2004;75:460-466.)
© 2004 by Society for Leukocyte Biology

The induction of Toll-like receptor tolerance enhances rather than suppresses HIV-1 gene expression in transgenic mice

André Báfica*,1, Charles A. Scanga*, Ozlem Equils{dagger} and Alan Sher*

* Immunobiology Section, Laboratory of Parasitic Diseases, National Institutes of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland; and
{dagger} Division of Pediatric Infectious Diseases, Steven Spielberg Pediatric Research Center, Burns and Allen Research Institute, Cedars-Sinai Medical Center, University of California School of Medicine, Los Angeles

1 Correspondence: National Institutes of Health, 50 South Drive, MSC-8003, Building 50, Room 6146, Bethesda, MD 20982. E-mail: abafica{at}niaid.nih.gov


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Microbial-induced proinflammatory pathways are thought to play a key role in the activation of human immunodeficiency virus type 1 (HIV-1) gene expression. The induction of Toll-like receptor (TLR) tolerance leads to a complex reprogramming in the pattern of inflammatory gene expression and down-modulates tumor necrosis factor {alpha} (TNF-{alpha}), interleukin (IL)-1, and IL-6 production. Using transgenic (Tg) mice that incorporate the entire HIV-1 genome, including the long-terminal repeat, we have previously demonstrated that a number of different TLR ligands induce HIV-1 gene expression in cultured splenocytes as well as purified antigen-presenting cell populations. Here, we have used this model to determine the effect of TLR-mediated tolerance as an approach to inhibiting microbial-induced viral gene expression in vivo. Unexpectedly, Tg splenocytes and macrophages, rendered tolerant in vitro to TLR2, TLR4, and TLR9 ligands as assessed by proinflammatory cytokine secretion and nuclear factor-{kappa}B activation, showed enhanced HIV-1 p24 production. A similar enhancement was observed in splenocytes tolerized and then challenged with heterologous TLR ligands. Moreover, TLR2- and TLR4-homotolerized mice demonstrated significantly increased plasma p24 production in vivo despite lower levels of TNF-{alpha}. Together, these results demonstrate that HIV-1 expression is enhanced in TLR-reprogrammed host cells, possibly reflecting a mechanism used by the virus to escape the effects of microbial-induced tolerance during natural infection in vivo.

Key Words: AIDS • bacterial • LPS • inflammation • TLR • HIV


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Immune activation by common infectious and/or opportunistic pathogens has been proposed as one of the cofactors influencing disease progression in human immunodeficiency virus type 1 (HIV-1)+ individuals [1 , 2 ]. This positive-feedback relationship between coinfection and AIDS has been most-thoroughly investigated in the case of dual infection with HIV and Mycobacterium tuberculosis, in which successful, antimycobacterial therapy has been shown to result in decreased plasma viremia [3 ]. M. tuberculosis and other coinfections associated with HIV-1 are activators of CD4+ T lymphocyte function and thereby, could promote HIV-1 expression by enhancing viral infectivity, reverse transcription, and integration and spread within newly infected cells [1 , 4 ]. In addition, many of the same infectious agents are strong stimulators of proinflammatory cytokines [e.g., tumor necrosis factor {alpha} (TNF-{alpha}), interleukin (IL)-6, and IL-1], which are known to induce HIV-1 transcription, assembly, and release in virally infected cells [5 ]. In the case of TNF-{alpha}, the observed effects on HIV-1 expression have been linked to the induction of nuclear factor (NF)-{kappa}B, which interacts with promoter sequences within the long-terminal repeat (LTR) of the viral genome [6 ].

The observed association between proinflammatory cytokine production and HIV-1 expression has suggested that treatments that inhibit microbial-induced cytokine production might serve as useful interventions in preventing AIDS progression in coinfected HIV-1+ individuals, and several trials of drug-based, immune-suppressive agents have been performed to evaluate such a strategy [7 8 9 ]. In addition to pharmacological approaches, immunoregulatory interventions could provide a means of suppressing proinflammatory cytokine production and thereby HIV-1 expression in coinfected patients. One such procedure, which has been extensively investigated at the experimental level, is reprogramming of cytokine responsiveness by Toll-like receptor (TLR) agonists [10 ]. This process, which was initially termed "endotoxin tolerance", refers to the induction of a hyporesponsive state in macrophages following primary exposure to microbial ligands such as lipopolysaccharide (LPS), bacterial lipoprotein, lipoteichoic acid, and oligo CpG–DNA, now known to signal through TLRs. The resulting tolerant state is associated with a marked decrease in proinflammatory cytokine production following secondary challenge with these ligands [11 12 13 ]. For example, restimulation of monocytes and macrophages previously exposed to LPS fails to elicit TNF-{alpha}, IL-1, IL-6, IL-12, and Jun B gene expression or induce NF-{kappa}B, activated protein-1 (AP-1), cyclic AMP response element-binding protein (CREB), and signal transducer and activator of transcription (STAT)-1 activation, although other genes, including IL-10 and IL-1 receptor antagonist, are expressed at normal or elevated levels [12 , 14 ].

As there is growing evidence that microbial ligand-TLR interactions can play a role in driving HIV-1 expression [15 , 16 ], it is possible that reprogramming, mediated by TLR, could be used as a means of reducing HIV viral loads in coinfected individuals. In the current study, we have tested this hypothesis using a transgenic (Tg) mouse model that expresses complete DNA copies of the HIV-1 genome, including the LTR, in which microbial stimulation has previously been shown to result in enhanced viral expression [15 16 17 18 19 ]. It is interesting that in this Tg mouse model, antigen-presenting cells (macrophages and dendritic and B cells) rather than T cells provide the major source of elevated HIV-1 production. Furthermore, we have recently demonstrated that known TLR agonists such as LPS, monosylated phosphatidylinositol, CpG, and S-[2,3-bis(palmitoyloxy)-(2-RS)-propyl]-N-palmitoyl-(R)-Cys-(S)-Ser-Lys4-OH, trihydrochloride (Pam3Cys) stimulate increased levels of HIV-1 transcripts as well as production of p24 (a capsid protein encoded by the gag gene) by Tg spleen cells in vitro [15 , 16 ].

In the present report, we show that after tolerization with TLR2, TLR4, or TLR9 ligands, Tg cells unexpectedly display enhanced HIV-1 gene and protein expression after restimulation in vitro despite dramatic reductions in proinflammatory cytokine production. Moreover, Tg mice tolerized in vivo with LPS or Pam3Cys show increased levels of plasma p24, whereas TNF-{alpha} production is markedly diminished in the same animals. This overexpression of HIV-1 genes following TLR reprogramming may reflect a mechanism used by the virus to escape the effects of microbial-induced tolerance during natural infection in vivo.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Experimental animals
The Tg mouse line 166, which contains multiple copies of the complete proviral genome of HIV-1 strain NL4-3, was derived as described previously [17 ]. The homozygous animals were then bred as lines in an American Association for the Accreditation of Laboratory Animal Care-accredited animal facility. Mice of both sexes, between 6 and 12 weeks old, were used in all experiments.

Cell populations
Spleens from mice were disrupted through a 40-µm nylon mesh to obtain single-cell suspensions and were depleted of red blood cells by osmotic lysis. In one set of experiments, spleen cells were incubated with anti-CD11b MicroBeads (Miltenyi Biotec, Auburn, CA) for 15 min at 4°C, followed by a washing step in phosphate-buffered saline (PBS)/bovine serum albumin and then sorted in an AutoMACS (Miltenyi Biotec; isolation mode POSSEL_S). Analysis of the sorted cells showed purity higher than 95%. Thioglycollate-elicited murine peritoneal macrophages were obtained as described before [17 ].

TLR agonists and other reagents
LPS (Escherichia coli 0117:B08) and the synthetic lipoprotein Pam3Cys were purchased from Sigma Chemical Co. (St. Louis, MO) and EMC Microcollections (Tubingen, Germany), respectively. CpG oligo DNA (1668) was synthesized by Lofstrand Laboratories (Gaithersburg, MD). Caffeic acid phenethyl ester (CAPE) was obtained from Calbiochem (La Jolla, CA).

Induction of TLR tolerance in vitro
Cell populations were suspended in complete RPMI-1640 culture medium [16 ] at 5 x 106/ml and exposed to the different TLR agonists for 24 h. The cells were washed twice with PBS, resuspended in new media, and restimulated with the same or heterologous agonists. TNF-{alpha} and p24 were then assayed by enzyme-linked immunosorbent assay (ELISA) in supernatants at 48 h using commercial kits (TNF-{alpha}, R&D Systems Inc., Minneapolis, MN; p24 Coulter, Miami, FL). In some experiments, tnf-{alpha}, gag, and env mRNA levels were measured in spleen cell cultures at 2, 6, and 10 h following secondary stimulation. To assess the role of NF-{kappa}B in gene expression, spleen cells were pretreated for 1 h with different doses of CAPE (dissolved in ethanol) before stimulation with LPS.

In vivo induction of TLR tolerance
Tg mice (six animals per group) were injected intraperitoneally (i.p.) with Pam3Cys (5 mg/kg), LPS (5 mg/kg), or an equal volume (200 µl) of PBS before challenge. The induction of tolerance was assessed in these animals 24 h later by i.p. challenge with Pam3Cys or LPS (25 mg/kg). Blood samples were collected at different time points after challenge, and ELISA determined serum TNF-{alpha} and HIV-1 p24 as described above.

Measurement of HIV-1 and TNF-{alpha} gene expression by real-time reverse transcriptase-polymerase chain reaction (RT-PCR)
Total RNA was isolated from spleens or splenocytes as described previously [16 ]. Real-time PCR was performed on an ABI Prism 7900 sequence detection system (Applied Biosystems, Foster City, CA) using SYBR Green PCR Master Mix after reverse transcription of 1 µg RNA. The relative amount of PCR product was determined by the comparative Ct method, as described by the manufacturer, in which each sample was normalized to hypoxanthine guanine phosphoribosyltransferase (hprt) and expressed as a fold-increase versus untreated controls. The following primer pairs were used: for hprt, GTTGGTTACAGGCCAGACTTTGTTG (forward) and GAGGGTAGGCTGGCCTATAGGCT (reverse); for gag, CCAGATGAGAGAACCAAGGG (forward) and TTGTGAAGCTTGCTCGGCTCT (reverse); for env, GGGGACCAGGGAGAGCATT (forward) and TGGGTCCCCTCCTGAGGA (reverse); for tnf-{alpha}, AAAATTCGAGTGACAAGCCTGTAG (forward) and CCCTTGAAGAGAACCTGGGAGTAG (reverse); for il-6, GGCCTTCCCTACTTCACAAG (forward) and ATTTCCACGATTTCCCAGAG (reverse).

NF-{kappa}B, AP-1, CREB, and STAT-1 activation assays
Tg spleen cells were left untreated or exposed to 10 ng/ml LPS for 24 h and then were washed and stimulated with 100 ng/ml of the same ligand. After 3 h, nuclear extracts were prepared using a commercial kit (Panomics Inc., Redwood City, CA), and the protein concentration in each sample was determined using a commercial assay (Bio-Rad, Hercules, CA). NF-{kappa}B, AP-1, CREB, and STAT-1 activation (as assessed by binding to a specific consensus DNA sequence) was measured using a Transignal Protein/DNA array kit (Panomics Inc.) following the manufacturer’s protocol.

Statistical analysis
Nonparametric statistical analysis was performed by a two-tailed, Mann-Whitney t-test using 95% confidence intervals.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
TLR4-tolerized Tg cell populations display enhanced HIV-1 p24 protein as well as gag and env mRNA expression in vitro
The induction of TLR tolerance leads to a complex reprogramming in the pattern of inflammatory gene expression and down-modulates proinflammatory cytokines such as TNF-{alpha}. To investigate the role of this immunological process on HIV-1 expression in vitro, we used classical LPS tolerance protocols [10 ]. Spleen cells or peritoneal macrophages from Tg mice were primed with media alone or LPS (10 ng/ml) for 24 h and then were washed and restimulated with the same TLR4 agonist at a concentration of 100 ng/ml. As shown in Figure 1A and 1B , LPS-tolerized spleen cells and peritoneal macrophages produced significantly lower levels of TNF-{alpha} than control cells preincubated with media alone. Similar results were obtained when IL-1 and IL-6 were measured in the same supernatants (data not shown). Unexpectedly, the same tolerized cell populations displayed enhanced production of HIV-1 p24 compared with nontolerized controls. This overexpression of p24 appeared to be linked to the induction of tolerance, as when Tg spleen cells were first exposed to a tenfold lower dose of LPS, a concentration that fails to result in reprogramming of TNF-{alpha} synthesis, neither augmentation nor suppression of HIV-1 p24 was observed following secondary LPS challenge (Fig. 1A) . To address the possibility that the cytokines and p24 protein measured in these experiments are derived from different cellular sources, we repeated the high-dose sensitization experiments using highly purified, positively selected CD11b+ cells from spleen. As shown in Figure 1C , the same overexpression rather than suppression of HIV-1 p24 was observed following tolerization of these cells.



View larger version (20K):
[in this window]
[in a new window]
  		Figure 1. Enhancement of HIV-1 expression in TLR4-tolerized Tg cells. (A) Bulk spleen cells, (B) peritoneal macrophages (Perit. Mac.), and (C) CD11b+ spleen cell cultures from HIV-1 Tg mice were left untreated or exposed to LPS (10 ng/ml or 1 ng/ml). Twenty-four hours later, cells were washed with PBS and restimulated with 100 ng/ml LPS. TNF-{alpha} (open bars) and p24 (solid bars) were measured in supernatants at 48 h following secondary stimulation. The data shown are the means ± SE of assays on quadruplicate cultures. *, Data means significantly different (P<0.05) from each other. The experiment shown is representative of six performed.

 
To investigate whether the observed difference in the effects of tolerization on proinflammatory cytokine production and HIV-1 p24 protein expression reflects differences in the transcriptional regulation of the relevant genes, we measured tnf-{alpha}, il-6, gag, and env gene expression in the same spleen cell cultures described above. As shown in Figure 2A and 2C , induction of LPS tolerance led to decreased host tnf-{alpha} and il-6 mRNA expression at 2, 6, and 10 h, and virus genes gag and env mRNA expression was transiently suppressed at 2 h but greatly enhanced by 10 h post-challenge (Fig. 2B and 2D) . Moreover, as expected from previous studies [10 , 12 , 20 ], LPS tolerization in these experiments resulted in decreased NF-{kappa}B, AP-1, CREB, and STAT-1 activation, as measured by binding of nuclear proteins to a specific consensus sequence in a protein/DNA array (Fig. 3A and 3B ).



View larger version (31K):
[in this window]
[in a new window]
  		Figure 2. TLR4 homotolerance increases HIV-1 gag and env mRNA expression in Tg spleen cells in vitro. Spleen-cell cultures from HIV-1 Tg mice were left untreated (open bars) or stimulated with LPS (10 ng/ml, solid bars). Twenty-four hours later, cells were washed with PBS and restimulated with 100 ng/ml LPS. At the time points indicated, RNA was extracted, and (A) tnf-{alpha}; (B) gag, (C) il-6, and (D) env message expression was measured by real-time RT-PCR as described in Materials and Methods. The data shown are the means ± SE of assays on triplicate cultures. The experiment shown is representative of two performed.

 


View larger version (33K):
[in this window]
[in a new window]
  		Figure 3. Gene functions associated with LPS-induced reprogramming in Tg spleen cells. Cells were tolerized with LPS as in Figure 1A , and nuclear extracts were prepared at 3 h following restimulation. NF-{kappa}B, AP-1, CREB, and STAT-1 activity was analyzed as described in Materials and Methods (A and B). Transcription factor-binding activity as visualized by chemiluminescence in dot-blots of duplicate samples from unstimulated, stimulated, and tolerized spleen cells (A). Densitometric analysis of images generated in Panel A (B). Effect of the NF-{kappa}B inhibitor CAPE on LPS-induced TNF-{alpha} and HIV p24 expression (C and D). Tg spleen cells were stimulated with LPS (100 ng/ml) in the presence or absence of increasing concentrations of CAPE. ELISA measured HIV p24 and TNF-{alpha} production at 48 h (C). As noted previously [21 ], the inhibition of TNF-{alpha} production in LPS-stimulated cultures was only partial. To test the effect of CAPE on the response of tolerized cells, splenocytes were primed with LPS (10 ng/ml) and then challenged with LPS in the presence or absence of CAPE (20 µM). TNF-{alpha} and p24 production was then measured 48 h later (D). (C and D) Each data point shown is the mean ± SE of quadruplicate measurements performed on pooled spleen cells from two mice. The experiments shown are representative of two performed.

 
To compare the role of NF-{kappa}B in LPS-induced cytokine versus viral gene expression, we added the inhibitor CAPE during initial LPS priming or during secondary challenge. CAPE addition resulted in a partial dose-dependent inhibition of TNF-{alpha} synthesis and a much smaller inhibition of HIV p24 production following initial LPS stimulation (Fig. 3C) . More importantly, the drug failed to reduce LPS-induced p24 expression in tolerized cells (Fig. 3D) , arguing that this response is not NF-{kappa}B-dependent.

Induction of TLR2 or TLR9 homotolerance and TLR2/TLR4 or TLR9/TLR4 heterotolerance also leads to enhanced HIV-1 expression in vitro
To rule out the possibility that the observed effects of tolerization on HIV-1 expression may relate specifically to LPS stimulation, we also tested the response of Tg spleen cells to reprogramming by TLR2 (Pam3Cys) and TLR9 (CpG) ligands. A suppression of TNF-{alpha} secretion but enhancement of HIV-1 p24 production similar to that induced by LPS was observed (Fig. 4A ). Similarly, enhanced p24 production was observed when Tg spleen cells were tolerized in vitro with Pam3Cys or CpG and challenged with LPS (Fig. 4B and 4C) , indicating that this effect is also seen in a situation of heterologous TLR reprogramming.



View larger version (27K):
[in this window]
[in a new window]
  		Figure 4. Induction of TLR2 and TLR9 homotolerance as well as TLR2/TLR4 and TLR9/TLR4 heterolerance results in overexpression of HIV-1 in Tg spleen cells in vitro. Spleen cells from HIV-1 Tg mice were left untreated or stimulated with Pam3Cys (A and B, 10 ng/ml), CpG (A and C, 100 ng/ml), and LPS (A, 10 ng/ml) for 24 h. Cells were then washed and restimulated with Pam3Cys (A and B, 100 ng/ml), CpG (A, 200 ng/ml), or LPS (A–C, 100 ng/ml). p24 and TNF-{alpha} were measured in the supernatants 48 h later. The data presented are the means ± SE of assays on triplicate cultures. The experiment shown is representative of two performed.

 
Induction of TLR2 or TLR4 homotolerance results in overexpression of HIV-1 in Tg mice in vivo
To investigate the effect of TLR tolerance on HIV-1 expression in vivo, we pretreated Tg mice i.p. with saline, Pam3Cys (5 mg/kg), or LPS (5 mg/kg). On the following day, the corresponding animals were challenged homologously with Pam3Cys (25 mg/kg) or LPS (25 mg/kg) and serum TNF-{alpha} and p24 levels assayed, respectively, at 3 and 36 h later. As shown in Figure 5A , TLR4-tolerized Tg mice produced significantly less serum TNF-{alpha} than nontolerized animals following LPS challenge, and plasma p24 levels were actually increased in the former group. This result was also observed when tnf-{alpha} and gag mRNA levels were measured in spleens of the same animals (Fig. 5B) . Comparable effects on serum TNF-{alpha} and HIV-1 p24 protein levels were also seen when tolerization and challenge were performed with Pam3Cys rather than LPS (Fig. 5C) .



View larger version (20K):
[in this window]
[in a new window]
  		Figure 5. Induction of TLR2 and TLR4 homotolerance results in overexpression of HIV-1 mRNA and p24 in Tg mice challenged in vivo. HIV-1 Tg mice (six per group) were injected i.p with PBS, Pam3Cys (5 mg/kg), or LPS (5 mg/kg). Twenty-four hours later, mice were challenged with LPS (25 mg/kg; A and B) or Pam3Cys (25 mg/kg; C). ELISA measured TNF-{alpha} and p24 in plasma 3 and 36 h later, respectively (A and C). In addition, spleens quanitified tnf-{alpha} and gag mRNA levels at 3 h by real-time RT-PCR (B) as described in Materials and Methods. The ELISA data shown are the means ± SE of assays performed on six animals in each group, and the RT-PCR means are derived from assays on three of the animals in the same groups. *, Data means significantly different (P<0.05) from each other. The experiment shown is representative of two performed.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Although the effects of TLR tolerance induction on HIV-1 expression can be investigated using virus-infected human peripheral blood cells or cell lines, the interpretation of the results obtained can be complicated by effects on viral spread as a result of regulation of coreceptor and/or chemokine expression [22 ]. As mice lack the appropriate receptors required for HIV-1 entry, a major advantage of the Tg mouse model used in this study is that the induction of integrated HIV-1 can be studied in the absence of possible side effects on viral infectivity. More importantly, these Tg animals can be used to assess the consequences of TLR reprogramming on HIV-1 gene expression in vivo.

Although the induction of TLR-dependent tolerance inhibited proinflammatory cytokine production and NF-{kappa}B activation, an unexpected overexpression of HIV-1 genes was detected at the transcriptional and protein levels in vivo as well as in vitro. These observations suggest the existence of a pathway for TLR-induced viral expression that is not subject to reprogramming and indeed is enhanced by repeated stimulation. As suggested by the CAPE-inhibition studies (Fig. 3C and 3D) , this pathway does not appear to require NF-{kappa}B. A number of NF-{kappa}B-independent pathways for HIV-1 induction have been described previously, which are potential candidates for this mechanism, such as those involving the host transcription factors, SP-1, C/EBP, and c-Myb, which interact with distinct sites on the viral LTR [23 ]. In this regard, we have observed that c-Myb, a transcription factor known to up-regulate HIV expression [24 ], is also overexpressed in LPS-tolerized cells (data not shown). However, at present, we have no formal evidence that the overexpression of HIV occurring in our LPS-tolerization experiments is a result of c-Myb induction. The existence of a non-NF-{kappa}B-dependent pathway for HIV-1 induction in Tg mice was also suggested in a recent study in which TLR2 deficiency was shown to affect mycobacterial-induced HIV-1 but not TNF-{alpha} gene expression in Tg cells [16 ]. An alternative hypothesis to explain the observed overexpression of viral genes is that the process of tolerization results in the inhibited synthesis or function of a negative regulatory factor that normally represses HIV-1 induction. Although LPS reprogramming led eventually to any increase in HIV expression, it is of interest that a transient suppression was observed in in vitro cultures at 2 h following challenge (Fig. 2) . This observation may indicate that the relevant positive or negative regulatory element is a gene function that is late-acting relative to NF-{kappa}B.

Although the in vivo relevance of our observations to human HIV-1 infection remains to be formally established, and the data presented here replicated in experiments using primary human macrophages, our findings suggest that repeated microbial stimulation is likely to have an enhancing rather than suppressive effect on the immune activation of HIV-1 in coinfected individuals. As the natural induction of TLR tolerance by other infectious agents should be expected to decrease rather than increase HIV-1 loads, the ability of the virus to escape the effects of tolerance induction would clearly be to its benefit. One can speculate that HIV-1 has evolved alternative, non-NF-{kappa}B-dependent pathways for triggering its induction, in part to avoid the consequences of TLR reprogramming on microbial-induced immune activation.

There has been recent interest in the suppression of TLR responses as a strategy for disease intervention [25 ]. The results presented here have examined one strategy, the induction of TLR tolerance, as a means of achieving this goal in the context of immune activation of HIV-1. Our findings provide an example of a situation in which manipulation of TLR responses can have a detrimental rather than beneficial effect on a parameter of disease expression. Although our observations argue that TLR reprogramming would be an ineffective and in fact harmful approach for regulating immune activation of HIV-1, other strategies involving the suppression of TLR function may nevertheless be of benefit. In this regard, we have recently demonstrated that mycobacterial infection fails to induce HIV-1 expression in Tg mice, which are TLR2-deficient [16 ]. Therefore, the development of TLR antagonists that can be used to block highly specific, microbial-induced responses would seem a more productive approach for inhibiting disease through the targeting of TLR signaling.


   ACKNOWLEDGEMENTS
 
The National Institutes of Health Intramural AIDS Targeted Antiviral Program supported this work. We thank Drs. Stephanie Vogel, Dragana Jankovic, Julio Aliberti, and Moshe Arditi for helpful discussions.

Received August 19, 2003; revised October 17, 2003; accepted November 6, 2003.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Fauci, A. S. (1996) Host factors and the pathogenesis of HIV-induced disease Nature 384,529-534[CrossRef][Medline]
  2. Bentwich, Z., Kalinkovich, A., Weisman, Z. (1995) Immune activation is a dominant factor in the pathogenesis of African AIDS Immunol. Today 16,187-191[CrossRef][Medline]
  3. Goletti, D., Weissman, D., Jackson, R. W., Graham, N. M., Vlahov, D., Klein, R. S., Munsiff, S. S., Ortona, L., Cauda, R., Fauci, A. S. (1996) Effect of Mycobacterium tuberculosis on HIV replication. Role of immune activation J. Immunol. 157,1271-1278[Abstract]
  4. Rosenberg, Z. F., Fauci, A. S. (1989) Induction of expression of HIV in latently or chronically infected cells AIDS Res. Hum. Retroviruses 5,1-4[Medline]
  5. Poli, G., Fauci, A. S. (1992) The effect of cytokines and pharmacologic agents on chronic HIV infection AIDS Res. Hum. Retroviruses 8,191-197[Medline]
  6. Duh, E. J., Maury, W. J., Folks, T. M., Fauci, A. S., Rabson, A. B. (1989) Tumor necrosis factor alpha activates human immunodeficiency virus type 1 through induction of nuclear factor binding to the NF-{kappa}B sites in the long terminal repeat Proc. Natl. Acad. Sci. USA 86,5974-5978[Abstract/Free Full Text]
  7. Bekker, L. G., Haslett, P., Maartens, G., Steyn, L., Kaplan, G. (2000) Thalidomide-induced antigen-specific immune stimulation in patients with human immunodeficiency virus type 1 and tuberculosis J. Infect. Dis. 181,954-965[CrossRef][Medline]
  8. La Maestra, L., Zaninoni, A., Marriott, J. B., Lazzarin, A., Dalgleish, A. G., Barcellini, W. (2000) The thalidomide analogue CC-3052 inhibits HIV-1 and tumour necrosis factor (TNF-{alpha}) expression in acutely and chronically infected cells in vitro Clin. Exp. Immunol. 119,123-129[CrossRef][Medline]
  9. Walker, R. E., Spooner, K. M., Kelly, G., McCloskey, R. V., Woody, J. N., Falloon, J., Baseler, M., Piscitelli, S. C., Davey, R. T., Jr, Polis, M. A., Kovacs, J. A., Masur, H., Lane, H. C. (1996) Inhibition of immunoreactive tumor necrosis factor-{alpha} by a chimeric antibody in patients infected with human immunodeficiency virus type 1 J. Infect. Dis. 174,63-68[Medline]
  10. Dobrovolskaia, M. A., Medvedev, A. E., Thomas, K. E., Cuesta, N., Toshchakov, V., Ren, T., Cody, M. J., Michalek, S. M., Rice, N. R., Vogel, S. N. (2003) Induction of in vitro reprogramming by Toll-like receptor (TLR)2 and TLR4 agonists in murine macrophages: effects of TLR "homotolerance" versus "heterotolerance" on NF-{kappa}B signaling pathway components J. Immunol. 170,508-519[Abstract/Free Full Text]
  11. Henricson, B. E., Neta, R., Vogel, S. N. (1991) An interleukin-1 receptor antagonist blocks lipopolysaccharide-induced colony-stimulating factor production and early endotoxin tolerance Infect. Immun. 59,1188-1191[Abstract/Free Full Text]
  12. Yeo, S. J., Yoon, J. G., Hong, S. C., Yi, A. K. (2003) CpG DNA induces self and cross-hyporesponsiveness of RAW264.7 cells in response to CpG DNA and lipopolysaccharide: alterations in IL-1 receptor-associated kinase expression J. Immunol. 170,1052-1061[Abstract/Free Full Text]
  13. Jacinto, R., Hartung, T., McCall, C., Liwu, L. (2002) Lipopolysaccharide- and lipoteichoic acid-induced tolerance and cross-tolerance: dystonic alterations in IL-1 receptor-associated kinase J. Immunol. 168,6136-6141[Abstract/Free Full Text]
  14. Dobrovolskaia, M. A., Vogel, S. N. (2002) Toll receptors, CD14, and macrophage activation and deactivation by LPS Microbes Infect. 4,903-914[CrossRef][Medline]
  15. Equils, O., Schito, M. L., Karahashi, H., Madak, Z., Yarali, A., Michelsen, K. S., Sher, A., Arditi, M. (2003) TLR2 and TLR9 signaling results in HIV-LTR transactivation and HIV replication in HIV-1 transgenic mouse spleen cells: implications of simultaneous activation of TLRs on HIV replication J. Immunol. 170,5159-5164[Abstract/Free Full Text]
  16. Bafica, A., Scanga, C. A., Schito, M. L., Hieny, S., Sher, A. (2003) Cutting edge: in vivo induction of integrated HIV-1 expression by Mycobacteria is critically dependent on Toll-like receptor 2 J. Immunol. 171,1123-1127[Abstract/Free Full Text]
  17. Gazzinelli, R. T., Sher, A., Cheever, A., Gerstberger, S., Martin, M. A., Dickie, P. (1996) Infection of human immunodeficiency virus 1 transgenic mice with Toxoplasma gondii stimulates proviral transcription in macrophages in vivo J. Exp. Med. 183,1645-1655[Abstract/Free Full Text]
  18. Freitag, C., Chougnet, C., Schito, M., Near, K. A., Shearer, G. M., Li, C., Langhorne, J., Sher, A. (2001) Malaria infection induces virus expression in human immunodeficiency virus transgenic mice by CD4 T cell-dependent immune activation J. Infect. Dis. 183,1260-1268[CrossRef][Medline]
  19. Doherty, T. M., Chougnet, C., Schito, M., Patterson, B. K., Fox, C., Shearer, G. M., Englund, G., Sher, A. (1999) Infection of HIV-1 transgenic mice with Mycobacterium avium induces the expression of infectious virus selectively from a Mac-1-positive host cell population J. Immunol. 163,1506-1515[Abstract/Free Full Text]
  20. Medvedev, A. E., Kopydlowski, K. M., Vogel, S. N. (2000) Inhibition of lipopolysaccharide-induced signal transduction in endotoxin-tolerized mouse macrophages: dysregulation of cytokine, chemokine, and Toll-like receptor 2 and 4 gene expression J. Immunol. 164,5564-5567[Abstract/Free Full Text]
  21. Mancuso, G., Midiri, A., Beninati, C., Piraino, G., Valenti, A., Nicocia, G., Teti, D., Cook, J., Teti, G. (2002) Mitogen-activated protein kinease and NF-{kappa}B are involved in TNF-{alpha} responses to group B streptococci J. Immunol. 169,1401-1409[Abstract/Free Full Text]
  22. Verani, A., Sironi, F., Siccardi, A. G., Lusso, P., Vercelli, D. (2002) Inhibition of CXCR4-tropic HIV-1 infection by lipopolysaccharide: evidence of different mechanisms in macrophages and T lymphocytes J. Immunol. 168,6388-6395[Abstract/Free Full Text]
  23. Pereira, L. A., Bentley, K., Peeters, A., Churchill, M. J., Deacon, N. J. (2000) A compilation of cellular transcription factor interactions with the HIV-1 LTR promoter Nucleic Acids Res. 28,663-668[Abstract/Free Full Text]
  24. Churchill, M. J., Ramsay, R. G., Rhodes, D. I., Deacon, N. J. (2001) c-Myb influences HIV type 1 gene expression and virus production AIDS Res. Hum. Retroviruses 17,1481-1488[CrossRef][Medline]
  25. Sanbroe, I., Read, C. R., Whyte, M. K. B., Dockrell, D. H., Vogel, S. N., Dower, S. K. (2003) Toll-like receptors in health and disease: complex questions remain J. Immunol. 171,1630-1635[Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
C.-C. Kuo, W.-T. Lin, C.-M. Liang, and S.-M. Liang
Class I and III Phosphatidylinositol 3'-Kinase Play Distinct Roles in TLR Signaling Pathway
J. Immunol., May 15, 2006; 176(10): 5943 - 5949.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Bafica, C. A. Scanga, M. Schito, D. Chaussabel, and A. Sher
Influence of Coinfecting Pathogens on HIV Expression: Evidence for a Role of Toll-Like Receptors
J. Immunol., June 15, 2004; 172(12): 7229 - 7234.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0803388v1
75/3/460    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Báfica, A.
Right arrow Articles by Sher, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Báfica, A.
Right arrow Articles by Sher, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS