Journal of Leukocyte Biology eBioscience full spectrum cell analysis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0703341 on November 3, 2003

Published online before print November 3, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0703341v1
75/2/260    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, K.
Right arrow Articles by Gan, Y.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, K.
Right arrow Articles by Gan, Y.-H.
(Journal of Leukocyte Biology. 2004;75:260-266.)
© 2004 by Society for Leukocyte Biology

Mycobacterial heat shock protein 65 enhances antigen cross-presentation in dendritic cells independent of Toll-like receptor 4 signaling

Kang Chen*, Jinhua Lu{dagger}, Lei Wang*,1 and Yunn-Hwen Gan*,2

Department of Biochemistry,
* Faculty of Medicine, and
{dagger} National University Medical Institutes, National University of Singapore

2 Correspondence: Department of Biochemistry, MD7, National University of Singapore, 8 Medical Drive, Singapore 117597. E-mail: bchganyh{at}nus.edu.sg


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Heat shock proteins (HSP) have been shown to enhance antigen processing and presentation through their association with antigenic peptides and delivery of these moieties into major histocompatibility complex class I pathways. In this study, mycobacterial Hsp65 is demonstrated to have the ability to help cross-present an exogenous protein by dendritic cells (DC) to CD8 T cells without the need for complex formation between Hsp65 and the protein. This ability of Hsp65 to enhance cross-presentation is independent of its weak stimulatory effect on DC, the latter seen only after prolonged incubation. When the effect of lipopolysaccharide contamination is abrogated, Hsp65 is unable to activate Toll-like receptor (TLR)4 in the presence of CD14 and MD2. This accounts for the inability of Hsp65 to drive maturation of DC and shows that Hsp65 is not a potent stimulator of DC. Thus, Hsp65 enhances the cross-presentation of a soluble, free antigen by DC, independent of TLR4 signaling and up-regulation of costimulatory molecules.

Key Words: HSP-antigen complex • CD8 T cells • LPS


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Exogenous, soluble antigens can be cross-presented by antigen-presenting cells (APC) to major histocompatibility complex (MHC) class I-restricted CD8 T cells [1 ]. This process was originally described for the cytotoxic T lymphocyte responses to minor histocompatibility antigens [2 ]. The major APC responsible for cross-presentation to CD8 T cells are dendritic cells (DC) [3 ], and this unique property of DC contributes to its ability to activate naive CD8 T cells without the help of CD4 T cells [4 ].

It is interesting that heat shock proteins (HSP), belonging to the Hsp60, -70, and -90 families, have been found to facilitate the process of cross-presentation in DC. Hsp70 and gp96 were first shown by Srivastava and Heike [5 ] and Srivastava and Maki [6 ] to bind antigenic peptides, and these HSP-peptide complexes could be taken up by APC to be cross-presented to MHC class I-restricted T cells. Hsp70 and Hsp65 have also been fused to peptides of various lengths, and DC could take up these exogenous fusion proteins for cross-presentation to CD8 T cells specific for the fusion peptides [4 ]. In yet another approach, Kammerer et al. [7 ] engineered Hsp73 binding sites in chimeric antigens. These antigens were expressed in tumor cells and found to bind noncovalently with the constitutively expressed, cellular Hsp73 for cross-presentation by DC to antigen-specific T cells.

In all of the above studies, HSP were engineered to be in a complex with the antigen of interest, covalently or noncovalently, which were shown to promote the cross-presentation of HSP-complexed antigens. However, this association may not be necessary, as Skinner et al. [8 ] were able to immunize mice simultaneously with the ovalbumin (OVA) antigen and Mycobacterium vaccae Hsp65 to elicit a cytotoxic T cell response to an OVA-derived epitope. The mechanism by which Hsp65 facilitates the presentation of the OVA epitope was not examined. Mammalian and bacterial Hsp60 proteins have been shown to have adjuvant properties; i.e., they are able to induce cytokine production and DC activation [9 ]. DC activation by these HSP could contribute to the increased cross-presentation of unrelated antigens to T cells. However, as DC are effectively activated by bacterial endotoxins such as lipopolysaccharides (LPS), the copurification of LPS with recombinant HSP from bacteria could add to the confusion [10 ]. In this study, we examine the ability of Mycobacterium bovis Hsp65 in helping to cross-present a soluble, exogenous antigen not associated with Hsp65 in DC. We show that Hsp65 is able to enhance antigen cross-presentation independent of up-regulation of costimulatory molecules and possible LPS contamination.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell cultures and animals
The immature DC line JAWSII (American Type Culture Collection, Manassas, VA) was cultured in complete RPMI-1640 medium supplemented with 20% fetal bovine serum (FBS), 2 mg/ml glutamine, 100 U/ml penicillin and streptomycin, 1 mM sodium pyruvate, and 5 ng/ml granulocyte macrophage-colony stimulating factor (GM-CSF) in a 5% CO2 incubator at 37°C. The mouse CD8 T cell hybridoma B3Z was a kind gift from Dr. Ronald Germain (NIH, Bethesda, MD). The cells were cultured in complete RPMI-1640 medium supplemented with 10% FBS, 2 mg/ml glutamine, and 100 U/ml penicillin and streptomycin in a 5% CO2 incubator at 37°C. Breeding pairs of OT-1 mice were obtained from Animal Resources Center (Perth, Australia) and were maintained in a clean room at the Laboratory Animal Center of the National University of Singapore. They were used at 7–10 weeks old.

Hsp65 preparations and reagents
The full length of M. bovis Hsp65 gene (1623 base pairs) with a 6x-Histidine tag at the N-terminus was cloned into the expression vector pQE-30 (Qiagen, Hilden, Germany). The plasmid was transformed into Escherichia coli M15 cells. The log-phase bacterial culture grown in the presence of ampicillin (100 µg/ml) and kanamycin (25 µg/ml) was induced by 1 mM isopropylthiogalactoside for 3 h. The cells in the pellet were lysed and sonicated. Hsp65 in the supernatant was purified using an Ni-NTA resin column (Clontech Laboratories, Palo Alto, CA). During washing of the column, washing buffer containing 0.5% (w/v) sodium deoxycholate was used to solublize and reduce LPS contamination. The eluted protein was exchanged into phosphate-buffered saline (PBS) and concentrated. The protein was filtered, and the concentration was determined by the Bradford assay (Bio-Rad, Hercules, CA).

In vitro antigen presentation assay
JAWSII cells were plated at a density of 5 x 104 cells per well in a 96-well plate. OVA, Hsp65, bovine serum albumin (BSA), lactoferrin, LPS, or polymyxin B was added to appropriate final concentrations, and GM-CSF was added to a final concentration of 20 ng/ml. The final volume of each well was 200 µl. The incubation was allowed to take place for 8 h in a 5% CO2 incubator at 37°C. B3Z cells (5x104) were then added to each well in a volume of 50–100 µl. Cell viability for all wells was determined to be >95% by trypan blue exclusion. The accumulation of interleukin (IL)-2 in the supernatant was allowed to take place for 16 h in the incubator. IL-2 level in the supernatant was measured by enzyme-linked immunosorbent assay (ELISA; BD PharMingen, San Diego, CA). All supernatants were measured in triplicates.

Immunoprecipitation and Western blot
Mixtures of OVA and Hsp65 were incubated with mc4220 (a murine monoclonal antibody against mycobacterial Hsp65, a kind gift from Dr. Patrick J. Brennan, Colorado State University, Fort Collins, CO) in 1 ml immunoprecipitation (IP) buffer (10 mM Tris-HCl at pH 7.4, 1% Triton-X 100, 1 mM EGTA, 1 mM EDTA) for 1.5 h on ice with rocking and another 2 h on ice with 20 µl protein A-agarose beads (Sigma Chemical Co., St. Louis, MO). The beads were washed four times with IP buffer before being subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot using a monoclonal anti-OVA antibody (Sigma Chemical Co.).

Cytokine expression
JAWSII cells (4x106) were incubated in 20 ng/ml GM-CSF with 1 µg/ml LPS or with 100 or 200 µg/ml Hsp65 in the presence of 20 µg/ml polymyxin B for 24 h. Total RNA from the cells was isolated using Trizol (Gibco-BRL, Grand Island, NY). RNA was reverse-transcribed using 10 µM oligo-dT primer, dNTPs, and Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI). Polymerase chain reaction (PCR) was performed with Taq polymerase (Promega) and cytokine gene-specific primers for IL-1ß (sense 5'-TCATGGGATGATGATGATAACCTGCT-3', antisense 5'-CCCATACTTTAGGAAGACACGGATT-3'); IL-6 (sense 5'-CTGGTGACAACCACGGCCTTCCCTA, antisense 5'-ATGCTTAGGGCATAACGCACTAGGTT-3'); tumor necrosis factor {alpha} (TNF-{alpha}; sense 5'-GAACTTCGGGGTGATCG-3', antisense 5'-CAGATTGACCTCAGCGC-3'); and IL-18 (sense 5'-ACTGTACAACCGCAGTAATACGG-3', antisense 5'-AGTGAACATTACAGATTTATCCC-3'). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. ELISA measured interferon-{gamma} (IFN-{gamma}), IL-2, IL-12, and TNF-{alpha} in the supernatant (Bender MedSystems, Vienna, Austria).

Generation of bone marrow (BM)-derived DC
BM cells were obtained from femurs and tibiae of C57BL/6 mice and were cultured in 30 ng/ml GM-CSF following the protocol of Lutz et al. [11 ]. Six days after culture, cells were labeled with CD11c microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany) and were subjected to positive selection via magnetic activated cell sorter (MACS; Miltenyi Biotec). The purity after separation was determined by flow cytometry, and typically, >85% of the cells exhibited high CD11c expression, and the rest showed lower expression.

Spleen CD8 T cell purification
Single-cell suspension was obtained from an OT-1 mouse spleen. Splenocytes were magnetically labeled with CD8{alpha} microbeads (Miltenyi Biotec). The cells were washed with ice-cold PBS containing 5% FBS and 2 mM EDTA and were sequentially applied to two columns and positively selected by MACS (Miltenyi Biotec). The percentage of CD8{alpha}+ cells after separation was determined by flow cytometry.

IFN-{gamma} measurement
Isolated mouse BM-derived DC (5x104) were seeded in each well of a 96-well plate. LPS, Hsp65, polymyxin B, or OVA was added to appropriate final concentrations, and GM-CSF was added to a final concentration of 20 ng/ml. The final volume of each well was 200 µl. After 8 h incubation, 3 x 105 purified spleen CD8 T cells were added to the wells in a volume of 30–35 µl. After another 16 h, IFN-{gamma} in the supernatant was measured in duplicates or triplicates using an IFN-{gamma}–ELISA module set from Bender MedSystems.

Flow cytometry
Cells were washed with PBS and stained on ice with specific antibodies against mouse CD40, CD86, Kb/Db, Db, I-Ab, CD11c, and their proper isotype controls (BD PharMingen) for 30–45 min, followed by appropriate secondary antibodies if necessary. Cells were then washed with PBS, and fluorescence was measured using a FACScan flow cytometer (Becton Dickinson, San Jose, CA).

Toll-like receptor 4 (TLR4) activation assay
cDNA encoding human TLR4, MD2, and CD14 was amplified by PCR with the following primers (5'–3'): TLR4, gcttggtaccactgctgctcacagaag/gaagggccctcagatagatgttgcttcctg; MD2, cggggtaccaccatgttaccatttctgtttttttc/gaagggccctctaatttgaattaggttggtgta; and CD14, cggggtaccaccatggagcgcgcgtcc/gagtctagattaggcaaagccccgggc RNA was isolated from the monocytic THP-1 cells using the Trizol reagent (Invitrogen, Carlsbad, CA), and cDNA was synthesized using the RT-for-PCR kit (Clontech) as PCR templates. The PCR-amplified cDNA fragments for TLR4 and MD2 were digested with KpnI and ApaI and were cloned into the pcDNA3.1/myc-His A vector to yield the pTLR4 and pMD2 expression vectors. The CD14 cDNA fragment was digested with KpnI and XbaI and similarly cloned into the pcDNA3.1/myc-His A vector (pCD14). All expression vectors were verified by sequencing from both directions. Activation of the TLR4/MD2/CD14 receptor complex was determined using a previously described luciferase assay [12 ]. Briefly, human embryonic kidney (HEK) 293T cells were subcultured in 24-well plates and transfected using GenePORTER 2 following the manufacturer’s instructions (Gene Therapy Systems, La Jolla, CA). Cells in 24-well plates were transfected with the expression vectors (each at 100 ng/well unless otherwise stated). In each experiment, the p5 x nuclear factor (NF)-{kappa}B- luciferase (Luc; Stratagene, La Jolla, CA) and pRL–cytomegalovirus (CMV; Promega) reporter plasmids were cotransfected each at 100 ng/well. Twenty-four hours after transfection, the cells were stimulated with LPS or Hsp65 at the stated concentrations and then harvested after 16 h for luciferase assays. NF-{kappa}B–Luc expression was determined using the dual luciferase assay (Promega) and normalized to CMV-directed, constitutive expression of the Renilla luciferase.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Hsp65 promotes cross-presentation of exogenous antigen on JAWSII cell line to T cell hybridoma
To examine whether purified recombinant Hsp65 could promote cross-presentation of exogenous OVA on Kb molecules, we used an immortalized C57BL/6 mouse BM-derived, immature DC line JAWSII (CD11c+CD11b+CD8{alpha}-) as the APC. JAWSII cells were incubated with exogenous OVA and Hsp65 and were then tested for the ability to activate the CD8+ T cell hybridoma B3Z, specific for the SIINFEKL OVA peptide presented by Kb (Fig. 1 ). As shown in Figure 1 , JAWSII cells incubated with exogenous OVA or Hsp65 alone could not effectively stimulate IL-2 secretion from B3Z. When JAWSII cells were incubated with Hsp65 and OVA, IL-2 secretion by stimulated B3Z cells was dramatically increased (Fig. 1A) . Incubation of JAWSII cells with an equal concentration of lactoferrin or BSA together with OVA did not stimulate IL-2 release by B3Z (data not shown).



View larger version (23K):
[in this window]
[in a new window]
  		Figure 1. Hsp65 promotes cross-presentation of exogenous OVA in JAWSII cells. OVA concentration was kept at 50 µg/ml and Hsp65 at 100 µg/ml except when indicated otherwise. (A) Cells were incubated with OVA, Hsp65, or both. One representative of three independent assays is shown. (B) Cells were incubated with OVA (1); OVA and Hsp65 (2); OVA, Hsp65, and 20 µg/ml polymyxin B (PolyxB; 3); or Hsp65 (4). Comparable results were obtained in six similar experiments. (C) Cells were incubated with medium (1); OVA alone (2); intact Hsp65 (3); OVA and intact Hsp65 (4); OVA with 10 ng/ml, 100 ng/ml, or 1 µg/ml LPS, respectively (5–7); intact Hsp65 purified without sodium deoxycholate (8); OVA and intact Hsp65 purified without sodium deoxycholate (9); OVA and heat-denatured Hsp65 (10); or OVA and Hsp65, which were trypsinized (Try.) for 15, 60, and 120 min, respectively (11–13). (D) Cells were incubated with increasing concentrations of Hsp65 (0, 1, 10, 50, 100, 200, 500, 1000, and 1500 µg/ml). The result is representative of five independent experiments. (E) OVA was subjected to the following conditions before being mixed with Hsp65, immunoprecipitated with anti-Hsp65 antibody followed by SDS-PAGE, and immunoblotting with anti-OVA antibody: OVA preheated at 95°C for 5 min (1); OVA chilled at 0°C for 10 min (3); and at 45°C for 10 min (4). Lane 2 was loaded with OVA and represents the OVA-positive control for immunoblotting. OVA and Hsp65 mixed at 37°C did not form a complex at any of the time points examined (data not shown).

 
It is possible that the activation of B3Z cells may be a result of surface loading of OVA-derived peptides onto MHC class I molecules on JAWSII cells. This was examined by fixation of JAWSII cells before incubation with OVA and Hsp65. The fixed JAWSII cells were unable to stimulate a detectable increase in IL-2 secretion (Fig. 1A) , showing that activation of B3Z cells required OVA uptake and cross-presentation by JAWSII cells, and surface loading of OVA peptide fragments on JAWSII cells was not sufficient to activate B3Z cells.

Hsp65 used in this study was purified using 0.5% (w/v) sodium deoxycholate to reduce bacterial LPS. However, residual LPS in the Hsp65 preparations could still confer some stimulatory activity to JAWSII cells. To exclude the possibility of JAWSII activation by contaminating LPS, the antigen-presentation assay was performed in the presence of 20 µg/ml polymyxin B, an LPS adsorbent that inhibits the action of LPS. JAWSII cells incubated with OVA and Hsp65 in the presence or absence of polymyxin B were found to stimulate B3Z cells to the same extent (Fig. 1B) . It has been reported that the capability of LPS to interact with HSP can result in inefficient removal of LPS [13 14 15 ]. To determine whether LPS could indeed stimulate JAWSII cells for more effective cross-presentation, JAWSII cells were incubated with OVA and as much as 1 µg/ml LPS to stimulate B3Z cells. Stimulated B3Z cells produced only background levels of IL-2 (Fig. 1C) . Furthermore, the ability of Hsp65 to enhance cross-presentation to B3Z cells was mostly abolished by heat denaturation and almost completely abolished by trypsinization (Fig. 1C) . As detected by SDS-PAGE, most of the protein was cleaved after 15 min of trypsinization, and little intact Hsp65 was present after 60 or 120 min (data not shown). Therefore, the ability of Hsp65 to promote OVA cross-presentation was unlikely to be a result of contaminating LPS.

HSP could assist antigen cross-presentation by chaperoning antigenic peptides into cross-presentation pathways. Therefore, it is possible that more HSP would increase antigen presentation by chaperoning more peptides. This has important implications, as antigen dose critically affects the outcome of an immune response. Therefore, JAWSII cells were incubated with increasing concentrations of Hsp65 ranging from 0 to 1500 µg/ml in the presence of 50 µg/ml OVA. Corresponding concentrations of lactoferrin were used as control. The highest IL-2 level produced by B3Z cells was consistently observed when JAWSII cells were incubated with 200 µg/ml Hsp65 (Fig. 1D) . The stimulatory effect of JAWSII cells started to decline after incubation with higher concentrations of Hsp65 (>200 µg/ml), and this was not a result of decreased viability of JAWSII and B3Z cells, as assayed by propidium iodide uptake (data not shown). A possible explanation is that too much Hsp65 could compete with OVA peptide for binding to MHC class I molecules. Furthermore, we had verified that simply mixing OVA and Hsp65 under our in vitro culture conditions at 37°C did not induce complex formation (data not shown). In fact, OVA and Hsp65 only formed a complex under very specific conditions, where OVA had to be denatured at 95°C before mixing with Hsp65 (Fig. 1E) . Collectively, these results demonstrated that Hsp65 was able to promote cross-presentation of exogenous OVA by JAWSII cells without prior complex formation in vitro.

Hsp65 minimally up-regulates MHC class I and costimulatory molecules and cytokine gene expression in JAWSII cells
To determine whether Hsp65 promotes antigen cross-presentation through up-regulation of MHC and costimulatory molecule expression on APC, JAWSII cells were incubated with 200 µg/ml Hsp65 in the presence of 20 µg/ml polymyxin B for 24 and 48 h. A slight up-regulation of MHC class I molecules was observed only at 24 h, and CD86 was increased slightly at both time-points (Fig. 2A and 2B ). Surface expression of CD40 and I-Ab was negligible on JAWSII cells (data not shown). As JAWSII cells did not show a typical expression of MHC and costimulatory molecules with LPS, we also examined cytokine expression by the cell line to verify the validity of using LPS as a positive control. LPS was able to induce IL-1ß, IL-6, IL-12, IL-18, and TNF-{alpha} expression, and Hsp65 in the presence of polymyxin B was not able to, except for a low level of IL-18 expression (Fig. 2C) . The ability of Hsp65 to induce TNF-{alpha} production was a result of contaminating LPS, as it was abrogated by polymyxin B (Fig. 2D) . Thus, it is unlikely that Hsp65 promotes antigen cross-presentation through DC activation and maturation.



View larger version (33K):
[in this window]
[in a new window]
  		Figure 2. Up-regulation of MHC class I, CD86, and cytokine gene expression after Hsp65 stimulation of JAWSII cells. LPS was used as a positive control. Experiments were performed in the presence of 20 µg/ml polymyxin B except for the LPS control or when indicated. Surface staining was performed (A) 24 and (B) 48 h after stimulation. Numbers denote the ratio of mean fluorescence intensity of specific staining to isotype control. This is a representative of three experiments. (C) After stimulation for 24 h, IL-1ß, IL-6, IL-18, and TNF-{alpha} gene expression was analyzed by RT-PCR. ELISA measured IFN-{gamma}, IL-2, and IL-12 in the supernatant. IFN-{gamma} and IL-2 were not detected in any of the treatments. Only the IL-12 level is shown. (D) Cells were stimulated with the indicated concentrations of Hsp65 for 8 h in the presence or absence of polymyxin B (PolyxB), and ELISA measured TNF-{alpha} in the supernatant.

 
Effect of Hsp65 on enhancement of cross-presentation and stimulation of BM-derived DC
As Hsp65 has been shown to promote the cross-presentation of exogenous OVA by JAWSII cells to the T cell hybridoma B3Z, we examined if it could also enhance cross-presentation by primary DC to naïve T cells. DC were generated by culturing BM cells with GM-CSF for 6 days. CD11c+ cells were positively selected and incubated with OVA in the presence or absence of Hsp65 and used to stimulate transgenic CD8 T cells from the spleen of OT-1 mice, specific for the OVA-derived peptide SIINFEKL presented by Kb. When DC were cultured with Hsp65 at 20 and 100 µg/ml Hsp65, enhanced cross-presentation of OVA was consistently observed, as judged by IFN-{gamma} secretion by the stimulated OT-1 T cells (Fig. 3A ). Hsp65 alone did not cause IFN-{gamma} secretion in CD11c+ cells, and CD8+ T cells alone were unable to secrete IFN-{gamma} when stimulated with OVA or Hsp65 or both (data not shown). The expression of CD86, CD40, and MHC class I or II molecules was not increased on CD11c+ DC after Hsp65 stimulation for 24 h (data not shown). Only after 70 h of stimulation was there some up-regulation of CD86 and CD40 with Hsp65 (Fig. 3B) . There was no increase in I-Ab expression except with LPS stimulation. Furthermore, LPS-stimulated DC exhibited a mature morphology with extensive dendrite formation under light microscopy, and Hsp65-stimulated DC mostly exhibited an immature morphology (data not shown). Although Hsp65 appears to have a slight stimulatory activity on DC upon prolonged incubation, Hsp65 promotion of antigen cross-presentation by DC is unlikely to involve DC activation by Hsp65, as the antigen presentation occurs in the first 24 h.



View larger version (33K):
[in this window]
[in a new window]
  		Figure 3. Enhancement of cross-presentation and stimulation of BM-derived DC by Hsp65. IFN-{gamma} level as measured by ELISA was shown for the activation of purified, naïve OT-1 T cells cultured with purified DC in the presence of 20 µg/ml polymyxin B for all wells containing Hsp65 (A). CD8 T cells were positively selected and isolated to a purity of 85–90%. Staining of cell-surface markers (B) was performed at 70 h after stimulation with 1 µg/ml LPS (gray-lined histogram), 100 µg/ml Hsp65 in the presence of 20 µg/ml polymyxin B (black-lined histogram), and medium only (shaded histogram). Antibody isotype controls were included in all experiments and did not show nonspecific staining.

 
Hsp65 does not act through TLR4
HSP have been suggested to bind to LPS [13 14 15 ]. Thus, it is possible that HSP function as LPS binding and recognition-enhancing proteins, and a very small amount of LPS is enough to activate APC with the assistance of HSP. In fact, mammalian and chlamydial Hsp60 have been reported to activate macrophages through the activation of TLR4-mediated cell signaling, and this activation was dependent on CD14, the major high-affinity receptor for bacterial LPS on mononuclear cells, and MD2, a secreted protein associated with the extracellular domain of TLR4 [9 , 16 17 ]. To examine whether the purified Hsp65 used in our study also activates DC through CD14 and the TLR4–MD2 complex, HEK 293T cells were transfected to coexpress TLR4, CD14, and MD2, and the transfected cells were incubated with Hsp65 or as a control, LPS. The activation of NF-{kappa}B in these transfected cells was determined using luciferase reporter plasmids. Overexpression of TLR4 together with MD2 and CD14 led to slight autoactivation in the absence Hsp65 or LPS stimulation (Fig. 4A ). Although LPS was shown to effectively induce TLR4-mediated NF-{kappa}B activation at 0.2–200 ng/ml, Hsp65 only slightly activated TLR4 at 100 and 200 µg/ml (Fig. 4A) . At 500 µg/ml, Hsp65 induced TLR4-mediated NF-{kappa}B activation to a level that was comparable with that induced by 0.2 ng/ml LPS (Fig. 4A) . This Hsp65-induced TLR4 activation was dependent on the coexpression of CD14, as HEK 293T cells, transfected to coexpress TLR4 and MD2 in the absence of CD14, were unresponsive to Hsp65 stimulation (Fig. 4B) . However, the TLR4-mediated NF-{kappa}B activation by Hsp65 was completely abrogated with 20 µg/ml polymyxin B, which is the concentration consistently used in the antigen-presentation assays to inhibit LPS activity (Fig. 4B) . These results show that 20 µg/ml polymyxin B was able to completely abrogate the effect of contaminating LPS in the purified Hsp65 and that Hsp65 was unable to activate TLR4-mediated NF-{kappa}B activation.



View larger version (16K):
[in this window]
[in a new window]
  		Figure 4. Activation of TLR4-mediated NF-{kappa}B activity by Hsp65 and LPS. HEK 293T cells were subcultured in 24-well plates and transfected with expression vectors for human TLR4, MD2, and CD14, each at 100 ng/well, and after 24 h, stimulated with LPS (0.2, 2.0, 20, and 200 ng/ml) or Hsp65 (10, 100, 200, and 500 µg/ml) overnight (A). Stimulation with 200 µg/ml Hsp65 was performed in the presence or absence of 20 µg/ml polymyxin B (B). All cells were cotransfected with the p5 x NF-{kappa}B–Luc reporter plasmid, which expresses the firefly luciferase, and the pRL–CMV luciferase plasmid, which constitutively expresses the Renilla luciferase. Experiments were performed in triplicates, and the NF-{kappa}B-directed firefly luciferase expression was normalized to the CMV-directed Renilla luciferase expression and was expressed as relative NF-{kappa}B activation in each experiment. The y-axis represents relative luciferase activity.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
HSP have been shown to bind to several receptors on surfaces of cells. Among the better characterized is CD91, found to be a common receptor for gp96, Hsp90, Hsp70, and calreticulin. It acts to bind HSP peptide complexes so as to internalize the antigen into APC for presentation [18 ]. A recent study demonstrated the low expression of CD91 on DC and showed the involvement of the scavenger receptor LOX-1 in binding Hsp70 in DC [19 ]. Although no receptor has yet been identified to bind Hsp60 directly, Lipsker et al. [20 ] demonstrated through competitive binding studies that Hsp60 and Hsp70 seemed to bind to a common cellular receptor, which involved neither CD14 nor TLR4. This is in contrast to earlier reports implicating the involvement of TLR4 and CD14 [16 , 17 , 21 ]. Although the ability of HSP fusion proteins or peptide complexes to facilitate the uptake and cross-presentation of antigen in APC is well established, there is less agreement as to their ability to stimulate cytokine production and drive maturation in these cells. In our study with mycobacterial Hsp65, we found that it is able to enhance cross-presentation of exogenous antigen in DC but has only a weak ability to drive DC activation after prolonged incubation. Polymyxin B has no effect on the ability of Hsp65 to enhance cross-presentation, but it abrogates production of cytokines such as TNF-{alpha}. Ever wary of low-level LPS contamination in our system, we determined the ability of Hsp65 in activating TLR4 in HEK 293T cells. Our results show definitively that Hsp65, at the concentration used for our antigen-presenting assays and DC stimulation experiments in the presence of 20 µg/ml polymyxin B, is unable to activate TLR4. Therefore, Hsp65 does not signal through TLR4, and the cross-presenting ability of Hsp65 is independent of the effect of LPS.

However, we do not discount the ability of Hsp65 to weakly stimulate DC, as seen in our experiments with JAWSII cells and primary BM-derived DC. This stimulation is independent of TLR4 signaling, as deduced from the TLR4 luciferase reporter assays, and could occur through pathways yet undefined. There remains the possibility that the stimulation is mediated by residual LPS through TLR4-independent pathways not inhibited by polymyxin B, although this is unlikely, as the level of contaminating LPS is low (equivalent to <0.2 ng/ml) even without polymyxin B, and TLR4-independent signaling by low levels of LPS has not been reported. Nevertheless, this weak stimulation does not account for the ability of Hsp65 to enhance cross-presentation, as the time course in which these two events occur differed, particularly in BM-derived DC. Antigen presentation occurred within 24 h, but up-regulation of costimulatory molecules was not observed until 70 h. We were also unable to detect an obvious up-regulation of costimulatory molecules and cytokine gene expression in JAWSII cells in the presence of Hsp65 in the duration where cross-presentation took place. JAWSII cells and BM-derived DC remained primarily with immature phenotypes and morphology in the presence of Hsp65.

The enhancement of cross-presentation by Hsp65 is not a peculiar property of the JAWSII cell line, as the phenomenon is also observed in primary BM-derived DC cross-presenting to naïve, antigen-specific T cells. The extent of enhancement by Hsp65 was lower in primary DC cross-presenting to CD8 T cells than in JAWSII cells cross-presenting to B3Z, and this could reflect the higher threshold of activation necessary for naïve T cells compared with the B3Z T cell line. We showed that the ability of Hsp65 to cross-present antigen was not restricted to its fusion proteins or when it was complexed with peptides. It is able to cross-present a soluble, exogenous protein without the need for complex formation. Our finding could explain the study by Skinner et al. [8 ], where they found that Hsp65, coinjected with antigen without any complex formation in mice, was able to prime a T cell response toward the antigen. Our in vitro study is important, as it shows for the first time that Hsp65 could enhance cross-presentation of an unassociated, exogenous protein and provides the basis for use of Hsp65 as adjuvant without the need for fusion or complex formation, thus simplifying its use. It also implies that the mechanism of Hsp65 in promoting cross-presentation is not through direct chaperoning of the antigen into the cells. In fact, we found that Hsp65 was not able to enhance the uptake of the exogenous antigen into DC (data not shown). Furthermore, pretreatment of DC with OVA followed by washing and addition of Hsp65 as much as 8 h later could still result in enhanced cross-presentation (data not shown). Thus, it is possible that Hsp65 is enhancing other parts of the antigen-processing machinery and assembly, such as the efficient processing of protein into peptides, loading of processed peptides to MHC class I, or through the expression of yet-undefined, costimulatory signals from the DC to T cells. For example, we did observe a modest increase in IL-18 expression with Hsp65, which was not inhibited with polymyxin B, and IL-18 could potentially serve as a costimulus to T cell activation [22 ]. With a better understanding of the mechanism of enhanced cross-presentation by Hsp65, we would be able to better evaluate the efficacy of using Hsp65 as an adjuvant in the context of an infectious disease or cancer vaccine.


   ACKNOWLEDGEMENTS
 
Grants R-183-000-046-112 and R-183-000-063-112 from the National University of Singapore and the National Medical Research Council, respectively, funded this work. We thank Tien Huat Lee and Soh Chan Lim for their technical assistance.


   FOOTNOTES
 
1 Current address: Division of Experimental Hematology and Molecular Developmental Biology Program, Children’s Hospital Research Foundation, Cincinnati, OH 45229. Back

Received July 21, 2003; revised September 8, 2003; accepted October 7, 2003.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Heath, W. R., Carbone, F. R. (1999) Cytotoxic T lymphocyte activation by cross-priming Curr. Opin. Immunol. 11,314-318[CrossRef][Medline]
  2. Bevan, M. J. (1976) Cross-priming for a secondary cytotoxic response to minor H antigens with H-2 congenic cells which do not cross-react in the cytotoxic assay J. Exp. Med. 143,1283-1288[Abstract/Free Full Text]
  3. Thery, C., Amigorena, S. (2001) The cell biology of antigen presentation in dendritic cells Curr. Opin. Immunol. 13,45-57[CrossRef][Medline]
  4. Cho, B. K., Palliser, D., Guillen, E., Wisniewski, J., Young, R. A., Chen, J., Eisen, H. N. (2000) A proposed mechanism for the induction of cytotoxic T lymphocyte production by heat shock protein fusion proteins Immunity 12,263-272[CrossRef][Medline]
  5. Srivastava, P. K., Heike, M. (1991) Tumor-specific immunogenecity of stress-induced proteins: convergence of two evolutionary pathways of antigen presentation? Semin. Immunol. 3,57-64[Medline]
  6. Srivastava, P. K., Maki, R. G. (1991) Stress-induced proteins in immune response to cancer Curr. Top. Microbiol. Immunol. 167,109-123[Medline]
  7. Kammerer, R., Stober, D., Riedl, P., Oehninger, C., Schirmbeck, R., Reimann, J. (2002) Noncovalent association with stress protein facilitates cross-priming of CD8+ T cells to tumor cell antigens by dendritic cells J. Immunol. 168,108-117[Abstract/Free Full Text]
  8. Skinner, M. A., Prestidge, R., Yuan, S., Strabala, T. J., Tan, P. L. J. (2001) The ability of heat-killed Mycobacterium vaccae to stimulate a cytotoxic T-cell response to an unrelated protein is associated with a 65 kilodalton heat-shock protein Immunology 102,225-233[CrossRef][Medline]
  9. Vabulas, R. M., Ahmad-Nejad, P., da Costa, C., Miethke, T., Kirschning, C. J., Hacker, H., Wagner, H. (2001) Endocytosed HSP60s use Toll-like receptor 2 (TLR2) and TLR4 to activate the Toll/interleukin-1 receptor signaling pathway in innate immune cells J. Biol. Chem. 276,31332-31339[Abstract/Free Full Text]
  10. Bausinger, H., Lipsker, D., Hanau, D. (2002) Heat-shock proteins as activators of the innate immune system Trends Immunol. 23,342-343[CrossRef][Medline]
  11. Lutz, M. B., Kukutsch, N., Ogilvie, A. L. J., Robner, S., Koch, F., Romani, N., Schuler, G. (1999) An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow J. Immunol. Methods 223,77-92[CrossRef][Medline]
  12. Zhang, H., Tay, P. N., Cao, W., Li, W., Lu, J. (2002) Integrin-nucleated Toll-like receptor (TLR) dimerization reveals subcellular targeting of TLRs and distinct mechanisms of TLR4 activation and signaling FEBS Lett. 532,171-176[CrossRef][Medline]
  13. Byrd, C. A., Bornmann, W., Erdjument-Bromage, H., Tempst, P., Pavletich, N., Rosen, N., Nathan, C. F., Ding, A. (1999) Heat shock protein 90 mediates macrophage activation by Taxol and bacterial lipopolysaccharide Proc. Natl. Acad. Sci. USA 96,5645-5650[Abstract/Free Full Text]
  14. Triantafilou, K., Triantafilou, M., Dedrick, R. L. (2001) A CD14-independent LPS receptor cluster Nat. Immunol. 2,338-345[CrossRef][Medline]
  15. Triantafilou, K., Triantafilou, M., Ladha, S., Mackie, A., Fernandez, N., Dedrick, R. L., Cherry, R. (2001) Fluorescence recovery after photobleaching reveals that LPS rapidly transfers from CD14 to hsp70 and hsp90 on the cell membrane J. Cell Sci. 114,2535-2545[Abstract/Free Full Text]
  16. Ohashi, K., Burkart, V., Flohe, S., Kolb, H. (2000) Heat shock protein 60 is a putative endogenous ligand of the Toll-like receptor 4 complex J. Immunol. 164,558-561[Abstract/Free Full Text]
  17. Bulut, Y., Faure, E., Thomas, L., Karahashi, H., Michelsen, K. S., Equils, O., Morrison, S. G., Morrison, R. P., Arditi, M. (2002) Chlamydial heat shock protein 60 activates macrophages and endothelial cells through Toll-like receptor 4 and MD2 in a MyD88-dependent pathway J. Immunol. 168,1435-1440[Abstract/Free Full Text]
  18. Basu, S., Binder, R. J., Ramalingam, T., Srivastava, P. K. (2001) CD91 is a common receptor for heat shock proteins gp96, hsp90, hsp70 and calreticulin Immunity 14,303-313[CrossRef][Medline]
  19. Delneste, Y., Magistrelli, G., Gauchat, J., Haeuw, J., Aubry, J., Nakamura, K., Kawakami-Honda, N., Goetsch, L., Sawamura, T., Bonnefoy, J., Jeannin, P. (2002) Involvement of LOX-1 in dendritic cell-mediated antigen cross-presentation Immunity 17,353-362[CrossRef][Medline]
  20. Lipsker, D., Ziylan, U., Spehner, D., Proamer, F., Bausinger, H., Jeannin, P., Salamero, J., Bohbot, A., Cazenave, J. P., Drillien, R., Delneste, Y., Hanau, D., de la Salle, H. (2002) Heat shock proteins 70 and 60 share common receptors which are expressed on human monocyte-derived but not epidermal dendritic cells Eur. J. Immunol. 32,322-332[CrossRef][Medline]
  21. Kol, A., Lichtman, A. H., Finberg, R. W., Libby, P., Kurt-Jones, E. (2000) Heat shock protein 60 activates the innate immune response: CD14 is an essential receptor for Hsp60 activation of mononuclear cells J. Immunol. 164,13-17[Abstract/Free Full Text]
  22. Stoll, S., Jonuleit, H., Schmitt, E., Muller, G., Yamauchi, H., Kurimoto, M., Knop, J., Enk, A. H. (1998) Production of functional IL-18 by different subtypes of murine and human dendritic cells (DC): DC-derived IL-18 enhances IL-12-dependent Th1 development Eur. J. Immunol. 28,3231-3239[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Ann Rheum DisHome page
J M. Blander
Phagocytosis and antigen presentation: a partnership initiated by Toll-like receptors
Ann Rheum Dis, December 1, 2008; 67(Suppl_3): iii44 - iii49.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
C.-L. Chang, Y.-C. Tsai, L. He, T.-C. Wu, and C.-F. Hung
Cancer Immunotherapy Using Irradiated Tumor Cells Secreting Heat Shock Protein 70
Cancer Res., October 15, 2007; 67(20): 10047 - 10057.
[Abstract] [Full Text] [PDF]

Home page
 Innate ImmunityHome page
M.-F. Tsan and Baochong Gao
Review: Pathogen-associated molecular pattern contamination as putative endogenous ligands of Toll-like receptors
Innate Immunity, February 1, 2007; 13(1): 6 - 14.
[Abstract] [PDF]

Home page
 J Med MicrobiolHome page
W. Ju, J. Liu, W. Xiao, M. Liu, and X. Qu
Construction of a eukaryotic expression system of HSP65 gene from Mycobacterium tuberculosis, and anti-HSP65 IgG produced in mice
J. Med. Microbiol., January 1, 2005; 54(1): 3 - 6.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
R. Qamra and S. C. Mande
Crystal Structure of the 65-Kilodalton Heat Shock Protein, Chaperonin 60.2, of Mycobacterium tuberculosis
J. Bacteriol., December 1, 2004; 186(23): 8105 - 8113.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
M.-F. Tsan and B. Gao
Endogenous ligands of Toll-like receptors
J. Leukoc. Biol., September 1, 2004; 76(3): 514 - 519.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0703341v1
75/2/260    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, K.
Right arrow Articles by Gan, Y.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, K.
Right arrow Articles by Gan, Y.-H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS