Published online before print July 22, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1
* Department of Biology, University of Roma Tre, Rome, Italy;
Laboratory of Virology, Istituto Superiore di Sanità, Rome, Italy; and
Institute of Molecular Biology and Pathology, CNR, Rome, Italy
1Correspondence: Laboratory of Virology, Istituto Superiore di Sanità, Viale Regina Elena, 299, 00161 Rome, Italy. E-mail: federico{at}iss.it
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, that requires de novo protein synthesis but appears independent from the activation of src tyrosine kinases. The results presented here support the idea that the first intervention of Nef in the intracellular signaling of monocyte-macrophages could generate, by means of the release of soluble factor(s), a secondary wave of activation that could be of a potential pathogenetic significance.
Key Words: monocyte-derived macrophages • STAT • HIV-1 pseudotypes • MIP-1 • src kinases
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
chain signaling [9
]. Furthermore, Nef activates the calcium-dependent signaling in T lymphocytes in a TCR-independent manner [10
]. Such a surprisingly broad collection of effects was effectively recapitulated by the observation that the Nef expression triggers a transcriptional gene program tightly resembling that generated by a physiological T lymphocyte stimulus [11
].
Acquired immune deficiency syndrome (AIDS) is considered the result of heavy immunological disorders induced by HIV/SIV replication. Besides lymphocytes, monocyte/macrophages represent the elective target cells for HIV attack, which are at the same time resistant to its cytopathic effect [12
]. This has significant functional consequences, considering that monocyte/macrophages play a critical role in many aspects of both innate and adaptive immunological responses. As the presence of Nef has been convincingly correlated with a full development of the AIDS disease, at least in animal models [13
, 14
], the study of the influences of Nef on monocyte/macrophages appears of outstanding interest. By means of single-cycle infections of human monocyte-derived macrophages (MDM) with vesicular stomatitis virus glycoprotein (VSV-G) pseudotyped HIV-1, or treatment with recombinant Nef protein, we recently reported that Nef increases the expression of several genes involved in the inflammatory response, as well as the release of a number of chemokines and cytokines, including macrophage inflammatory protein (MIP)-1, MIP-1ß, interleukin (IL)-1ß, IL-6, and tumor necrosis factor [15
, 16
]. Such a cell activation tightly correlated with the activation of p50/p50 NF-
B homodimer [16
].
Here, we report that soluble factors released by human MDM in response to the Nef expression specifically activate STAT3. The STAT molecule family includes so far seven elements [for reviews, see 17 18 ], and their activation is involved in the response of a wide number of cytokines, growth factors, and hormones. Typically, the binding of cytokines with specific receptors lacking intrinsic kinase activity in their cytoplasmic tails induces receptor aggregation and recruitment of members of Janus protein kinases. These become activated by phosphorylating themselves and tyrosine residues in the receptor cytoplasmic tails, which serve as docking sites for the binding of inactive STAT through the Src-homology (SH)-2 domains. STAT monomers became phosphorylated at a constant tyrosine residue and were dimerized. The activated dimers translocate to the nucleus and bind to specific DNA response elements, ultimately influencing gene expression programs.
STAT3 has been found expressed ubiquitously and is transiently activated by numerous ligands, such as type I or II interferons (IFN); epidermal growth factor; platelet-derived growth factor; interleukin-2, -6, and -15; and oncostatin M, as well as by activated src tyrosine kinases [for a review, see 19 ]. STAT3 activation is thought to have a role in cell survival mechanisms, as demonstrated by the resistance to the anti-apoptotic effect of IL-6 in STAT3-defective T lymphocytes [20 ]. Accordingly, STAT3 knockout mice showed an embryonic lethal phenotype [21 ].
The Nef-dependent STAT3 activation we demonstrated in MDM correlated with the presence of Nef domains interacting with the cell endocytotic machinery and relied on the release of MIP-1 and IL-6. These results help illustrate a model concerning the intracellular events leading to the STAT3 activation.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and IL-6 (both from R&D Systems, Minneapolis, MN) were used. To inhibit active protein synthesis, cells were treated with 5 µg/mL of cycloheximide (Sigma-Aldrich, Milan, Italy). For monitoring the effects of the inhibition of src-related kinases, MDM were cultivated in the presence of 5 µM of PP2 (Calbiochem, Darmstadt, Germany), a potent and selective inhibitor of src tyrosine kinases [22
], or as control of PP3 (Calbiochem), a PP2 analog that has no effect on src kinases activation.
Virus preparations, infections, and detection
Preparations of VSV-G pseudotyped HIV-1 were obtained as supernatants of 293 cells 48 h after co-transfection of different derivatives of the pNL4-3 molecular clone with a VSV-G expressing plasmid (molar ratio 5:1), performed by the calcium phosphate method [23
]. Supernatants were clarified and concentrated by ultracentrifugation as described [24
]. The 
env HIV-1 construct was obtained by inserting the Sal I/Bam HI fragment from the env HXB2 HIV-1 molecular clone [25
] in Sal I and Bam HI sites of the pNL4-3 plasmid [26
]. To obtain the env/nef pNL4-3 double mutant, this fragment was also inserted in the Sal I and Bam HI sites of the nef pNL4-3 molecular clone [5
]. To recover HIV-1 genomes expressing diverse nef mutants, each nef allele was PCR-amplified by using a couple of oligoprimers carrying the Mlu I (5' end) and Cla I (3' end) restriction sites and overlapping the nef initiation and stop codons, respectively. Then, each amplification product was inserted in a derivative of env pNL4-3 deleted of the whole nef gene, where the Mlu I and Cla I sites had been previously created in a linker inserted just downstream to the env stop codon. All PCR-derived sequences were rigorously checked by the dideoxy chain-termination method. The envelope glycoprotein from the VSV was expressed in a pcDNA3 vector under the control of the immediate early cytomegalovirus promoter.
Virus preparations were titrated by measuring HIV-1 p24 contents by quantitative enzyme-linked immunoabsorbant assay (ELISA) (Abbott, Abbott Park, IL), and through a reverse-transcriptase assay as described [27 ]. Pseudotyped HIV-1 (10 ngs, approximately corresponding to 5x105 cpm)/106 cells were used to infect 7-day-old MDM. The virus adsorption was performed in 48-wells plates by incubating the cells for 1 h at 37°C with the viral inoculum diluted in 100 µL of complete medium. Afterwards, the viral inoculum was removed and the cells were washed and refed with 300 µL of complete medium.
Percentages of cells expressing intracytoplasmic HIV-1 Gag-related products were evaluated by FACs analyses after treatment with Permeafix (Ortho Diagnostic, Raritan, NJ) for 30 min at room temperature (r.t.) and labeling for 1 h at r.t. with l:50 dilution of KC57-RD1 PE-conjugated anti HIV-1 Gag mAb (Coulter Corp., Hialeah, FL).
Preparation of recombinant proteins and immunodepletions
Recombinant (r)Nef proteins were recovered as 6' His tagged fusion proteins as described previously [28
]. Briefly, the nef gene from NL4-3 HIV-1 strain or mutants thereof was amplified by PCR and cloned in frame with the 6' His tag into the 5' Bam H I/3' Sal I sites of pQE 30 vector (Qiagen, Chatsworth, CA). rNefs were purified by lysing bacteria in a 8 M urea buffer and using Ni-NTA resin (Qiagen) according to the manufacturer’s recommendations. Recombinant protein preparations were scored as negative for the presence of bacterial endotoxins by using the Limulus amebocyte lysate assay (Biowhittaker, Walkersville, MD).
To ensure a total and specific depletion of rNef, the complete medium supplemented with 100 ng/mL of rNef was incubated for 8 h at 4°C with a 1:50 dilution of a cocktail containing six different mono- and polyclonal anti Nef Abs (all obtained from the NIH AIDS Research and Reference Program). As a control, the rNef-complemented medium was incubated with equal amounts of irrelevant isotype- and species-matched Abs. Then, immunocomplexes were reacted with detergent-free protein A-G Agarose beads (Pierce, Rockford, IL) overnight at 4°C. Afterwards, immunocomplexes bound to protein A-G Agarose were discarded through centrifugation and supernatants were filtered (0.22 µm pore diameter) and added to MDM cultures. MIP-1 and IL-6 immunodepletions were performed with similar procedures by using specific neutralizing mAbs (R&D Systems). The complete clearing of soluble factors was checked by Western blot for rNef and by ELISA for MIP-1 and IL-6.
Western blot assay
MDM were washed twice with PBS, pH 7.4, and were lysed in 20 mM HEPES, pH 7.9; 50 mM NaCl; 10 mM EDTA; 2 mM EGTA; 0.5% nonionic detergent IGEPAL CA-630 (Sigma); 0.5 mM DTT; 20 mM sodium molibdate; 10 mM sodium orthovanadate; 100 mM sodium fluoride; 10 µg/mL leupeptin; and 0.5 mM PMSF for 20 min in ice. Whole cell lysates were centrifuged at 6000 g for 10 min at 4°C, and the supernatants frozen at –80°C. The protein concentration of cell extracts was determined by the Bio-Rad (Hercules, CA) protein assay. Aliquots of 20–30 µg of cell extracts were resolved on 7–10% SDS-PAGE and transferred by electroblotting on nitrocellulose membranes (Sartorius AG.Gottingen, Germany) for 60 min at 100 Volts with a Bio-Rad trans-blot. For the immunoassay, nitrocellulose membranes were blocked in 3% bovine serum albumin (BSA) fraction V (Sigma) in TTBS/EDTA (10 mM Tris-HCl, pH 7.4; 100 mM NaCl; 1 mM EDTA; 0.1% Tween-20) for 30 min at r.t., then incubated for 1 h at r.t. with specific antibodies diluted in 1% BSA/TTBS-EDTA. Antibodies used in the different immunoblotting assays are the following: polyclonal anti phosphotyrosine STAT3 from Cell Signaling Technology (Beverly, MA); monoclonal anti phosphotyrosine STAT3 and anti STAT3 from Santa Cruz Biotechnology (Santa Cruz, CA); polyclonal anti phosphotyrosine STAT1 from UBI (Lake Placid, NY); monoclonal anti STAT1 from Transduction Laboratories (San Diego, CA); and monoclonal anti ß tubulin from ICN Biomedicals (Costa Mesa, CA). The polyclonal sheep anti Nef antiserum was a generous gift of M. Harris, University of Leeds, Leeds, UK. Immune complexes were detected through horseradish peroxidase-conjugated goat anti-rabbit (Calbiochem) or goat anti mouse (NEN, Boston, MD) antiserum, followed by enhanced chemioluminescence reaction (ECL, Amersham Pharmacia Biotech, Milan, Italy).
DNA electrophoresis mobility shift assay (EMSA)
Whole-cell extracts as prepared for Western blot assays were used. To measure the association between DNA binding proteins and DNA sequences, the double-stranded oligonucleotides (12 pmol) described below were end-labeled with 
[32P]ATP (1.11 MBq, 222 TBq, NEN) by T4 polynucleotide Kinase (Biolabs, Beverly, MA).The labeled oligonucleotide probes (74–130 mBq) were incubated for 1 h at 4°C and 20 min at room temperature in a final volume of 20 µL containing 20 µg cell extract proteins prepared as above in a binding buffer containing 20 mM Tris, pH 7.5; 75 mM KCl; 1 mM DTT; 6 µg/mL BSA; 2 µg/mL poly(dI)-poly(dC) (Sigma); and 13% glycerol. To control the specificity of the DNA-protein binding, cold competitors were added in 200-fold molar excess of the radiolabeled probe. Antibody treatment for supershifts was performed by adding 1 µg of specific antibody anti-STAT1 mAbs from Transduction Laboratories or 2 µg of polyclonal antibody anti-STAT3 from Santa Cruz Biotechnology to 20 µg cell extract proteins. Cell proteins (10 µg) obtained from HeLa cell line treated with 100 IU/mL human rIFNß for 30 min were used as positive control for the detection of STAT1- and STAT3-containing complexes. The analysis of the DNA-protein complex was performed on 5% nondenaturating gel (acrylamide/bisacrylamide 29:1) in 1 TBE buffer, pH 8.3 (100 mM Tris, 97 mM boric acid, 2.5 mM EDTA). The double-stranded oligonucleotide used was the sis-inducible element (SIE) sequence of the c-fos promoter (5'GTCGACATTTCCCGTAAATCGTCGA3').
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B [16
]. In turn, the most part of such soluble factors could influence the cell-signaling pathways upon binding with the specific receptors. Thus, it appears of interest extending the observations concerning the consequences of the Nef expression in terms of cell signaling. Monocytes (
95% pure) isolated from four healthy donors were cultivated separately for 7 days. Thereafter, cell cultures were challenged with 10 ng/106 cells of VSV-G pseudotyped HIV-1 defective for the expression of either Env (env), or both Env and Nef viral products (env/nef). Thereafter, cells were harvested and pooled, and the cell lysates were tested for the activation of STAT3. We observed increased levels of tyrosine phosphorylation of both and ß isoforms of STAT3 correlating with the Nef expression. Such an activation was readily detectable 8 h after the challenge (Fig. 1a
), remaining over the background levels until 24 h post-infection (not shown). The actual number of MDM expressing the infecting HIV-1 genome was evaluated by FACs analysis for the expression of HIV-1 Gag-related products 16 h after the challenge (Fig. 1b)
. Of note, the challenging of MDM with (VSV-G) HIV-1 pseudotypes allowed to reach a very high infection efficiency (>90%), as demonstrated by the percentages of cells accumulating HIV-1 Gag-related products, and independently from the expression of Nef. The presence of Nef in infected MDM was checked by Western blot analysis of cell lysates 16 h post infection (Fig. 1c)
. Importantly, both HIV-1 Gag and Nef products were indeed detectable at the time of cell harvesting for the STAT3 analysis, even if at lower levels (not shown).
 View larger version (21K): [in a new window] |
Figure 1. MDM infected by (VSV-G) HIV-1 activate STAT3 in a Nef-dependent manner. a) Western blot analysis of phosphotyrosine-STAT3, STAT3, and ß-tubulin levels performed on total cell extracts assayed 8 h after the infection with 10 ng of p24 Gag/106 cells of VSV-G pseudotyped HIV-1, expressing or not the nef gene. As a positive control, MDM were treated for 1 h with 50 IU/mL of human recombinant ß-IFN. Cell extracts analyzed were obtained by pooling simultaneous cell cultures from four healthy donors. b) Analysis of the expression of HIV-1 Gag-related products in MDM 16 h after the challenge and, as control, in uninfected MDM (Ctrl). The FACs analysis was performed by using a PE-conjugated anti-Gag HIV-1 mAb. The labeling of either uninfected or infected MDM with isotype matched unspecific PE-conjugated immunoglobulins and resulted in fluorescence curves overlapping those from uninfected cells labeled with the anti-HIV-1 Gag mAb (not shown). c) Western blot analysis for the expression of Nef performed in total cell lysates from MDM cultures assayed for both STAT3 activation and expression of HIV-1 Gag-related products. Proteins of cell lysates from MDM uninfected (Lane 1) or infected with (VSV-G) env (Lane 2) or env/nef (Lane 3) HIV-1 were resolved in a 12% SDS-PAGE and were blotted, and the filter was incubated with a 1:1000 dilution of a sheep polyclonal anti Nef antiserum. In both (a) and (c), specific signals are marked on the left side, whereas kilodaltons of molecular-size markers are reported on the right. The results are representative of five independent experiments.
|
 View larger version (26K): [in a new window] |
Figure 3. The endogenous expression of Nef alleles mutated in either the myristoylation signal or the C-terminal loop fails to activate STAT3. a) Western blot analysis of phosphotyrosine-STAT3, STAT3, ß-tubulin, and Nef levels performed on total cell extracts from MDM uninfected (Ctrl) or challenged with 10 ng of p24 Gag/106 cells of VSV-G pseudotyped HIV-1 expressing different nef mutants or, as control, lacking the nef gene. Eight hours thereafter, cells were harvested and cell lysates were assayed for the indicated products. Cell lysates were obtained by pooling MDM purified from three healthy donors, and the results are representative of three independent experiments. Specific signals are indicated on the left side, whereas molecular-size markers (in kilodaltons) are reported on the right. b) Analysis for the expression of HIV-1 Gag-related products in MDM cultures whose analyses for the STAT3 activation are reported in (a). The intracytoplasmic FACs analyses were performed 16 h after challenge by using a PE-conjugated anti-Gag HIV-1 mAb. Fluorescence curves overlapping those from uninfected cells labeled with anti-HIV-1 Gag mAb were obtained upon labeling either uninfected or infected MDM with isotype matched, unspecific PE-conjugated immunoglobulins (not shown).
|
/ß doublet appeared to be not clearly resolved.
 View larger version (30K): [in a new window] |
Figure 2. Human MDM activate STAT3 upon treatment with rNef. a) Western blot analysis of phosphotyrosine-STAT3, STAT3, and ß-tubulin levels assayed at different time points after addition of 100 ng/mL of rNef. Specific signals are indicated on the left side, whereas molecular size markers (in kilodaltons) are reported on the right. The analyses were performed on total cell extracts recovered upon pooling cells from four different healthy donors, and the results represent three independent experiments. b) EMSA performed by incubating total cell extracts from MDM untreated or treated with 100 ng/mL of wt rNef for 2 h with a 32P-labeled SIE of the c-fos promoter. Supershifts were performed with either monoclonal antibody anti-STAT1 or polyclonal antibodies anti-STAT3. Cold competitor DNA (200-fold molar excess) was used as specific control. Electrophoretic mobility for STAT1-1 or STAT1-3 dimers is indicated on the left side. Cell extract from HeLa cell line treated with 100 IU/mL human rIFNß for 30 min was used for the detection of STAT1- and STAT3-containing complexes.
|
Furthermore, we could detect increased phosphorylation of STAT3 by using doses of rNef as low as 10 ng/mL (not shown). The specificity of the effects induced by rNef was proven by means of the MDM treatment with rNef complemented medium after Nef-specific immunodepletion performed by adding a mixture of anti Nef mAbs or, as control, equal amounts of isotype matched, non-specific mAbs (data not shown).
Taken together, the results obtained upon either HIV-1 infection or rNef internalization consistently demonstrated that Nef induces STAT3 activation in human MDM.
The N-terminal myristoylation and domains in the C-terminal flexible loop of Nef are involved in the STAT3 activation
The intracellular cycle of Nef has been revealed in great detail. Nef is translated from free ribosomes, and, by means of its N-terminal myristoylation, is targeted to the cell membrane [35
], where it interacts with a large number of signaling molecules, particularly through its SH3-binding polyproline region [36
]. Afterwards, Nef shows a strong internalization activity, mediated by the efficient association with a number of cell endocytotic proteins and governed by domains present in its C-terminal flexible loop [2
, 3
, 37
]. To inspect the mechanism of the Nef-dependent STAT3 activation in MDM, we first sought to individuate the step of the Nef cycle specifically involved in the STAT3 activation by testing the effects of an array of Nef mutants expressed in the viral context. Nef mutants we assayed could be classified as follows: G2A, a mutant lacking the myristoylation signal, thus becoming defective for the cell membrane targeting [37
]; 72AxxA75, a mutant in the polyproline region, defective for the interaction with the SH3 domain of signaling cell proteins [36
]; and 155EE-QQ156, 164LL-AA165, and 174DD-AA175 mutants, all showing a strongly impaired internalization activity, with a consequent persistence at the cell membrane. In detail, even if a general consensus has not been reached yet [38
], it has been reported that the 155EE156 diacidic motif is involved in the binding of Nef with the ß subunit of the coatomers in endosomes, a complex coating the vesicles involved in the transport from early-to-late endosomes and lysosomes [39
]. The 164LL165 dileucine is a typical sorting motif, required for targeting Nef to the clathrin-coated pits and early endosomes through the binding of adaptor molecules (AP)-2 [40
, 41
]. Finally, the 174DD175 Nef domain has been proven to be involved in the interaction of Nef with the V1H regulatory subunit of the V-ATPase (i.e., a multi-subunit primary proton pump regulating the acidic luminal pH in organelles such as secretory vesicles, endosomes, lysosomes, and synaptic vesicles) [42
] and facilitating the Nef transport to early endosomes [43
, 44
].
MDM cultures, 7 days old, from four healthy donors were infected with (VSV-G) pseudotyped env HIV-1 strains expressing different Nef mutants and, 8 h thereafter, the levels of STAT3 tyrosine phosphorylation were monitored by Western blot analysis. It appeared quite clear that Nef mutated in domains comprising the C-terminal flexible loop (i.e., 155EE-QQ156, 164LL-AA165, and 174DD-AA175) failed to activate STAT3 (Fig. 3a)
. Similarly, no STAT3 activation was detected in cells infected by HIV-1 expressing the Nef mutant unable to localize at the cell membrane. Differently, Nef mutations in the polyproline-rich region (i.e., 72AxxA75) did not negatively affect the STAT3 phosphorylation. To prove that the cell populations challenged with HIV-1 expressing diverse Nef mutants were infected at similar extents, intracytoplasmic FACs analyses of HIV-1 Gag products were performed on the remainder of cell cultures 16 h post infection (Fig. 3b)
. Moreover, the effective expression of different Nef alleles was detected by Western blot analysis of cell lysates 16 h after the challenge (Fig. 3a)
. In summary, our data suggest that both the Nef membrane targeting and its interactions with the endocytotic machinery are important for the STAT3 activation.
Critical events for the Nef-dependent STAT3 activation occur during the Nef retrograde intracellular pathway
We have already reported that exogenous rNef, in the wild-type as well as in its mutated forms, is efficiently internalized by MDM [16
, 28
]. Some of evidence indicates that the fate of rNef upon internalization resembles that of the endogenously expressed Nef during its retrograde pathway. In fact, we have already described that, upon MDM internalization, rNef disposes in an intracytoplasmic punctated pattern tightly reminding that already described in cells endogenously expressing Nef [16
, 28
], and that suggests an accumulation of Nef in vacuolar intracellular compartments. In addition, the co-localization of rNef-FITC with Lamp-2 (i.e., a lysosomal marker) that we observed by confocal microscope analysis (unpublished results) strongly supports the idea that rNef is ultimately conveyed to the lysosomal compartment, as occurs for the endogenously expressed Nef. Lastly, some effects induced by rNef (e.g., the increased release of inflammatory chemokines/cytokines) [15
, 16
, 28
] fairly reproduced those observed by the endogenous expression of Nef. Hence, the analysis of effects induced upon rNef internalization could be of some help in elucidating the overall effects of the endogenously expressed Nef.
We sought to dissect the contributions of the Nef cell membrane targeting via myristoylation from that originating by its interactions with the endocytotic machinery by testing the effects of the G2A rNef mutant compared with 155EE-QQ156 and 174DD-AA175 rNefs, whose mutations involve domains important for the ultimate steps of cell internalization (i.e., conveying to the endosome/lysosome compartment). As shown in Fig. 4a , comparable STAT3 phosphorylation levels have been detected upon treatment with either wt or G2A rNefs. Conversely, and consistently to that already observed upon virus infection, no increases in the STAT3 phosphorylation were detectable in MDM treated with either 155EE-QQ156 or 174DD-AA175 rNef mutants (Fig. 4b) .
 View larger version (27K): [in a new window] |
Figure 4. rNefs mutated in domains of the C-terminal loop do not activate STAT3. Phosphotyrosine-STAT3, STAT3, and ß-tubulin amounts detected through Western blots performed on total cell extracts of MDM treated for 2 h with 100 ng/mL G2A (a) and 155EE-QQ156 and 174DD-AA175 (b) rNefs. MDM, untreated or treated with 100 ng/mL of wt rNef, were used as controls. The analyses were performed on total cell extracts recovered by pooling cells from four different healthy donors, and the results are representative of three independent experiments. In all panels, specific signals are indicated on the left side, whereas molecular size markers (in kilodaltons) are reported on the right.
|
The Nef-dependent STAT3 activation relies on the release of soluble factor(s) and requires active protein synthesis
Typically, STATs are activated upon the engagement of cytokine receptors with the specific ligands. We recently observed that the presence of Nef in MDM activates NF-B, leading to the release of numerous inflammatory soluble factors [16
]. Interestingly, both the STAT3 negative 155EE-QQ156 and 174DD-AA175 Nef mutants have previously shown inability to activate NF-B or induce the release of inflammatory factors [16
]. This enforces the idea that the Nef-dependent STAT3 activation relies on the release of soluble factor(s). To confirm such an hypothesis, the supernatants from MDM treated for 2 h with rNef were added to fresh autologous MDM after a specific immunodepletion, ensuring the complete clearing of residual rNef as proven by Western blot analysis on supernatants (not shown). As clearly shown in Fig. 5a
, the conditioned medium efficiently activated STAT3 in fresh MDM as early as 30 min after the treatment. The fact that this time lag appeared to be not sufficient to induce STAT3 phosphorylation upon the rNef treatment (see Fig. 2a
) supports the conclusion that the soluble factor(s) released upon the Nef stimulus, rather than residual rNef, could indeed activate STAT3. Similar results have been obtained by treating MDM with the medium conditioned by MDM infected by (VSV-G) pseudotyped HIV-1 (data not shown).
 View larger version (22K): [in a new window] |
Figure 5. Nef-induced STAT3 activation in MDM is mediated by the release of soluble factor(s) and depends on active protein synthesis. a) Western blot analysis of phosphotyrosine-STAT3, STAT3, or ß-tubulin levels performed on total cell extracts of MDM treated for 30 and 60 min with supernatants collected from MDM of the same donors treated with 100 ng/mL of Nef for 2 h, after immunodepletion of residual rNef. Cell extracts from MDM treated with supernatants from untreated MDM (Ctrl) served as controls. Cell extracts analyzed were obtained by pooling simultaneous cell cultures from four healthy donors, and data from one representative of three independent experiments are shown. b) Western blot analysis of phosphotyrosine-STAT3, STAT3, ß-tubulin, and IRF-1 on total cell extracts of MDM pretreated or not for 2 h with 5 µg/mL of cycloheximide, and incubated for additional 2 h with 100 ng/mL of rNef. As controls, the analyses were performed on cell extracts of MDM treated either for 2 h with 100 ng/mL of rNef or with cycloheximide only. Cell extracts were obtained by pooling simultaneous cell cultures from three healthy donors, and the results are representative of two independent experiments. Specific signals are indicated on the left side, whereas molecular size markers (in kilodaltons) are reported on the right.
|
30 min [45
]. We concluded that the release of de novo synthesized soluble factors was involved in the Nef-dependent STAT3 activation in MDM.
MIP-1 is involved in the Nef-dependent STAT3 activation
Next, we sought to identify the soluble factors involved in the Nef-dependent STAT3 activation. We have already shown that the presence of Nef leads MDM increasing the transcription of genes coding for several inflammatory cytokines/chemokines, including MIP-1, MIP-1ß, IL-1ß, IL-6, and tumor necrosis factor [16
]. Among these, IL-6 has been already described as a potent STAT3 activator in monocyte/macrophages [46
47
48
], whereas the influence of MIP-1 in the STAT3 activation state has been exclusively reported for the human lymphoblastoid Jurkat cell line [49
]. No influences on the STAT3 activation have been described for the other soluble factors we previously demonstrated to be released upon the Nef stimulus.
Thus, we measured the levels of both IL-6 and MIP-1 in the supernatants, either after the infection with pseudotyped HIV-1 or upon rNef internalization. As reported in Table 1
, the expression of Nef in MDM induced a significant increase in the concentrations of both IL-6 and MIP-1. To evaluate the contribution of MIP-1 in the overall effect of Nef-induced STAT3 activation, two different approaches have been pursued. First, we added to the MDM culture medium 10 ng/mL of recombinant human MIP-1 and monitored the kinetic of STAT3 phosphorylation. Interestingly, we observed a prompt STAT3 phosphorylation 15 min after the treatment, which decreased within 30 min (Fig. 6a
), possibly as the consequence of the action of specific suppressors of the STAT activation, that is, PTPase, CIS/SOCS, or PIAS [50
]. As a complementary approach, the STAT3 phosphorylation was tested in fresh MDM cultivated for 15 min with the medium conditioned by rNef-treated MDM upon immunodepletion of both rNef and MIP-1. Consistently with the previous analysis, the MIP-1 immunodepletion led to a reduction of the STAT3 activation signal (Fig. 6b)
. The effective clearance of MIP-1 from the supernatants of rNef-treated MDM was checked by ELISA (not shown). These data indicate that MIP-1 could act as part of the mechanism of the Nef-dependent STAT3 activation in primary human monocyte/macrophages.
|
View this table: [in a new window] |
Table 1. Levels of MIP-1 and IL-6 in supernatants of MDM after the infection with wt or nefVSV-G pseudotyped HIV-1, or the treatment with wt rNefa
|
 View larger version (25K): [in a new window] |
Figure 6. MIP-1 is involved in the Nef-mediated STAT3 activation. a) Western blot analysis of phosphotyrosine-STAT3, STAT3, or ß-tubulin in MDM treated with 10 ng/mL of human rMIP-1 at different times. As a positive control, MDM were also treated with 100 ng/mL of rNef. Cell extracts analyzed were obtained by pooling simultaneous cell cultures from three healthy donors, and results are representative of three independent experiments. b) Western blot analysis of phosphotyrosine-STAT3, STAT3, or ß-tubulin performed on total cell extracts from MDM incubated for 15 min with supernatants from MDM treated for 2 h with 100 ng/mL of rNef after rNef and MIP-1 double immunodepletions. As control, unspecific species-matched Abs were added to part of the supernatants. Then, immunodepleted supernatants were added to fresh MDM from the same donors and, after an incubation of 15 min, cells were harvested and total cell extracts were assayed. Cell extracts from MDM either untreated (Ctrl) or treated for 2 h with supernatants from untreated MDM (CM Ctrl) served as controls. Analyses were performed on cell extracts obtained by pooling simultaneous cell cultures from four healthy donors, and the results are representative of two independent experiments. In either panel, specific signals are indicated on the left side, whereas molecular size markers (in kilodaltons) are reported on the right.
|
 View larger version (31K): [in a new window] |
Figure 7. The STAT3 activation induced by Nef is independent from the activation of src tyrosine kinases. a) Western blot analysis of phosphotyrosine-STAT3, STAT3, and ß-tubulin levels performed on total cell extracts from MDM upon challenge with (VSV-G) HIV-1 expressing or not the nef gene. MDM were pretreated for 60 min with 5 µM of PP2, washed, incubated for 1 h with the viral inoculum in the presence of PP2, washed, and refed with complete medium in the presence of 5 µM PP2. After 8 h of incubation, cells were harvested and cell lysates were tested for the STAT3 activation. As controls, cell lysates from MDM cultivated in complete medium (Ctrl) or in the presence of 5 µM PP2 for 8 h (PP2) were also analyzed. b) Western blot analysis of phosphotyrosine-STAT3, STAT3, and ß-tubulin levels performed on total cell extracts from MDM upon pretreatment for 30 min with 5 µM of PP2 or PP3, and cultivation for additional 2 h in the presence of 100 ng/mL of wt rNef and PP2 or PP3. Thereafter, cells were harvested and cell lysates were tested for the STAT3 activation. As controls, cell lysates from MDM cultivated in complete medium (Ctrl) or in the presence of 100 ng/mL of wt rNef for 2 h were also analyzed. For both experiments, cell lysates were obtained by pooling MDM purified from four healthy donors, and the results are representative of two independent experiments. Specific signals are indicated on the left side, whereas molecular size markers (in kilodaltons) are reported on the right.
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
By means of either single-cycle infection experiments driven by VSV-G pseudotyped HIV-1 or treatment with rNef, we now describe that Nef specifically activates STAT3 in primary MDM. Such a STAT3 activation is mediated by the release of de novo synthesized soluble factor(s) whose Nef-dependent enhancement upon HIV-1 infection was previously demonstrated occurring as early as 6 h post infection [16 ]. It has been reported that Nef promotes, in a STAT3-dependent manner, the independence from cytokines/growth factors for the expansion of TF-1 cells, a human myeloid cell line that could be induced to a macrophage-like differentiation upon phorbol myristate acetate treatment [53 ]. The mechanism described for the Nef-induced STAT3 activation in TF-1 appears quite different from what we have observed in the primary human monocyte-macrophages. In fact, no involvement of soluble factors has been claimed, whereas the src tyrosine kinase Hck appeared to be involved in the observed STAT3 phosphorylation as the consequence of the interaction with the constitutively expressed Nef. Conversely, these reported analyses performed by expressing a Nef defective for the src tyrosine kinase binding (i.e., 72AxxA75 Nef), together with the results obtained by treating Nef-expressing MDM with the src tyrosine kinase inhibitor PP2, consistently indicate that the Nef-dependent STAT3 activation in primary MDM does not involve such a family of tyrosine kinases. Most likely, the observations made in TF-1 and primary MDM reflect the different nature of cells.
As for the nature of soluble factors involved, here we report that the chemokine MIP-1 contributes to the activation of STAT3 in primary human MDM. The possibility that the STAT3 activation could be influenced by the MIP-1 cell treatment was first observed in the human lymphoblastoid Jurkat cell line [49
]. Here we describe the involvement of MIP-1 in the STAT3 activation in a more physiologically relevant cell system, enforcing the idea that MIP-1 induces STAT3 activation also in vivo. The fact that the MIP-1 immunodepletion did not fully abolish the effect on the STAT3 activation of supernatants from the rNef-treated MDM strongly suggests the involvement of additional soluble factor(s), in particular IL-6, whose release appeared increased upon Nef stimulation.
It has been described that the endogenously expressed Nef anchors the inner side of the cell membrane through its N-terminal myristoylation. Afterwards, Nef shows a strong activity of internalization of itself, as well as of different interacting cell membrane molecules {e.g., CD4 [37 ], TCR [54 , 55 ], CD28 [56 , 57 ]}. The Nef retrograde intracellular path starts upon the association with AP-2 molecules at the cell membrane, leading to its inclusion in clathrin coated pits and the ultimate accumulation in the endosomal/lysosomal compartment [58 , 59 ]. The quite high efficiency of infection achieved through the single-cycle infection performed with the VSV-G pseudotyped HIV-1, as well as the ability of MDM to internalize rNef efficiently, allowed us to perform a systematic evaluation of the involvement of different Nef domains in the activation of STAT3.
The G2A Nef, a mutant failing to reach the cell membrane, did not activate STAT3 when expressed in the viral context, which conversely led to STAT3 activation upon internalization of the soluble recombinant protein product. The significance of such apparently contrasting data could be clarified by considering that all mutations in the Nef C-terminal loop induced a decreased internalization activity [39 , 40 , 43 ], led to unresponsiveness in terms of STAT3 activation. In fact, STAT3 was not activated either by the 164LL-AA165 Nef mutant, whose internalization is blocked at the cell membrane, or by the 155EE-QQ156 or 174DD-AA175 Nef mutants, which fail to be targeted to the early or late endosomes and lysosomes, respectively. Thus, it should be hypothesized that events occurring during or after the Nef targeting to late endosomes and lysosomes are based on the STAT3 activation. Consistently, the lack of STAT3 activation observed upon the endogenous expression of G2A Nef correlates with its inability to be delivered to the endosome/lysosome vesicles [58 , 59 ], which differs from the endogenously expressed wild-type Nef or G2A rNef, both of which dispose in a typical intracytoplasmic punctate pattern that suggests association with the endocytotic cell apparatus [28 , 58 , 59 ].
We have reported recently that Nef induces the release of inflammatory factors that are likely through the activation of NF-B, and that both EE and DD diacidic domains of the Nef C-terminal flexible loop are required for such a phenotype [16
]. Moreover, the Nef-induced NF-B activation tightly correlates with the transcriptional activation of numerous genes such as MIP-1 and IL-6 [16
]. Here, we report that the Nef domains important for the Nef-dependent NF-B activation are also involved in the STAT3 activation. Such a functional correlation suggests that the Nef-dependent STAT3 activation is based on NF-B activation.
Taken together, these data are consistent with the hypothesis that the Nef targeting to the endosomal/lysosomal compartment leads to intracellular signaling, possibly involving NF-B activation and ultimately inducing the release of soluble factors, including MIP-1 and IL-6. Such soluble factors participate to a sustained STAT3 activation in the Nef-expressing cells, meanwhile influencing also cell signaling in cross-talking cell types (Fig. 8
). This could be of relevance for the interpretation of the role played by the Nef protein in the AIDS pathogenesis.
 View larger version (29K): [in a new window] |
Figure 8. A model for the Nef-induced STAT3 activation in human monocyte/macrophages. Whatever is endogenously expressed by infecting HIV or internalized from the extracellular milieu, Nef molecules are conveyed to the endosomal/lysosomal compartment, thereby activating NF-B, with consequent increase in the expression of HIV genome as well as of genes coding inflammatory products, as MIP-1 and IL-6. These soluble factors, by binding their specific receptors on the same or neighboring cells, lead to the activation of STAT3 molecules that migrate into the nucleus, which thereby induce gene expression/cell activation.
|
Received April 17, 2003; revised June 20, 2003; accepted June 24, 2003.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B activation J. Immunol. 170,1716-1727B, AP-1 and c-Jun N-terminal kinase and stimulates HIV transcription in promonocytic cells: role in AIDS pathogenesis J. Biol. Chem. 278,2219-2227This article has been cited by other articles:
 |
|
 |
|
  G. Mangino, Z. A. Percario, G. Fiorucci, G. Vaccari, S. Manrique, G. Romeo, M. Federico, M. Geyer, and E. Affabris In Vitro Treatment of Human Monocytes/Macrophages with Myristoylated Recombinant Nef of Human Immunodeficiency Virus Type 1 Leads to the Activation of Mitogen-Activated Protein Kinases, I{kappa}B Kinases, and Interferon Regulatory Factor 3 and to the Release of Beta Interferon J. Virol., March 15, 2007; 81(6): 2777 - 2791. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. MORDELET, K. KISSA, A. CRESSANT, F. GRAY, S. OZDEN, C. VIDAL, P. CHARNEAU, and S. GRANON Histopathological and cognitive defects induced by Nef in the brain FASEB J, December 1, 2004; 18(15): 1851 - 1861. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
