| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Published online before print August 21, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
HIV Immunopathogenesis Laboratory, The Wistar Institute, Philadelphia, Pennsylvania
1 Correspondence: The Wistar Institute, 3601 Spruce Street, Room 480, Philadelphia, PA 19130. E-mail: montaner{at}wistar.upenn.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
(IFN-). We show that IL-13 and IL-4 increase transcripts, total protein, and cell-surface expression of DC-SIGN in all MDM tested, IFN- results ranged from no change to up-regulation of surface expression, and message and total protein were, respectively, induced in all and 86% of donors tested. Transmission experiments of HIV-1 X4 between cytokine-treated MDM to Sup-T1 cells showed no association between total transmission and DC-SIGN up-regulation. IL-4 but not IL-13 resulted in a less than twofold increase in MDM viral transmission to CD4+ T cells in spite of a fourfold up-regulation in DC-SIGN expression by either cytokine. In contrast, IFN- treatment induced a decrease in total transmission by at least two-thirds, despite its induction of DC-SIGN. Soluble mannan resulted in a greater inhibition of viral transmission to CD4+ T cells than neutralizing anti-DC-SIGN monoclonal antibody (67–75% vs. 39–48%), supporting the role of mannose-binding receptors in viral transmission. Taken together, results show that DC-SIGN regulation in MDM does not singly predict the transmission potential of this cell type.
Key Words: IL-4 • IL-13 • IFN-
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Based on the observations that DC-SIGN mediates capture and transmission of HIV-1 from DC to CD4 T cells and that DC-SIGN-bound virus retains infectivity for several days [2 ], this molecule has been proposed to contribute to HIV-1 dissemination and transport of viral particles from the mucosal sites of entry (mucosal DC) to the T cell areas of the lymphoid tissue [24 ]. However, the role of DC-SIGN as a predominant attachment factor for HIV-1 in DC has been recently challenged by several observations, indicating that epidermal DCs do not express DC-SIGN and that in addition to DC-SIGN, other C-type lectin receptors play a relevant role in HIV-1 attachment during infection and transmission between dermal DCs and T cells [9 , 25 , 26 ].
Although the monocyte-derived DC (MDDC) system has been proven useful for the study of DC-SIGN in pathogen binding and transmission, the potential contribution of DC-SIGN expression on monocyte-derived macrophages (MDM) to HIV-1 transmission remains undefined. To gain further insights into the regulation of DC-SIGN expression in primary human MDM, we have extended our original observations on interleukin (IL)-13-induced MDM expression of DC-SIGN [27
] by performing a detailed analysis on the effects of IL-4, IL-13, and interferon- (IFN-) on DC-SIGN and HIV-1 transmission to T cells. Here, we show that despite a marked up-regulation of DC-SIGN by cytokine regulation, no association is observed between DC-SIGN expression and the amount of HIV-1 transmission from MDM to CD4 T cells.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
(10 ng/ml) at the time of the culture (day 0). Initial studies that compare IL-13- or IL-4-treated monocytes and IL-4- and granulocyte macrophage-colony stimulating factor (GM-CSF)-derived MDDC show marked differences in adherence (MDDC, less adherent), CD86 expression (higher in IL-4- or IL-13-treated macrophages), and human leukocyte antigen-DR levels (higher in IL-4- or IL-13-treated macrophages) to support that an IL-4- or IL-13-treated monocyte is a related yet not an equal state to immature MDDC.
Cell lines
SUP-T1 cells were cultured in RPMI 1640 supplemented with glutamine, antibiotics, and 10% FBS. T-REX cells, parental or expressing DC-SIGN, were kindly provide by Robert Doms (University of Pennsylvania). T-REX–DC-SIGN+ cells were maintained in RPMI 1640 supplemented with 10% FBS, 100 µg/ml zeocin, and 50 µg/ml blasticidin. DC-SIGN was induced in T-REX–DC-SIGN+ after treatment with doxycyclin (Sigma Chemical Co., St. Louis, MO) for 12 h. Parental T-REX cells were cultured in a similar condition without zeocin. Parental and DC-SIGN-transfected cells were used throughout the study as controls in flow cytometry, Western blotting, and reverse transcriptase-polymerase chain reaction (RT-PCR).
Virus
HIV-1 stocks were propagated as described [28
], and p24 antigen (Ag) contents were determined by commercial enzyme-linked immunosorbent assay (ELISA; Perkin Elmer Life Sciences, Foster City, CA). Single-cycle, infectious HIV-1 containing a firefly luciferase reporter gene (pNL4-3.LucR.E–) pseudotyped with HIV-1–HXB2 env was generated as described [29
], and ELISA evaluated viral stocks for p24 Ag content.
Cytokines, antibodies, and reagent
IL-4, IL-13, and IFN- were purchased from R&D Systems (Minneapolis, MN) and were used at 10 ng/ml. Fluorescein isothiocyanate (FITC)-conjugated monoclonal antibody (mAb) to DC-SIGN [CD209, clone DCN46, immunoglobulin G (IgG)2a] and isotype-matched control antibody (clone 27-35, IgG2b) were from BD/PharMingen (San Jose, CA) and were used at 20 µg/ml throughout the study in all staining experiments. Purified, unconjugated CD209 antibody (clone 120507, shown to block transmission of HIV-1 to T cells [9
, 26
, 30
, 31
]) and isotype-control antibody (IgG2a; R&D Systems) were used in the transmission experiments at 20 µg/ml. Mannan (Sigma Chemical Co.) was at 40 µg/ml.
Immunofluorescence analyses and quantitative flourescein-activated cell sorter (QFACS)
Fluorescein-activated cell sorter (FACS) analysis was performed on a FACSCalibur machine (Becton Dickinson, San Jose, CA) using the Cell QuestTM software (Becton Dickinson) for data analysis. Untreated and cytokine-treated monocytes were processed for DC-SIGN surface expression by immunofluorescence using FITC-conjugated CD209 and FITC isotype-matched control antibody as described [27
]. Measurements of antibody-binding sites (ABS) were determined by the use of the Quantum Simply Cellular microbead kit (Sigma Chemical Co.), according to the manufacturer’s instruction. To quantify the number of ABS on the cells analyzed, the binding capacity of the microbeads was determined as described [32
].
DC-SIGN RT-PCR
Elutriated monocyte preparations after one-step adherence to plastic (>95% CD14+/CD11c+) were incubated with medium, IL-4, IL-13, or IFN- and were cultured for 5–7 days. Cells were then harvested and RNA isolated using TRI-Reagent from Molecular Research Center (Cincinnati, OH). RNA (1 µg) was reverse-transcribed using the RETROscript kit (Ambion, Austin, TX). One-tenth of the resultant cDNA products was used for the multiplex PCR reactions (QuantumRNATM18S and B-actin internal control standards, Ambion). A multiplex PCR reaction was set up according to the manufacturer’s instructions with the following modifications: 18S RNA primer pair (5 µM; 18S competimer/18S primer in the ratio of 7/3) was added as an internal control to normalize the DC-SIGN mRNA expression level, along with 1 µl 32P-dCTP. Forward and reverse primers for DC-SIGN were GCCACCCCTGTCCCTGGGAATG (DCSIGNFr3) and TAAAGGTCGAAGGATGGAGAGAAG (3UTRRv), respectively. The PCR reaction was run for 26 cycles with a magnesium concentration of 1.5 mM, and PCR products were separated on a 6% polyacrylamide gel. The dried gel was exposed using a Phospho-Imager (Molecular Dynamics, Sunnyvale, CA). Images were captured with the Storage Phospho Screen (Molecular Dynamics), and the ImageQuant software (Molecular Dynamics) was used to calculate the 32P counts of the DC-SIGN and 18S RNA signals. The 18S RNA counts of all samples were divided by that of the untreated, day 0 samples to obtain a value representative of the relative sample loading between time points (i.e., lanes). Normalized DC-SIGN counts were then obtained by dividing DC-SIGN counts in each lane by the value representative of the relative sample loading.
Western blot for DC-SIGN
Cleared cell lysates from freshly isolated monocytes or MDM were prepared as described [27
]. DC-SIGN was detected with 1 µg/ml DC-SIGN antibody 28 (DC-28, IgG2a, provided by Fred Baribaud and Richard Doms, University of Pennsylvania).
Viral transmission assays
Seven-day cytokine-treated or untreated MDM (30,000/well) were incubated with the pseudotyped X4-HIV-1-Luc (7–10 ng p24 Ag content). After 2–3 h, cells were extensively washed to remove unbound virus and were cocultured with 120,000/well SUP-T1 target cells for 72 h. Cells were lysed with 50 µl lysing buffer (Promega, Madison, WI), and incubated with 50 µl substrate (Promega) before analysis in the luminometer for luciferase activity. In indicated experiments, cells were preincubated for 30 min with 20 µg/ml CD209 (clone 120507, IgG2b) or an isotype-matched control (IgG2b) or 40 µg/ml mannan, before addition of pseudotype X4-HIV-1. After 2–3 h, cells were washed extensively to remove unbound virus, treated again with antibodies or mannan, and cocultured with 120,000/well SUP-T1 target cells for 72 h. Luciferase activity was determined as above. A cocktail of anti-DC-SIGN mAb (clones 6, 11, 28, and 72, kindly provided by Fred Baribaud and Robert Doms, University of Pennsylvania) was also used to block viral transmission.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
also significantly increased the percent of MDM expressing DC-SIGN but to a lesser extent than IL-4 or IL-13. The effect of IFN- was variable among the 12 subjects (eight out of 12 up-regulated DC-SIGN, and the remainder did not). Additional measurements of the numbers of DC-SIGN molecules by QFACS showed a median of 37,000 (21,000–90,000) ABS in untreated MDM (n=3), and IL-13 and IL-4 increased this amount to >213,000 ABS/MDM (upper limit of linear range for quantitation). As expected, IFN- treatment resulted in variable levels of induction in the three donors tested (range, 70,000–>213,000).
|
. Treatment with IL-4 and IL-13 resulted in an increase of total cellular expression of DC-SIGN, whereas response to IFN- in seven donors tested showed an increase in expression in six of seven donors tested (86%). Shown in Figure 1
is the range of response observed, and data comparing protein to message levels suggest the variability in Western observed in one donor may be a result of assay sensitivity and not of post-translational regulation, as message was induced in all donors as discussed below. Taken together, these experiments show that IL-4 and IL-13 treatments are associated with a stronger increase of DC-SIGN membrane and total expression, whereas IFN- up-regulation varied between donors.
|
was associated with increased transcription, DC-SIGN mRNA levels were measured in MDM following cytokine treatment (the specificity of mRNA detection was controlled using DC-SIGN-transfected T-REX cells). Seven-day primary MDM showed induction of DC-SIGN mRNA by day 3 of culture in the presence of IL-4, IL-13, or IFN- as compared with untreated MDM or with day 0 monocytes (Fig. 2
). In contrast to variable surface or total protein levels observed in MDM following IFN- stimulation, up-regulation of DC-SIGN message was consistently observed in all donors tested (n=7). The multiple hybridization bands detected the DC-SIGN primers are consistent with the multiple spliced forms of DC-SIGN described by Mummidi et al. [33
]. Taken together, our data support up-regulation of DC-SIGN transcription in MDM by IL-4, IL-13, or IFN- .
|
|
clearly inhibited total viral transmission by 62–67%, and no detectable component of the resulting viral transmission was mediated by DC-SIGN (Fig. 4)
. Mannan-independent transmission was found to be unaffected by any of the cytokines tested. The observed decrease of transmission was not related to a direct effect of the cytokines tested on viral replication in the reporter cells (SUP-T1), as demonstrated in control experiments (not shown). Taken together, results show a maintained-to-increased MDM transmission to CD4 T cells by type 2 cytokines and a decrease by type 1 cytokines.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) and type 2 (IL-4 and IL-13) cytokines. Although we document the up-regulation of DC-SIGN by type 1 and type 2 cytokines, no association was observed between DC-SIGN expression levels and the magnitude of X4 HIV-1 transmission from macrophages to CD4+ T cells. We and other groups have previously demonstrated that human MDM express detectable levels of cell-surface DC-SIGN in the absence of IL-13 treatment [27 ]. Consistent with these observations and with the existence of a relationship between type 2 responses and up-regulation of DC-SIGN, we now show a similar activity for IL-4, and up-regulation is evident at mRNA accumulation, total cell protein levels in addition to cell-surface expression. The unexpected lack of association between a fourfold increase in DC-SIGN expression and X4 HIV transmission argues for a partial role of DC-SIGN in transmission or the presence of additional changes by IL-4 or IL-13 that may counterbalance the increase in DC-SIGN observed. It is interesting that our data differ from recent reports showing no reduction in X4 HIV-1 transmission after anti-DC-SIGN treatment of IL-4/GM-CSF-treated MDDC [26 ], as we did document DC-SIGN-specific transmission by macrophages treated with IL-4 or IL-13. Although the concept that type 2 cytokines make a monocyte or macrophage into transitional DC cannot be excluded, our data do support the hypothesis that type 2 regulation of macrophages in regards to up-regulation of DC-SIGN is disassociated from its HIV-1 transmission potential.
Several studies have shown that multiple anti-DC-SIGN-reactive antibodies block HIV transmission to T cells mediated by DC-SIGN-transfected cell lines [31 , 34 ]. However, when primary cells, such as MDDC, were used for HIV-1 transmission to T cells, less efficient inhibition of viral transmission was observed as noted, suggesting a lesser role for this molecule [9 , 26 , 30 , 31 ]. Emerging evidence suggests that DC-SIGN is not the only adhesion molecule that can bind and transmit HIV. Using circulating and tissue DCs, Turville et al. [25 ] elegantly demonstrated that at least three different receptors (in addition to DC-SIGN) can play a role in gp120 binding. Wu et al. [30 ] also reported a DC-SIGN-independent transmission of primate lentiviruses from rhesus macaque DC. Furthermore, Baribaud et al. [9 ] suggested a DC-SIGN-independent HIV-1 transmission pathway in MDDC in addition to DC-SIGN. In the present study, we show that DC-SIGN, although playing a role in transmission in the absence of cytokine treatment, is not the only active mechanism, as in our experiment, up to 61% of transmission is DC-SIGN-independent. In agreement with the results by Nguyen and Hildreth [35 ], a role for additional C-type lectin receptors in MDM, such as the mannose receptor, is indicated by the greater inhibition achieved in the presence of mannan. The absolute percentage of mannan-dependent transmission is interpreted to be 39–48% DC-SIGN-mediated, suggesting that this interaction approximates 50% of the C-type lectin-mediated transmission. The identity of the receptors involved in mannan-independent transmission remains undefined but is likely to include interactions with nonviral molecules incorporated into virions or those previously identified as important in virus-cell interactions, such as lymphocyte function-associated antigen-1 for example [36 37 38 ]. Additional investigation of this component of MDM-mediated viral transmission remains to be addressed. We show that IL-4 or IL-13 treatment, although enhancing DC-SIGN expression does not result in increased viral transmission. Candidate mechanisms that may contribute to this phenomenon are an increase in mannose-dependent uptake by MDM (i.e., decreasing the viral particles that may interact with CD4 T cells) or a down-regulation of CD4 and CXCR4 by IL-4 or IL-13 [39 , 40 ]. Indeed, the role of additional molecules that may complement DC-SIGN in mediating transmission cannot be excluded from prior reports [25 ]. Conversely, we also cannot rule out that regulation by IL-4 may impact transmission, as a moderate increase was observed in spite of its poor association with the magnitude of increase in DC-SIGN cell-surface expression, raising the possibility that the effects of IL-4 may be largely independent from DC-SIGN regulation. Supporting the interpretation that the amount of X4 HIV transmission between MDM and CD4+ T cells in the presence of IL-13 and IL-4 may be independent of increased mannose-mediated viral binding to MDM, no increase in the mannan-dependent percentage of transmission was observed in our system. IL-4 and IL-13 have been reported to increase mannose receptor expression [41 ]. An alternative explanation for these observations is that the role of DC-SIGN in transmission between MDM and T cells has reached a maximal level, and further increases in expression have a limited effect. In regard to this point, it is of interest that the p24 concentration of virus required to establish transmission between MDM and CD4 T cells in our system was four times greater than that reported in MDDC, suggesting a lower efficiency of transmission.
Consistent with the interpretation that regulation of DC-SIGN is not a correlate of transmission potential in MDM as it is on MDDC, IFN- activation of MDM showed a marked inhibition of mannose-dependent transmission despite a lack of down-regulation for DC-SIGN expression. A decrease in mannose-dependent transmission can be explained in part by the reported inhibition of mannose receptor by IFN- [42
, 43
]. The lack of a contribution by DC-SIGN when measuring the DC-SIGN-specific component of transmission allows us to conclude that contrary to what was observed with IL-4 and IL-13, DC-SIGN plays no role in transmission from IFN--treated MDM. The decrease of X4 HIV-1 transmission also suggests that IFN- allows for viral clearance from the MDM cell membrane. The latter is also shown to be independent of DC-SIGN, as no increase in transmission was observed following inhibition of this molecule. In contrast to the anticipated shared regulation of IL-4 or IL-13 of DC-SIGN between MDDC and MDM, the lack of a down-regulation effect by IFN- on MDM DC-SIGN expression described in MDDC [44
] supports a differential regulation by this molecule between cell subsets. Although we interpret transmission as a factor of correlations between DC-SIGN expression and viral replication in Sup-T1 cells, it is important to stress that our data do not address direct measurements of viral particle binding or uptake through DC-SIGN in untreated or treated MDM.
As prior data have already established that the cytokines tested all have an inhibitory effect on R5 HIV infection and replication in MDM [39 , 45 , 46 ], our data do raise a difference between these cytokines and their potential for X4 HIV transmission, even if not associated with DC-SIGN regulation. Specifically, our results support that type 1 responses decrease the transfer of X4 HIV-1 between MDM and bystander CD4 T cells in contrast to no effect or an increase present during type 2 responses.
|
ACKNOWLEDGEMENTS |
|---|
Received May 20, 2003; revised July 28, 2003; accepted August 5, 2003.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  K.-F. Kong, K. Delroux, X. Wang, F. Qian, A. Arjona, S. E. Malawista, E. Fikrig, and R. R. Montgomery Dysregulation of TLR3 Impairs the Innate Immune Response to West Nile Virus in the Elderly J. Virol., August 1, 2008; 82(15): 7613 - 7623. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Serrano-Gomez, R. T. Martinez-Nunez, E. Sierra-Filardi, N. Izquierdo, M. Colmenares, J. Pla, L. Rivas, J. Martinez-Picado, J. Jimenez-Barbero, J. L. Alonso-Lebrero, et al. AM3 Modulates Dendritic Cell Pathogen Recognition Capabilities by Targeting DC-SIGN Antimicrob. Agents Chemother., July 1, 2007; 51(7): 2313 - 2323. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Saidi, G. Magri, C. Carbonneil, N. Nasreddine, M. Requena, and L. Belec IFN-{gamma}-activated monocytes weakly produce HIV-1 but induce the recruitment of HIV-sensitive T cells and enhance the viral production by these recruited T cells J. Leukoc. Biol., March 1, 2007; 81(3): 642 - 653. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Wahl, T. Greenwell-Wild, and N. Vazquez HIV accomplices and adversaries in macrophage infection J. Leukoc. Biol., November 1, 2006; 80(5): 973 - 983. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Rappocciolo, F. J. Jenkins, H. R. Hensler, P. Piazza, M. Jais, L. Borowski, S. C. Watkins, and C. R. Rinaldo Jr DC-SIGN Is a Receptor for Human Herpesvirus 8 on Dendritic Cells and Macrophages J. Immunol., February 1, 2006; 176(3): 1741 - 1749. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Papasavvas, J. Sun, Q. Luo, E. C. Moore, B. Thiel, R. R. MacGregor, A. Minty, K. Mounzer, J. R. Kostman, and L. J. Montaner IL-13 Acutely Augments HIV-Specific and Recall Responses from HIV-1-Infected Subjects In Vitro by Modulating Monocytes J. Immunol., October 15, 2005; 175(8): 5532 - 5540. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Granelli-Piperno, A. Pritsker, M. Pack, I. Shimeliovich, J.-F. Arrighi, C. G. Park, C. Trumpfheller, V. Piguet, T. M. Moran, and R. M. Steinman Dendritic Cell-Specific Intercellular Adhesion Molecule 3-Grabbing Nonintegrin/CD209 Is Abundant on Macrophages in the Normal Human Lymph Node and Is Not Required for Dendritic Cell Stimulation of the Mixed Leukocyte Reaction J. Immunol., October 1, 2005; 175(7): 4265 - 4273. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Dominguez-Soto, A. Puig-Kroger, M. A. Vega, and A. L. Corbi PU.1 Regulates the Tissue-specific Expression of Dendritic Cell-specific Intercellular Adhesion Molecule (ICAM)-3-grabbing Nonintegrin J. Biol. Chem., September 30, 2005; 280(39): 33123 - 33131. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Marzi, T. Gramberg, G. Simmons, P. Moller, A. J. Rennekamp, M. Krumbiegel, M. Geier, J. Eisemann, N. Turza, B. Saunier, et al. DC-SIGN and DC-SIGNR Interact with the Glycoprotein of Marburg Virus and the S Protein of Severe Acute Respiratory Syndrome Coronavirus J. Virol., November 1, 2004; 78(21): 12090 - 12095. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Serrano-Gomez, A. Dominguez-Soto, J. Ancochea, J. A. Jimenez-Heffernan, J. A. Leal, and A. L. Corbi Dendritic Cell-Specific Intercellular Adhesion Molecule 3-Grabbing Nonintegrin Mediates Binding and Internalization of Aspergillus fumigatus Conidia by Dendritic Cells and Macrophages J. Immunol., November 1, 2004; 173(9): 5635 - 5643. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Hu, I. Frank, V. Williams, J. J. Santos, P. Watts, G. E. Griffin, J. P. Moore, M. Pope, and R. J. Shattock Blockade of Attachment and Fusion Receptors Inhibits HIV-1 Infection of Human Cervical Tissue J. Exp. Med., April 19, 2004; 199(8): 1065 - 1075. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. G. Collman, C.-F. Perno, S. M. Crowe, M. Stevenson, and L. J. Montaner HIV and cells of macrophage/dendritic lineage and other non-T cell reservoirs: new answers yield new questions J. Leukoc. Biol., November 1, 2003; 74(5): 631 - 634. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
