Pepro Tech
Originally published online as doi:10.1189/jlb.0503231 on August 21, 2003

Published online before print August 21, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.0503231v1
74/5/757    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chehimi, J.
Right arrow Articles by Montaner, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chehimi, J.
Right arrow Articles by Montaner, L. J.
(Journal of Leukocyte Biology. 2003;74:757-763.)
© 2003 by Society for Leukocyte Biology

HIV-1 transmission and cytokine-induced expression of DC-SIGN in human monocyte-derived macrophages

Jihed Chehimi, Qi Luo, Livio Azzoni, Linda Shawver, Noel Ngoubilly, Ray June, Ghassen Jerandi, Matthew Farabaugh and Luis J. Montaner1

HIV Immunopathogenesis Laboratory, The Wistar Institute, Philadelphia, Pennsylvania

1 Correspondence: The Wistar Institute, 3601 Spruce Street, Room 480, Philadelphia, PA 19130. E-mail: montaner{at}wistar.upenn.edu


arrow
ABSTRACT
 
Dendritic cell-specific intercellular adhesion molecule-3-grabbing nonintegrin (DC-SIGN) has been described as an attachment molecule for human immunodeficiency virus type 1 (HIV-1) with the potential to mediate its transmission. We examined DC-SIGN expression in monocyte-derived macrophages (MDM) and its role in viral transmission when MDM were exposed to interleukin (IL)-13, IL-4, or interferon-{gamma} (IFN-{gamma}). We show that IL-13 and IL-4 increase transcripts, total protein, and cell-surface expression of DC-SIGN in all MDM tested, IFN-{gamma} results ranged from no change to up-regulation of surface expression, and message and total protein were, respectively, induced in all and 86% of donors tested. Transmission experiments of HIV-1 X4 between cytokine-treated MDM to Sup-T1 cells showed no association between total transmission and DC-SIGN up-regulation. IL-4 but not IL-13 resulted in a less than twofold increase in MDM viral transmission to CD4+ T cells in spite of a fourfold up-regulation in DC-SIGN expression by either cytokine. In contrast, IFN-{gamma} treatment induced a decrease in total transmission by at least two-thirds, despite its induction of DC-SIGN. Soluble mannan resulted in a greater inhibition of viral transmission to CD4+ T cells than neutralizing anti-DC-SIGN monoclonal antibody (67–75% vs. 39–48%), supporting the role of mannose-binding receptors in viral transmission. Taken together, results show that DC-SIGN regulation in MDM does not singly predict the transmission potential of this cell type.

Key Words: IL-4 • IL-13 • IFN-{gamma}


arrow
INTRODUCTION
 
Dendritic cell-specific intercellular adhesion molecule-3-grabbing nonintegrin (DC-SIGN or CD209) is a mannose-binding C-type lectin originally cloned from a placental cDNA library, based on its capability to bind human immunodeficiency virus (HIV) gp120 [1 ]. DC-SIGN mediates binding of R5 and X4 strains of HIV-1, HIV-2, and simian immunodeficiency virus, indicating that it may function as a general viral attachment factor for lentiviruses [2 3 4 5 ]. Although originally described primarily as a DC-specific marker and once thought to be restricted to immature DC, DC-SIGN expression appears now to be much broader than described (e.g., on several tissue macrophages; reviewed in ref. [6 ]). The role of DC-SIGN in relation to infectious diseases is also expanding beyond lentiviral infections, as DC-SIGN has been shown to interact with such pathogens as Ebola virus [7 8 9 10 11 ], cytomegalovirus [12 ], Leishmania [13 ], mycobacteria [14 15 16 17 ], Candida albicans [18 ], hepatitis C virus [19 20 21 ], and Schistosoma mansoni [22 , 23 ].

Based on the observations that DC-SIGN mediates capture and transmission of HIV-1 from DC to CD4 T cells and that DC-SIGN-bound virus retains infectivity for several days [2 ], this molecule has been proposed to contribute to HIV-1 dissemination and transport of viral particles from the mucosal sites of entry (mucosal DC) to the T cell areas of the lymphoid tissue [24 ]. However, the role of DC-SIGN as a predominant attachment factor for HIV-1 in DC has been recently challenged by several observations, indicating that epidermal DCs do not express DC-SIGN and that in addition to DC-SIGN, other C-type lectin receptors play a relevant role in HIV-1 attachment during infection and transmission between dermal DCs and T cells [9 , 25 , 26 ].

Although the monocyte-derived DC (MDDC) system has been proven useful for the study of DC-SIGN in pathogen binding and transmission, the potential contribution of DC-SIGN expression on monocyte-derived macrophages (MDM) to HIV-1 transmission remains undefined. To gain further insights into the regulation of DC-SIGN expression in primary human MDM, we have extended our original observations on interleukin (IL)-13-induced MDM expression of DC-SIGN [27 ] by performing a detailed analysis on the effects of IL-4, IL-13, and interferon-{gamma} (IFN-{gamma}) on DC-SIGN and HIV-1 transmission to T cells. Here, we show that despite a marked up-regulation of DC-SIGN by cytokine regulation, no association is observed between DC-SIGN expression and the amount of HIV-1 transmission from MDM to CD4 T cells.


arrow
MATERIALS AND METHODS
 
MDM
Monocytes were isolated from leukopheresis from HIV seronegative donors by elutriation (provided by the University of Pennsylvania Center for AIDS Research, Immunology Core, Philadelphia). Elutriated monocytes (>85% CD14+) were further depleted of contaminant cells by a 1-h adherence to plastic, followed by extensive washing to remove nonadherent cells. The remaining preparations containing > 95% CD14+ monocytes were resuspended at 2–3 x 106 cells/ml in complete medium containing 15% fetal bovine serum (FBS), glutamine, and antibiotics, dispensed in a 12-well plate, and treated with IL-13 (10 ng/ml), IL-4 (10 ng/ml), or IFN-{gamma} (10 ng/ml) at the time of the culture (day 0). Initial studies that compare IL-13- or IL-4-treated monocytes and IL-4- and granulocyte macrophage-colony stimulating factor (GM-CSF)-derived MDDC show marked differences in adherence (MDDC, less adherent), CD86 expression (higher in IL-4- or IL-13-treated macrophages), and human leukocyte antigen-DR levels (higher in IL-4- or IL-13-treated macrophages) to support that an IL-4- or IL-13-treated monocyte is a related yet not an equal state to immature MDDC.

Cell lines
SUP-T1 cells were cultured in RPMI 1640 supplemented with glutamine, antibiotics, and 10% FBS. T-REX cells, parental or expressing DC-SIGN, were kindly provide by Robert Doms (University of Pennsylvania). T-REX–DC-SIGN+ cells were maintained in RPMI 1640 supplemented with 10% FBS, 100 µg/ml zeocin, and 50 µg/ml blasticidin. DC-SIGN was induced in T-REX–DC-SIGN+ after treatment with doxycyclin (Sigma Chemical Co., St. Louis, MO) for 12 h. Parental T-REX cells were cultured in a similar condition without zeocin. Parental and DC-SIGN-transfected cells were used throughout the study as controls in flow cytometry, Western blotting, and reverse transcriptase-polymerase chain reaction (RT-PCR).

Virus
HIV-1 stocks were propagated as described [28 ], and p24 antigen (Ag) contents were determined by commercial enzyme-linked immunosorbent assay (ELISA; Perkin Elmer Life Sciences, Foster City, CA). Single-cycle, infectious HIV-1 containing a firefly luciferase reporter gene (pNL4-3.LucR.E) pseudotyped with HIV-1–HXB2 env was generated as described [29 ], and ELISA evaluated viral stocks for p24 Ag content.

Cytokines, antibodies, and reagent
IL-4, IL-13, and IFN-{gamma} were purchased from R&D Systems (Minneapolis, MN) and were used at 10 ng/ml. Fluorescein isothiocyanate (FITC)-conjugated monoclonal antibody (mAb) to DC-SIGN [CD209, clone DCN46, immunoglobulin G (IgG)2a] and isotype-matched control antibody (clone 27-35, IgG2b) were from BD/PharMingen (San Jose, CA) and were used at 20 µg/ml throughout the study in all staining experiments. Purified, unconjugated CD209 antibody (clone 120507, shown to block transmission of HIV-1 to T cells [9 , 26 , 30 , 31 ]) and isotype-control antibody (IgG2a; R&D Systems) were used in the transmission experiments at 20 µg/ml. Mannan (Sigma Chemical Co.) was at 40 µg/ml.

Immunofluorescence analyses and quantitative flourescein-activated cell sorter (QFACS)
Fluorescein-activated cell sorter (FACS) analysis was performed on a FACSCalibur machine (Becton Dickinson, San Jose, CA) using the Cell QuestTM software (Becton Dickinson) for data analysis. Untreated and cytokine-treated monocytes were processed for DC-SIGN surface expression by immunofluorescence using FITC-conjugated CD209 and FITC isotype-matched control antibody as described [27 ]. Measurements of antibody-binding sites (ABS) were determined by the use of the Quantum Simply Cellular microbead kit (Sigma Chemical Co.), according to the manufacturer’s instruction. To quantify the number of ABS on the cells analyzed, the binding capacity of the microbeads was determined as described [32 ].

DC-SIGN RT-PCR
Elutriated monocyte preparations after one-step adherence to plastic (>95% CD14+/CD11c+) were incubated with medium, IL-4, IL-13, or IFN-{gamma} and were cultured for 5–7 days. Cells were then harvested and RNA isolated using TRI-Reagent from Molecular Research Center (Cincinnati, OH). RNA (1 µg) was reverse-transcribed using the RETROscript kit (Ambion, Austin, TX). One-tenth of the resultant cDNA products was used for the multiplex PCR reactions (QuantumRNATM18S and B-actin internal control standards, Ambion). A multiplex PCR reaction was set up according to the manufacturer’s instructions with the following modifications: 18S RNA primer pair (5 µM; 18S competimer/18S primer in the ratio of 7/3) was added as an internal control to normalize the DC-SIGN mRNA expression level, along with 1 µl 32P-dCTP. Forward and reverse primers for DC-SIGN were GCCACCCCTGTCCCTGGGAATG (DCSIGNFr3) and TAAAGGTCGAAGGATGGAGAGAAG (3UTRRv), respectively. The PCR reaction was run for 26 cycles with a magnesium concentration of 1.5 mM, and PCR products were separated on a 6% polyacrylamide gel. The dried gel was exposed using a Phospho-Imager (Molecular Dynamics, Sunnyvale, CA). Images were captured with the Storage Phospho Screen (Molecular Dynamics), and the ImageQuant software (Molecular Dynamics) was used to calculate the 32P counts of the DC-SIGN and 18S RNA signals. The 18S RNA counts of all samples were divided by that of the untreated, day 0 samples to obtain a value representative of the relative sample loading between time points (i.e., lanes). Normalized DC-SIGN counts were then obtained by dividing DC-SIGN counts in each lane by the value representative of the relative sample loading.

Western blot for DC-SIGN
Cleared cell lysates from freshly isolated monocytes or MDM were prepared as described [27 ]. DC-SIGN was detected with 1 µg/ml DC-SIGN antibody 28 (DC-28, IgG2a, provided by Fred Baribaud and Richard Doms, University of Pennsylvania).

Viral transmission assays
Seven-day cytokine-treated or untreated MDM (30,000/well) were incubated with the pseudotyped X4-HIV-1-Luc (7–10 ng p24 Ag content). After 2–3 h, cells were extensively washed to remove unbound virus and were cocultured with 120,000/well SUP-T1 target cells for 72 h. Cells were lysed with 50 µl lysing buffer (Promega, Madison, WI), and incubated with 50 µl substrate (Promega) before analysis in the luminometer for luciferase activity. In indicated experiments, cells were preincubated for 30 min with 20 µg/ml CD209 (clone 120507, IgG2b) or an isotype-matched control (IgG2b) or 40 µg/ml mannan, before addition of pseudotype X4-HIV-1. After 2–3 h, cells were washed extensively to remove unbound virus, treated again with antibodies or mannan, and cocultured with 120,000/well SUP-T1 target cells for 72 h. Luciferase activity was determined as above. A cocktail of anti-DC-SIGN mAb (clones 6, 11, 28, and 72, kindly provided by Fred Baribaud and Robert Doms, University of Pennsylvania) was also used to block viral transmission.


arrow
RESULTS
 
Regulation of cell surface and total DC-SIGN in MDM
In contrast to freshly isolated CD14+ monocytes, which do not express detectable DC-SIGN (not shown and ref. [27 ]), moderate levels of DC-SIGN surface expression could be detected on a fraction of MDM generated in 7-day cultures [7% (4.5; 11.5), mean fluorescence intensity (MFI) 31.7 (18; 55.9), median (25th; 75th quartile) n=12]. Consistent with prior data on IL-13 exposure of MDM [26 ], treatment with IL-4 or IL-13 resulted in a significant increase (P<0.001 for either cytokine when compared with untreated) of DC-SIGN surface expression on MDM on all donors tested (Table 1 , n=12). Surprisingly, IFN-{gamma} also significantly increased the percent of MDM expressing DC-SIGN but to a lesser extent than IL-4 or IL-13. The effect of IFN-{gamma} was variable among the 12 subjects (eight out of 12 up-regulated DC-SIGN, and the remainder did not). Additional measurements of the numbers of DC-SIGN molecules by QFACS showed a median of 37,000 (21,000–90,000) ABS in untreated MDM (n=3), and IL-13 and IL-4 increased this amount to >213,000 ABS/MDM (upper limit of linear range for quantitation). As expected, IFN-{gamma} treatment resulted in variable levels of induction in the three donors tested (range, 70,000–>213,000).


View this table:
[in this window]
[in a new window]
 
Table 1. Surface Expression of DC-SIGN in MDM

To determine whether the cytokine-mediated induction of DC-SIGN cell-surface expression was associated with changes in total DC-SIGN protein, MDM lysates were analyzed by Western blot analysis following IL-4, IL-13, or IFN-{gamma}. Treatment with IL-4 and IL-13 resulted in an increase of total cellular expression of DC-SIGN, whereas response to IFN-{gamma} in seven donors tested showed an increase in expression in six of seven donors tested (86%). Shown in Figure 1 is the range of response observed, and data comparing protein to message levels suggest the variability in Western observed in one donor may be a result of assay sensitivity and not of post-translational regulation, as message was induced in all donors as discussed below. Taken together, these experiments show that IL-4 and IL-13 treatments are associated with a stronger increase of DC-SIGN membrane and total expression, whereas IFN-{gamma} up-regulation varied between donors.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 1. Regulation of DC-SIGN total protein levels by IL-4, IL-13, or IFN-{gamma}. Shown are representative 6- to 7-day MDM lysates following cytokine exposure as described in Materials and Methods. The top upper donors show effects of IL-4 or IL-13, and the lower three donors show effects of IFN-{gamma}. Cultured MDM (days 6–7) were lysed, and protein was separated by SDS-12% PAGE and transferred to nitrocellulose. DC-SIGN protein (45 kDa) was detected using anti-DC-SIGN mAb DC-28. Shown are 2/7 donors (top) and 3/7 donors (bottom) tested for each cytokine.

Regulation of mRNA levels of DC-SIGN in MDM
To determine whether up-regulated DC-SIGN expression induced by IL-4, IL-13, and IFN-{gamma} was associated with increased transcription, DC-SIGN mRNA levels were measured in MDM following cytokine treatment (the specificity of mRNA detection was controlled using DC-SIGN-transfected T-REX cells). Seven-day primary MDM showed induction of DC-SIGN mRNA by day 3 of culture in the presence of IL-4, IL-13, or IFN-{gamma} as compared with untreated MDM or with day 0 monocytes (Fig. 2 ). In contrast to variable surface or total protein levels observed in MDM following IFN-{gamma} stimulation, up-regulation of DC-SIGN message was consistently observed in all donors tested (n=7). The multiple hybridization bands detected the DC-SIGN primers are consistent with the multiple spliced forms of DC-SIGN described by Mummidi et al. [33 ]. Taken together, our data support up-regulation of DC-SIGN transcription in MDM by IL-4, IL-13, or IFN- {gamma}.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 2. Regulation of DC-SIGN mRNA expression by IL-4, IL-13, or IFN-{gamma}. Shown are two donor (upper and lower) RT-PCR DC-SIGN amplifications from MDM cultured for 3 (upper) or 7 (lower) days. The T-REX cells expressing DC-SIGN are used as a positive control (upper right panel).

DC-SIGN and X4 HIV-1 transmission by MDM to CD4 T cells
As surface expression levels of DC-SIGN (DC-SIGN-transfected cell lines) have been shown to strongly impact the efficiency of HIV binding and transmission [9 ], we tested whether DC-SIGN expression in primary MDM was associated with transmission of HIV-1 X4 to the CD4+–CXCR4+ Sup-T1 cells. Although 7-day-old MDM showed an ability to transmit HIV-1 X4, blockage of DC-SIGN (anti-CD209) resulted in a 39–48% reduction of transmission, indicating a role for this molecule in mediating part of the viral transfer to CD4+ T cells. It is interesting that blockage of all mannose receptors with soluble mannan accounted for a greater degree of inhibition of transmission (67–75%), suggesting that DC-SIGN is a component of a larger array of surface receptors responsible for viral transmission via mannosylated viral glycoprotein domains (Fig. 3 ). Twenty-five percent to 33% of transmission was found to be mannan-independent.



View larger version (8K):
[in this window]
[in a new window]
 
Figure 3. DC-SIGN mediated HIV-1 transmission by MDM. Shown is a histogram summary of percent transmission from two similar experiments as measured by luciferase activity on SUP-T1 cells 72 h after coculture with HIV-pulsed (2 h) MDM cultured for 7 days. Conditions listed represent MDM treatments with mannan (40 µg/ml), anti-DC-SIGN antibody (anti-CD209), and control isotype antibody (IgG, 20 µg/ml) for 30 min before HIV-1HXB2 pseudotype pulse for 2 h. Shown are two independent experiments, where 100% transmission represents 1918 cps in Donor 1 and 1140 cps in Donor 2. Standard deviations are shown for each condition.

Surprisingly, IL-4 and IL-13 had moderate or no effect on total transmission of HIV X4 to CD4+ T cells, despite inducing a fourfold increase in DC-SIGN expression on MDM (Fig. 4 ). Total transmission levels were not increased for IL-13 and only moderately increased for IL-4 (190% and 127% of total transmission, respectively, for Donor 1 and Donor 2). DC-SIGN blocking with anti-CD209 mAb showed that IL-4 and IL-13 increased the DC-SIGN-dependent transmission by less than twofold compared with untreated cells (IL-4: 177% and 123%; IL-13: 130% and 160%). In contrast, the presence of IFN-{gamma} clearly inhibited total viral transmission by 62–67%, and no detectable component of the resulting viral transmission was mediated by DC-SIGN (Fig. 4) . Mannan-independent transmission was found to be unaffected by any of the cytokines tested. The observed decrease of transmission was not related to a direct effect of the cytokines tested on viral replication in the reporter cells (SUP-T1), as demonstrated in control experiments (not shown). Taken together, results show a maintained-to-increased MDM transmission to CD4 T cells by type 2 cytokines and a decrease by type 1 cytokines.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. DC-SIGN mediated HIV-1 transmission by MDM exposed to IL-4, IL-13, or IFN-{gamma}. Shown are a series of histograms summarizing percent transmission from two similar experiments as measured by luciferase activity on SUP-T1 cells 72 h after coculture with HIV-pulsed (2 h) MDM treated with IL-4 (top), IL-13 (middle), or IFN-{gamma} (bottom) for 7 days. Percent transmission is graphed as a measure of untreated MDM. Conditions listed represent MDM treatments with cytokines with or without mannan (40 µg/ml) and anti-DC-SIGN antibody (anti-CD209) as described in Figure 3 . Standard deviations are shown for each condition.


arrow
DISCUSSION
 
We present a detailed analysis of DC-SIGN expression and regulation in human MDM upon treatment with type 1 (IFN-{gamma}) and type 2 (IL-4 and IL-13) cytokines. Although we document the up-regulation of DC-SIGN by type 1 and type 2 cytokines, no association was observed between DC-SIGN expression levels and the magnitude of X4 HIV-1 transmission from macrophages to CD4+ T cells.

We and other groups have previously demonstrated that human MDM express detectable levels of cell-surface DC-SIGN in the absence of IL-13 treatment [27 ]. Consistent with these observations and with the existence of a relationship between type 2 responses and up-regulation of DC-SIGN, we now show a similar activity for IL-4, and up-regulation is evident at mRNA accumulation, total cell protein levels in addition to cell-surface expression. The unexpected lack of association between a fourfold increase in DC-SIGN expression and X4 HIV transmission argues for a partial role of DC-SIGN in transmission or the presence of additional changes by IL-4 or IL-13 that may counterbalance the increase in DC-SIGN observed. It is interesting that our data differ from recent reports showing no reduction in X4 HIV-1 transmission after anti-DC-SIGN treatment of IL-4/GM-CSF-treated MDDC [26 ], as we did document DC-SIGN-specific transmission by macrophages treated with IL-4 or IL-13. Although the concept that type 2 cytokines make a monocyte or macrophage into transitional DC cannot be excluded, our data do support the hypothesis that type 2 regulation of macrophages in regards to up-regulation of DC-SIGN is disassociated from its HIV-1 transmission potential.

Several studies have shown that multiple anti-DC-SIGN-reactive antibodies block HIV transmission to T cells mediated by DC-SIGN-transfected cell lines [31 , 34 ]. However, when primary cells, such as MDDC, were used for HIV-1 transmission to T cells, less efficient inhibition of viral transmission was observed as noted, suggesting a lesser role for this molecule [9 , 26 , 30 , 31 ]. Emerging evidence suggests that DC-SIGN is not the only adhesion molecule that can bind and transmit HIV. Using circulating and tissue DCs, Turville et al. [25 ] elegantly demonstrated that at least three different receptors (in addition to DC-SIGN) can play a role in gp120 binding. Wu et al. [30 ] also reported a DC-SIGN-independent transmission of primate lentiviruses from rhesus macaque DC. Furthermore, Baribaud et al. [9 ] suggested a DC-SIGN-independent HIV-1 transmission pathway in MDDC in addition to DC-SIGN. In the present study, we show that DC-SIGN, although playing a role in transmission in the absence of cytokine treatment, is not the only active mechanism, as in our experiment, up to 61% of transmission is DC-SIGN-independent. In agreement with the results by Nguyen and Hildreth [35 ], a role for additional C-type lectin receptors in MDM, such as the mannose receptor, is indicated by the greater inhibition achieved in the presence of mannan. The absolute percentage of mannan-dependent transmission is interpreted to be 39–48% DC-SIGN-mediated, suggesting that this interaction approximates 50% of the C-type lectin-mediated transmission. The identity of the receptors involved in mannan-independent transmission remains undefined but is likely to include interactions with nonviral molecules incorporated into virions or those previously identified as important in virus-cell interactions, such as lymphocyte function-associated antigen-1 for example [36 37 38 ]. Additional investigation of this component of MDM-mediated viral transmission remains to be addressed. We show that IL-4 or IL-13 treatment, although enhancing DC-SIGN expression does not result in increased viral transmission. Candidate mechanisms that may contribute to this phenomenon are an increase in mannose-dependent uptake by MDM (i.e., decreasing the viral particles that may interact with CD4 T cells) or a down-regulation of CD4 and CXCR4 by IL-4 or IL-13 [39 , 40 ]. Indeed, the role of additional molecules that may complement DC-SIGN in mediating transmission cannot be excluded from prior reports [25 ]. Conversely, we also cannot rule out that regulation by IL-4 may impact transmission, as a moderate increase was observed in spite of its poor association with the magnitude of increase in DC-SIGN cell-surface expression, raising the possibility that the effects of IL-4 may be largely independent from DC-SIGN regulation. Supporting the interpretation that the amount of X4 HIV transmission between MDM and CD4+ T cells in the presence of IL-13 and IL-4 may be independent of increased mannose-mediated viral binding to MDM, no increase in the mannan-dependent percentage of transmission was observed in our system. IL-4 and IL-13 have been reported to increase mannose receptor expression [41 ]. An alternative explanation for these observations is that the role of DC-SIGN in transmission between MDM and T cells has reached a maximal level, and further increases in expression have a limited effect. In regard to this point, it is of interest that the p24 concentration of virus required to establish transmission between MDM and CD4 T cells in our system was four times greater than that reported in MDDC, suggesting a lower efficiency of transmission.

Consistent with the interpretation that regulation of DC-SIGN is not a correlate of transmission potential in MDM as it is on MDDC, IFN-{gamma} activation of MDM showed a marked inhibition of mannose-dependent transmission despite a lack of down-regulation for DC-SIGN expression. A decrease in mannose-dependent transmission can be explained in part by the reported inhibition of mannose receptor by IFN-{gamma} [42 , 43 ]. The lack of a contribution by DC-SIGN when measuring the DC-SIGN-specific component of transmission allows us to conclude that contrary to what was observed with IL-4 and IL-13, DC-SIGN plays no role in transmission from IFN-{gamma}-treated MDM. The decrease of X4 HIV-1 transmission also suggests that IFN-{gamma} allows for viral clearance from the MDM cell membrane. The latter is also shown to be independent of DC-SIGN, as no increase in transmission was observed following inhibition of this molecule. In contrast to the anticipated shared regulation of IL-4 or IL-13 of DC-SIGN between MDDC and MDM, the lack of a down-regulation effect by IFN-{gamma} on MDM DC-SIGN expression described in MDDC [44 ] supports a differential regulation by this molecule between cell subsets. Although we interpret transmission as a factor of correlations between DC-SIGN expression and viral replication in Sup-T1 cells, it is important to stress that our data do not address direct measurements of viral particle binding or uptake through DC-SIGN in untreated or treated MDM.

As prior data have already established that the cytokines tested all have an inhibitory effect on R5 HIV infection and replication in MDM [39 , 45 , 46 ], our data do raise a difference between these cytokines and their potential for X4 HIV transmission, even if not associated with DC-SIGN regulation. Specifically, our results support that type 1 responses decrease the transfer of X4 HIV-1 between MDM and bystander CD4 T cells in contrast to no effect or an increase present during type 2 responses.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by grants to L. J. M. by NIH AI47760 and AI51225, the Philadelphia Foundation (Robert I. Jacobs Fund), The Stengel-Miller family, AIDS funds from the Commonwealth of Pennsylvania, and the Commonwealth Universal Research Enhancement Program (PA) Department of Health. We are grateful to the blood donor population from The Wistar Institute Blood Donor Program (Philadelphia FIGHT, PA) and the University of Pennsylvania CFAR Immunology/Virology Cores and Dr. Drew Weissman (Division of Infectious Diseases, University of Pennsylvania) for their assistance in providing apheresis and elutriated monocyte preparations.

Received May 20, 2003; revised July 28, 2003; accepted August 5, 2003.


arrow
REFERENCES
 
    1
  1. Curtis, B. M., Scharnowske, S., Watson, A. J. (1992) Sequence and expression of a membrane-associated C-type lectin that exhibits CD4-independent binding of human immunodeficiency virus envelope glycoprotein gp120 Proc. Natl. Acad. Sci. USA 89,8356-8360[Abstract/Free Full Text]
  2. 2
  3. Geijtenbeek, T. B., Kwon, D. S., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C., Middel, J., Cornelissen, I. L., Nottet, H. S., KewalRamani, V. N., Littman, D. R., Figdor, C. G., van Kooyk, Y. (2000) DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells Cell 100,587-597[CrossRef][Medline]
  4. 3
  5. Steinman, R. M. (2000) DC-SIGN: a guide to some mysteries of dendritic cells Cell 100,491-494[CrossRef][Medline]
  6. 4
  7. Baribaud, F., Pohlmann, S., Doms, R. W. (2001) The role of DC-SIGN and DC-SIGNR in HIV and SIV attachment, infection, and transmission Virology 286,1-6[CrossRef][Medline]
  8. 5
  9. Pohlmann, S., Baribaud, F., Lee, B., Leslie, G. J., Sanchez, M. D., Hiebenthal-Millow, K., Munch, J., Kirchhoff, F., Doms, R. W. (2001) DC-SIGN interactions with human immunodeficiency virus type 1 and 2 and simian immunodeficiency virus J. Virol. 75,4664-4672[Abstract/Free Full Text]
  10. 6
  11. Soilleux, E. J. (2003) DC-SIGN (dendritic cell-specific ICAM-grabbing non-integrin) and DC-SIGN-related (DC-SIGNR): friend or foe? Clin. Sci. (Lond.) 104,437-446[Medline]
  12. 7
  13. Alvarez, C. P., Lasala, F., Carrillo, J., Muniz, O., Corbi, A. L., Delgado, R. (2002) C-type lectins DC-SIGN and L-SIGN mediate cellular entry by Ebola virus in cis and in trans J. Virol. 76,6841-6844[Abstract/Free Full Text]
  14. 8
  15. Baribaud, F., Doms, R. W., Pohlmann, S. (2002) The role of DC-SIGN and DC-SIGNR in HIV and Ebola virus infection: can potential therapeutics block virus transmission and dissemination? Expert Opin. Ther. Targets 6,423-431[CrossRef][Medline]
  16. 9
  17. Baribaud, F., Pohlmann, S., Leslie, G., Mortari, F., Doms, R. W. (2002) Quantitative expression and virus transmission analysis of DC-SIGN on monocyte-derived dendritic cells J. Virol. 76,9135-9142[Abstract/Free Full Text]
  18. 10
  19. Lin, G., Simmons, G., Pohlmann, S., Baribaud, F., Ni, H., Leslie, G. J., Haggarty, B. S., Bates, P., Weissman, D., Hoxie, J. A., et al (2003) Differential N-linked glycosylation of human immunodeficiency virus and Ebola virus envelope glycoproteins modulates interactions with DC-SIGN and DC-SIGNR J. Virol. 77,1337-1346
  20. 11
  21. Simmons, G., Reeves, J. D., Grogan, C. C., Vandenberghe, L. H., Baribaud, F., Whitbeck, J. C., Burke, E., Buchmeier, M. J., Soilleux, E. J., Riley, J. L., et al (2003) DC-SIGN and DC-SIGNR bind ebola glycoproteins and enhance infection of macrophages and endothelial cells Virology 305,115-123[CrossRef][Medline]
  22. 12
  23. Halary, F., Amara, A., Lortat-Jacob, H., Messerle, M., Delaunay, T., Houles, C., Fieschi, F., Arenzana-Seisdedos, F., Moreau, J. F., Dechanet-Merville, J. (2002) Human cytomegalovirus binding to DC-SIGN is required for dendritic cell infection and target cell trans-infection Immunity 17,653-664[CrossRef][Medline]
  24. 13
  25. Colmenares, M., Puig-Kroger, A., Pello, O. M., Corbi, A. L., Rivas, L. (2002) Dendritic cell (DC)-specific intercellular adhesion molecule 3 (ICAM-3)-grabbing nonintegrin (DC-SIGN, CD209), a C-type surface lectin in human DCs, is a receptor for Leishmania amastigotes J. Biol. Chem. 277,36766-36769[Abstract/Free Full Text]
  26. 14
  27. Geijtenbeek, T. B., Van Vliet, S. J., Koppel, E. A., Sanchez-Hernandez, M., Vandenbroucke-Grauls, C. M., Appelmelk, B., Van Kooyk, Y. (2003) Mycobacteria target DC-SIGN to suppress dendritic cell function J. Exp. Med. 197,7-17[Abstract/Free Full Text]
  28. 15
  29. Tailleux, L., Schwartz, O., Herrmann, J. L., Pivert, E., Jackson, M., Amara, A., Legres, L., Dreher, D., Nicod, L. P., Gluckman, J. C., et al (2003) DC-SIGN is the major Mycobacterium tuberculosis receptor on human dendritic cells J. Exp. Med. 197,121-127[Abstract/Free Full Text]
  30. 16
  31. Maeda, N., Nigou, J., Herrmann, J. L., Jackson, M., Amara, A., Lagrange, P. H., Puzo, G., Gicquel, B., Neyrolles, O. (2003) The cell surface receptor DC-SIGN discriminates between Mycobacterium species through selective recognition of the mannose caps on lipoarabinomannan J. Biol. Chem. 278,5513-5516[Abstract/Free Full Text]
  32. 17
  33. Kaufmann, S. H., Schaible, U. E. (2003) A dangerous liaison between two major killers: Mycobacterium tuberculosis and HIV target dendritic cells through DC-SIGN J. Exp. Med. 197,1-5[Free Full Text]
  34. 18
  35. Cambi, A., Gijzen, K., de Vries, J. M., Torensma, R., Joosten, B., Adema, G. J., Netea, M. G., Kullberg, B. J., Romani, L., Figdor, C. G. (2003) The C-type lectin DC-SIGN (CD209) is an antigen-uptake receptor for Candida albicans on dendritic cells Eur. J. Immunol. 33,532-538[CrossRef][Medline]
  36. 19
  37. Gardner, J. P., Durso, R. J., Arrigale, R. R., Donovan, G. P., Maddon, P. J., Dragic, T., Olson, W. C. (2003) L-SIGN (CD 209L) is a liver-specific capture receptor for hepatitis C virus Proc. Natl. Acad. Sci. USA 100,4498-4503[Abstract/Free Full Text]
  38. 20
  39. Lozach, P. Y., Lortat-Jacob, H., De Lacroix De Lavalette, A., Staropoli, I., Foung, S., Amara, A., Houles, C., Fieschi, F., Schwartz, O., Virelizier, J. L., Arenzana-Seisdedos, F., Altmeyer, R. (2003) DC-SIGN and L-SIGN are high-affinity binding receptors for hepatitis C virus glycoprotein E2 J. Biol. Chem. 278,20358-20366[Abstract/Free Full Text]
  40. 21
  41. Pohlmann, S., Zhang, J., Baribaud, F., Chen, Z., Leslie, G. J., Lin, G., Granelli-Piperno, A., Doms, R. W., Rice, C. M., McKeating, J. A. (2003) Hepatitis C virus glycoproteins interact with DC-SIGN and DC-SIGNR J. Virol. 77,4070-4080[Abstract/Free Full Text]
  42. 22
  43. Appelmelk, B. J., Van Die, I., Van Vliet, S. J., Vandenbroucke-Grauls, C. M., Geijtenbeek, T. B., Van Kooyk, Y. (2003) Cutting edge: carbohydrate profiling identifies new pathogens that interact with dendritic cell-specific ICAM-3-grabbing nonintegrin on dendritic cells J. Immunol. 170,1635-1639[Abstract/Free Full Text]
  44. 23
  45. Van Die, I., Van Vliet, S. J., Kwame Nyame, A., Cummings, R. D., Bank, C. M., Appelmelk, B., Geijtenbeek, T. B., Van Kooyk, Y. (2003) The dendritic cell specific C-type lectin DC-SIGN is a receptor for Schistosoma mansoni egg antigens and recognizes the glycan antigen Lewis-x Glycobiology 13,471-478[Abstract/Free Full Text]
  46. 24
  47. Frank, I., Pope, M. (2002) The enigma of dendritic cell-immunodeficiency virus interplay Curr. Mol. Med. 2,229-248[CrossRef][Medline]
  48. 25
  49. Turville, S. G., Cameron, P. U., Handley, A., Lin, G., Pohlmann, S., Doms, R. W., Cunningham, A. L. (2002) Diversity of receptors binding HIV on dendritic cell subsets Nat. Immunol. 3,975-983[CrossRef][Medline]
  50. 26
  51. Gummuluru, S., KewalRamani, V. N., Emerman, M. (2002) Dendritic cell-mediated viral transfer to T cells is required for human immunodeficiency virus type 1 persistence in the face of rapid cell turnover J. Virol. 76,10692-10701[Abstract/Free Full Text]
  52. 27
  53. Soilleux, E. J., Morris, L. S., Leslie, G., Chehimi, J., Luo, Q., Levroney, E., Trowsdale, J., Montaner, L. J., Doms, R. W., Weissman, D., et al (2002) Constitutive and induced expression of DC-SIGN on dendritic cell and macrophage subpopulations in situ and in vitro J. Leukoc. Biol. 71,445-457[Abstract/Free Full Text]
  54. 28
  55. Moonis, M., Lee, B., Bailer, R. T., Luo, Q., Montaner, L. J. (2001) CCR5 and CXCR4 expression correlated with X4 and R5 HIV-1 infection yet not sustained replication in Th1 and Th2 cells AIDS 15,1941-1949[CrossRef][Medline]
  56. 29
  57. Connor, R. I., Chen, B. K., Choe, S., Landau, N. R. (1995) Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes Virology 206,935-944[CrossRef][Medline]
  58. 30
  59. Wu, L., Bashirova, A.A., Martin, T.D., Villamide, L., Mehlhop, E., Chertov, A.O., Unutmaz, D., Pope, M., Carrington, M., KewalRamani, V. N. (2002) Rhesus macaque dendritic cells efficiently transmit primate lentiviruses independently of DC-SIGN Proc. Natl. Acad. Sci. USA 99,1568-1573[Abstract/Free Full Text]
  60. 31
  61. Wu, L., Martin, T. D., Vazeux, R., Unutmaz, D., KewalRamani, V. N. (2002) Functional evaluation of DC-SIGN monoclonal antibodies reveals DC-SIGN interactions with ICAM-3 do not promote human immunodeficiency virus type 1 transmission J. Virol. 76,5905-5914[Abstract/Free Full Text]
  62. 32
  63. Lee, B., Sharron, M., Montaner, L. J., Weissman, D., Doms, R. W. (1999) Quantification of CD4, CCR5, and CXCR4 levels on lymphocyte subsets, dendritic cells, and differentially conditioned monocyte-derived macrophages Proc. Natl. Acad. Sci. USA 96,5215-5220[Abstract/Free Full Text]
  64. 33
  65. Mummidi, S., Catano, G., Lam, L., Hoefle, A., Telles, V., Begum, K., Jimenez, F., Ahuja, S. S., Ahuja, S. K. (2001) Extensive repertoire of membrane-bound and soluble dendritic cell-specific ICAM-3-grabbing nonintegrin 1 (DC-SIGN1) and DC-SIGN2 isoforms. Inter-individual variation in expression of DC-SIGN transcripts J. Biol. Chem. 276,33196-33212[Abstract/Free Full Text]
  66. 34
  67. Baribaud, F., Pohlmann, S., Sparwasser, T., Kimata, M. T., Choi, Y. K., Haggarty, B. S., Ahmad, N., Macfarlan, T., Edwards, T. G., Leslie, G. J., et al (2001) Functional and antigenic characterization of human, rhesus macaque, pigtailed macaque, and murine DC-SIGN J. Virol. 75,10281-10289[Abstract/Free Full Text]
  68. 35
  69. Nguyen, D. G., Hildreth, J. E. (2003) Involvement of macrophage mannose receptor in the binding and transmission of HIV by macrophages Eur. J. Immunol. 33,483-493[CrossRef][Medline]
  70. 36
  71. Arias, R. A., Munoz, L. D., Munoz-Fernandez, M. A. (2003) Transmission of HIV-1 infection between trophoblast placental cells and T-cells takes place via an LFA-1-mediated cell to cell contact Virology 307,266-277[CrossRef][Medline]
  72. 37
  73. Sanders, R. W., de Jong, E. C., Baldwin, C. E., Schuitemaker, J. H., Kapsenberg, M. L., Berkhout, B. (2002) Differential transmission of human immunodeficiency virus type 1 by distinct subsets of effector dendritic cells J. Virol. 76,7812-7821[Abstract/Free Full Text]
  74. 38
  75. Hioe, C. E., Chien, P. C., Jr, Lu, C., Springer, T. A., Wang, X. H., Bandres, J., Tuen, M. (2001) LFA-1 expression on target cells promotes human immunodeficiency virus type 1 infection and transmission J. Virol. 75,1077-1082[Abstract/Free Full Text]
  76. 39
  77. Montaner, L. J., Bailer, R. T., Gordon, S. (1997) IL-13 acts on macrophages to block the completion of reverse transcription, inhibit virus production, and reduce virus infectivity J. Leukoc. Biol. 62,126-132[Abstract]
  78. 40
  79. Bailer, R. T., Lee, B., Montaner, L. J. (2000) IL-13 and TNF-alpha inhibit dual-tropic HIV-1 in primary macrophages by reduction of surface expression of CD4, chemokine receptors CCR5, CXCR4 and post-entry viral gene expression Eur. J. Immunol. 30,1340-1349[CrossRef][Medline]
  80. 41
  81. Raveh, D., Kruskal, B. A., Farland, J., Ezekowitz, R. A. (1998) Th1 and Th2 cytokines cooperate to stimulate mannose-receptor-mediated phagocytosis J. Leukoc. Biol. 64,108-113[Abstract]
  82. 42
  83. Martinez-Pomares, L., Reid, D. M., Brown, G. D., Taylor, P. R., Stillion, R. J., Linehan, S. A., Zamze, S., Gordon, S., Wong, S. Y. (2003) Analysis of mannose receptor regulation by IL-4, IL-10, and proteolytic processing using novel monoclonal antibodies J. Leukoc. Biol. 73,604-613[Abstract/Free Full Text]
  84. 43
  85. Montaner, L. J., da Silva, R. P., Sun, J., Sutterwala, S., Hollinshead, M., Vaux, D., Gordon, S. (1999) Type 1 and type 2 cytokine regulation of macrophage endocytosis: differential activation by IL-4/IL-13 as opposed to IFN-gamma or IL-10 J. Immunol. 162,4606-4613[Abstract/Free Full Text]
  86. 44
  87. Relloso, M., Puig-Kroger, A., Pello, O. M., Rodriguez-Fernandez, J. L., de la Rosa, G., Longo, N., Navarro, J., Munoz-Fernandez, M. A., Sanchez-Mateos, P., Corbi, A. L. (2002) DC-SIGN (CD209) expression is IL-4 dependent and is negatively regulated by IFN, TGF-beta, and anti-inflammatory agents J. Immunol. 168,2634-2643[Abstract/Free Full Text]
  88. 45
  89. Kornbluth, R. S., Matsuzaki, H., Meylan, P. R., Richman, D. D. (1994) Interferon interactions with HIV1 in macrophages Res. Immunol. 145,664-666[CrossRef][Medline]
  90. 46
  91. Kedzierska, K., Crowe, S. M., Turville, S., Cunningham, A. L. (2003) The influence of cytokines, chemokines and their receptors on HIV-1 replication in monocytes and macrophages Rev. Med. Virol. 13,39-56[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Virol.Home page
K.-F. Kong, K. Delroux, X. Wang, F. Qian, A. Arjona, S. E. Malawista, E. Fikrig, and R. R. Montgomery
Dysregulation of TLR3 Impairs the Innate Immune Response to West Nile Virus in the Elderly
J. Virol., August 1, 2008; 82(15): 7613 - 7623.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
D. Serrano-Gomez, R. T. Martinez-Nunez, E. Sierra-Filardi, N. Izquierdo, M. Colmenares, J. Pla, L. Rivas, J. Martinez-Picado, J. Jimenez-Barbero, J. L. Alonso-Lebrero, et al.
AM3 Modulates Dendritic Cell Pathogen Recognition Capabilities by Targeting DC-SIGN
Antimicrob. Agents Chemother., July 1, 2007; 51(7): 2313 - 2323.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
H. Saidi, G. Magri, C. Carbonneil, N. Nasreddine, M. Requena, and L. Belec
IFN-{gamma}-activated monocytes weakly produce HIV-1 but induce the recruitment of HIV-sensitive T cells and enhance the viral production by these recruited T cells
J. Leukoc. Biol., March 1, 2007; 81(3): 642 - 653.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. M. Wahl, T. Greenwell-Wild, and N. Vazquez
HIV accomplices and adversaries in macrophage infection
J. Leukoc. Biol., November 1, 2006; 80(5): 973 - 983.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Rappocciolo, F. J. Jenkins, H. R. Hensler, P. Piazza, M. Jais, L. Borowski, S. C. Watkins, and C. R. Rinaldo Jr
DC-SIGN Is a Receptor for Human Herpesvirus 8 on Dendritic Cells and Macrophages
J. Immunol., February 1, 2006; 176(3): 1741 - 1749.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Papasavvas, J. Sun, Q. Luo, E. C. Moore, B. Thiel, R. R. MacGregor, A. Minty, K. Mounzer, J. R. Kostman, and L. J. Montaner
IL-13 Acutely Augments HIV-Specific and Recall Responses from HIV-1-Infected Subjects In Vitro by Modulating Monocytes
J. Immunol., October 15, 2005; 175(8): 5532 - 5540.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Granelli-Piperno, A. Pritsker, M. Pack, I. Shimeliovich, J.-F. Arrighi, C. G. Park, C. Trumpfheller, V. Piguet, T. M. Moran, and R. M. Steinman
Dendritic Cell-Specific Intercellular Adhesion Molecule 3-Grabbing Nonintegrin/CD209 Is Abundant on Macrophages in the Normal Human Lymph Node and Is Not Required for Dendritic Cell Stimulation of the Mixed Leukocyte Reaction
J. Immunol., October 1, 2005; 175(7): 4265 - 4273.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Dominguez-Soto, A. Puig-Kroger, M. A. Vega, and A. L. Corbi
PU.1 Regulates the Tissue-specific Expression of Dendritic Cell-specific Intercellular Adhesion Molecule (ICAM)-3-grabbing Nonintegrin
J. Biol. Chem., September 30, 2005; 280(39): 33123 - 33131.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Marzi, T. Gramberg, G. Simmons, P. Moller, A. J. Rennekamp, M. Krumbiegel, M. Geier, J. Eisemann, N. Turza, B. Saunier, et al.
DC-SIGN and DC-SIGNR Interact with the Glycoprotein of Marburg Virus and the S Protein of Severe Acute Respiratory Syndrome Coronavirus
J. Virol., November 1, 2004; 78(21): 12090 - 12095.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Serrano-Gomez, A. Dominguez-Soto, J. Ancochea, J. A. Jimenez-Heffernan, J. A. Leal, and A. L. Corbi
Dendritic Cell-Specific Intercellular Adhesion Molecule 3-Grabbing Nonintegrin Mediates Binding and Internalization of Aspergillus fumigatus Conidia by Dendritic Cells and Macrophages
J. Immunol., November 1, 2004; 173(9): 5635 - 5643.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
Q. Hu, I. Frank, V. Williams, J. J. Santos, P. Watts, G. E. Griffin, J. P. Moore, M. Pope, and R. J. Shattock
Blockade of Attachment and Fusion Receptors Inhibits HIV-1 Infection of Human Cervical Tissue
J. Exp. Med., April 19, 2004; 199(8): 1065 - 1075.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
R. G. Collman, C.-F. Perno, S. M. Crowe, M. Stevenson, and L. J. Montaner
HIV and cells of macrophage/dendritic lineage and other non-T cell reservoirs: new answers yield new questions
J. Leukoc. Biol., November 1, 2003; 74(5): 631 - 634.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.0503231v1
74/5/757    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chehimi, J.
Right arrow Articles by Montaner, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chehimi, J.
Right arrow Articles by Montaner, L. J.