science pharmaceutical expo biotech jobs
Originally published online as doi:10.1189/jlb.0402212 on June 16, 2003

Published online before print June 16, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0402212v1
74/3/395    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Veckman, V.
Right arrow Articles by Julkunen, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Veckman, V.
Right arrow Articles by Julkunen, I.
(Journal of Leukocyte Biology. 2003;74:395-402.)
© 2003 by Society for Leukocyte Biology

Lactobacilli and streptococci induce inflammatory chemokine production in human macrophages that stimulates Th1 cell chemotaxis

Ville Veckman*,1, Minja Miettinen*, Sampsa Matikainen*, Roberto Lande{dagger}, Elena Giacomini{dagger}, Eliana M. Coccia{dagger} and Ilkka Julkunen*

* Department of Microbiology, National Public Health Institute, Helsinki, Finland; and
{dagger} Department of Infectious, Parasitic and Immune-Mediated Diseases, Istituto Superiore di Sanità, Rome, Italy

1Correspondence: Department of Microbiology, National Public Health Institute, Mannerheimintie 166, FIN-00300 Helsinki, Finland. E-mail: ville.veckman{at}ktl.fi


arrow
ABSTRACT
 
Macrophages have a central role in innate-immune responses to bacteria. In the present work, we show that infection of human macrophages with Gram-positive pathogenic Streptococcus pyogenes or nonpathogenic Lactobacillus rhamnosus GG enhances mRNA expression of inflammatory chemokine ligands CCL2/monocyte chemoattractant protein-1 (MCP-1), CCL3/macrophage-inflammatory protein-1{alpha} (MIP-1{alpha}), CCL5/regulated on activation, normal T expressed and secreted, CCL7/MCP-3, CCL19/MIP-3ß, and CCL20/MIP-3{alpha} and CXC chemokine ligands CXCL8/interleukin (IL)-8, CXCL9/monokine induced by interferon-{gamma} (IFN-{gamma}), and CXCL10/IFN-inducible protein 10. Bacteria-induced CCL2, CCL7, CXCL9, and CXCL10 mRNA expression was partially dependent on ongoing protein synthesis. The expression of these chemokines and of CCL19 was dependent on bacteria-induced IFN-{alpha}/ß production. CCL19 and CCL20 mRNA expression was up-regulated by IL-1ß or tumor necrosis factor {alpha} (TNF-{alpha}), and in addition, IFN-{alpha} together with TNF-{alpha} further enhanced CCL19 gene expression. Synergy between IFN-{alpha} and TNF-{alpha} was also seen for CXCL9 and CXCL10 mRNA expression. Bacteria-stimulated macrophage supernatants induced the migration of T helper cell type 1 (Th1) cells, suggesting that in human macrophages, these bacteria can stimulate efficient inflammatory chemokine gene expression including those that recruit Th1 cells to the site of inflammation. Furthermore, L. rhamnosus-induced Th1 chemokine production could in part explain the proposed antiallergenic properties of this bacterium.

Key Words: bacteria • chemokine • cycloheximide


arrow
INTRODUCTION
 
Macrophages play an essential role in innate-immune responses and are involved in stimulating the development of adaptive-immune responses during bacterial infections. Macrophages recognize, phagocytose, and destroy bacteria and function as antigen presenting cells [1 ]. Interaction of macrophages with bacteria stimulates intracellular signal-transduction pathways leading to production of cytokines and chemokines. Chemokines are crucial in controlling leukocyte activation and recruitment into the tissues at inflammatory sites (reviewed in refs. [2 3 4 ]). Currently ~50 chemokines and 18 chemokine receptors have been characterized. Chemokines can be divided into four families on the basis of the N-terminal cysteine positioning in their amino acid sequence. They act via G-protein-coupled specific receptors and induce changes in target-cell membrane protein composition and cell structure, thus enhancing chemotaxis and penetration of leukocytes through the vascular endothelium into the tissues. Chemokine receptor expression varies between different leukocyte populations. Therefore, different leukocyte types can be specifically recruited to the site of inflammation in response to local chemokine milieu.

Streptococcus pyogenes or group A streptococcus (GAS) is a Gram-positive human pathogen causing, e.g., pharyngitis, erysipelas, myositis, and skin infections. Invasiveness and virulence of S. pyogenes depend on various cell-surface adhesion molecules [5 ]. Streptococcal M protein has been proposed to be the most important virulence factor [6 ]. S. pyogenes also secretes superantigenic exotoxins and exoenzymes, which further promote the pathogenicity of this bacterium [7 ]. Lactobacilli (LAB) are nonpathogenic, Gram-positive bacteria, which are part of normal human microflora. Lactobacillus rhamnosus GG has been extensively studied regarding its potential beneficial effects on human health, which include proposed antiallergenic effects [8 9 10 11 ].

In this study, we have analyzed bacteria-induced gene expression of certain representative members of inflammatory chemokines, which are involved in recruiting different leukocyte types to the site of inflammation. Chemokine ligands CCL2, CCL3, CCL5, and CCL7 have a role in attracting monocyte/macrophages and lymphocytes. CCL19 and CCL20 are chemoattractants for mature and immature dendritic cells (DCs), respectively. CXC chemokine ligand CXCL8 attracts neutrophils, and CXCL9 and CXCL10 function as T helper cell type 1 (Th1) and natural killer cell chemoattractants [2 3 4 , 12 ]. In this work, we show that stimulation of primary human macrophages with S. pyogenes or L. rhamnosus leads to the expression of CCL2, CCL3, CCL5, CCL7, CCL19, CCL20, CXCL8, CXCL9, and CXCL10 genes. In addition to bacteria directly stimulating the mRNA expression of these chemokine genes, macrophage-produced interleukin (IL)-1ß, tumor necrosis factor {alpha} (TNF-{alpha}), and interferon (IFN)-{alpha} contribute to the expression of CCL2, CCL7, CCL19, CXCL9, and CXCL10 genes. We also demonstrate that S. pyogenes- or L. rhamnosus-stimulated macrophage supernatants enhance the migration of Th1 cells.


arrow
MATERIALS AND METHODS
 
Bacterial strains
S. pyogenes serotype T1M1 (IH32030), isolated from a child with bacteremia, was obtained from the collection of National Public Health Institute (Helsinki, Finland), and L. rhamnosus GG (ATCC 53103) was obtained from Valio R&D (Helsinki, Finland). Bacteria were stored in skimmed milk at -70°C and passaged three times as described previously [13 ] before they were used in stimulation experiments. S. pyogenes was grown in tryptone-yeast (TY) medium supplemented with 0.2% glucose [14 ] and L. rhamnosus in Man, Rogosa, and Sharp (MRS) medium (Difco, Detroit, MI). For stimulation experiments, bacteria were grown to logarithmic growth phase, and the number of bacterial cells was determined by counting in a Petroff-Hauser counting chamber.

Cell culture
Macrophages were cultured as described previously [15 ]. Briefly, freshly collected, leukocyte-rich buffy coats from healthy blood donors were obtained from the Finnish Red Cross Blood Transfusion Service (Helsinki). Human peripheral blood mononuclear cells (PBMC) were isolated by a density gradient centrifugation over Ficoll-Paque gradient (Pharmacia, Uppsala, Sweden). After washing, the cells were resuspended in RPMI-1640 medium (Sigma Chemical Co., St. Louis, MO) supplemented with 0.6 µg/ml penicillin, 60 µg/ml streptomycin, 2 mM L-glutamine, and 20 mM HEPES. For monocyte differentiation, cells were allowed to adhere to plastic six-well plates (Falcon, Becton Dickinson, Franklin Lakes, NJ) for 1 h at 37°C in RPMI (10x106 cells/well). After incubation, nonadherent cells were removed, and the wells were washed twice with phosphate-buffered saline (PBS). Adherent cells were grown for 7 days in macrophage/serum-free medium (Life Technologies, Grand Island, NY) supplemented with antibiotics and recombinant human granulocyte macrophage-colony stimulating factor (10 ng/ml; Leucomax, Schering-Plough, Innishannon, Ireland). Cultured cells showed typical morphology of macrophages and were over 90% CD14-positive, as analyzed by flow cytometry (data not shown).

Stimulation experiments
To minimize interindividual variation, all experiments were performed with cells obtained from four to six blood donors. Stimulation experiments were conducted in RPMI-1640 medium with live bacteria at a 1:1 bacteria:macrophage ratio. Cycloheximide (CHX; Sigma Chemical Co.) was used to inhibit protein synthesis at a concentration of 10 µg/ml, and it was added to cells 30 min after the beginning of stimulation. The used concentration of CHX (10 µg/ml) is sufficient to completely block protein synthesis in human PBMC [16 ]. Neutralizing-sheep anti-IFN-{alpha} [17 ] antibodies were used at concentrations of 2400 and 165 neutralizing units/ml for IFN-{alpha} and IFN-ß, respectively. Antibodies were added 1 h after the beginning of stimulations. For 24-h stimulations, anti-IFN-{alpha}/ß antibodies were added again at 12 h. Cells and cell-culture supernatants were collected at different times after stimulation and were pooled. Cells were used for isolation of total cellular RNA. Supernatants were stored at -20°C and used for chemokine quantification by enzyme-linked immunosorbent assay (ELISA) or for T cell migration assays. To analyze the effect of proinflammatory cytokines on chemokine gene expression, macrophages were stimulated for 2 h with IFN-{alpha} (100 IU/ml; Finnish Red Cross Blood Transfusion Service) and/or IL-1ß (10 ng/ml), IL-6 (20 ng/ml), or TNF-{alpha} (10 ng/ml), all obtained from R&D Biosystems (Abingdon, UK).

RNA isolation and analysis
For isolation of total cellular RNA, stimulated cells were collected, washed once with cold PBS, and lysed in guanidinium isothiocyanate [18 ] followed by centrifugation through a CsCl cushion [19 ]. RNA was quantified photometrically, and samples containing equal amounts (20 µg) of total cellular RNA were size-fractionated on 1% formaldehyde-agarose gels and were transferred to Hybond-N nylon membranes (Amersham-Pharmacia-Biotech, Uppsala, Sweden). To control equal loading, ethidium bromide staining was used. Dr. Alberto Mantovani (Istituto di Ricerche Farmacologiche, Milan, Italy) kindly provided the probes for CCL2, CCL3, CCL5, and CCL7. Dr. Albert Zlotnik [20 ] provided CCL19, CCL20, and CXCL8 probes. The probe for CXCL10 has been described earlier [21 ]. CXCL9 was reverse transcriptase-polymerase chain reaction-cloned from macrophage RNA as described [21 ] using oligonucleotides containing BamHI restriction sites CTCCATGGATCCACTATGAAGAAAAGTGGTGTTCTT (sense) and TGGTGAGGATCCCTCTTATGTAGTCTTCTTTTGACG (antisense). The probes were labeled with [{alpha}-32P]dATP (3000 Ci/mmol; Amersham-Pharmacia-Biotech) using a random-primed DNA labeling kit. Hybridizations were performed in a solution containing 50% formamide, 5x Denhardt’s solution, 5x subacute sclerosing panencephalitis, and 0.5% sodium dodecyl sulfate (SDS) at 42°C. After hybridization, membranes were washed three times with 1x saline sodium citrate/0.1% SDS at 42°C for 30 min and once at 65°C for 30 min. Membranes were exposed to Kodak X-Omat AR films (Eastman Kodak, Rochester, NY) at -70°C with intensifying screens.

Chemokine-specific ELISAs
Chemokine levels in cell-culture supernatants were detected by the ELISA method as described previously [13 ]. CCL3, CCL5, CCL7, and CXCL8 were determined with antibody pairs, and standards were obtained from R&D Biosystems. CCL19 and CCL20 were determined with an R&D Biosystems Duoset ELISA kit. CCL2, CXCL9, and CXCL10 were analyzed with antibody pairs, and standards were obtained from BD PharMingen (San Diego, CA).

Establishment of CD4+ cell line and flow cytometry analysis
CD4+ T cells were purified by negative sorting from PBMC using magnetic microbeads (Miltenyi, Bergisch Gladbech, Germany). The recovered cells were >96% CD4+, as determined by flow cytometry with specific antibody. A Th1-specific cell line was established from PBMC by using whole-cell heat-inactivated Mycobacterium tuberculosis (Mtb) as antigen, according to procedures described previously [22 ]. After 4 days, IL-2 (30 U/ml; Proleukin, Eurocetus-Chiron, Emeryville, CA) was added twice a week to expand the T cell population. To test the specificity of the Th1 cell line, the proliferative response and the IFN-{gamma} production were analyzed after restimulation of the culture with Mtb according to standard protocols [22 ].

The cell-surface expression of the chemokine receptors was analyzed by flow cytometry analysis [fluorescein-activated cell sorter (FACS)]. The antibodies used were CD4-fluorescein isothiocyanate, CCR3-phycoerythrin (PE), CCR5-PE, CCR2-PE, and CXCR3-PE (PharMingen, San Diego, CA). In addition, respective isotype-matched controls were used. For FACS analysis, 2 x 105 cells were aliquoted into tubes and washed once with PBS containing 2% fetal calf serum. The cells were incubated with antibodies at 4°C for 45 min. The cells were then washed and fixed with 2% paraformaldehyde before analysis on FACS Calibur using Cell Quest software (Becton Dickinson, Mountain View, CA). More that 80% and 90% of Th1 cells expressed CCR5 and CXCR3, respectively (see Fig. 6B ).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 6. (A) S. pyogenes (GAS)- or L. rhamnosus (LAB)-stimulated macrophage supernatant-induced Th1 cell chemotaxis. Cell-culture supernatants from control or GAS- or LAB-stimulated (24-h stimulation) macrophages were added to migration chambers, and the number of migrated Th1 cells was counted by FACS. To study the roles of CCR5 and CXCR3 ligands in Th1 chemotaxis, Th1 cells were treated with saturating amounts of CCL3 or CXCL10 (10 µg/ml) before migration assay to block the receptors. Values are shown as percentage of migrated cells compared with total Th1 cell population. Results are means (±SD) of three chemotaxis assays that were both done in duplicates. Cell-culture supernatants from four donors were used. *, Statistical significance was determined by paired two-tailed Student’s t-test; P= 0.033. (B) FACS analysis of Th1 cell-surface chemokine receptor expression. Th1 cells were stained with antibodies against CCR2, CCR4, CCR5, and CXCR3 (solid black) as described in Materials and Methods. Dotted lines represent respective isotype controls.

Chemotaxis assay
Chemotaxis assay was performed using 5 µm pore polycarbonate filters of a 24-well Transwell chamber (Costar, Cambridge, MA). T cells were washed with RPMI containing 0.5% bovine serum albumin (BSA; Sigma Chemical Co.) and were suspended at 2 x 106/ml. The supernatants from control or bacteria-stimulated macrophage cultures were diluted 1:5 in RPMI containing 0.5% BSA and were then added to the bottom chamber of the Transwell, and 2 x 105 T cells were added to the top chamber. The plates were incubated for 4 h at 37°C followed by counting of migrated cells by flow cytometry. To block Th1 cell chemokine receptor CCR5 or CXC chemokine receptor CXCR3, Th1 cells were incubated for 1 h at 37°C before migration assay with saturating amounts (10 µg/ml) of CCL3 or CXCL10, respectively [23 ].


arrow
RESULTS
 
Kinetics of chemokine-mRNA synthesis in bacteria-stimulated macrophages
To analyze S. pyogenes- and L. rhamnosus-induced chemokine mRNA expression, macrophages were stimulated with live bacteria at 1:1 bacteria:macrophage ratio. This dose of bacteria was chosen, as it induces submaximal cytokine gene expression in monocyte/macrophage cultures [24 , 25 ]. Total cellular RNA from stimulated macrophages was collected, and chemokine mRNA expression was analyzed by Northern blotting. S. pyogenes and L. rhamnosus induced the mRNA expression of all the chemokines analyzed (Fig. 1 ) but with different kinetics. At 2 h after stimulation, both bacteria induced CCL2, CCL3, CCL19, CCL20, and CXCL8 mRNA expression, and the CCL5 gene was only induced by S. pyogenes. At 6 h, CCL7 was induced by S. pyogenes and L. rhamnosus, whereas CXCL9 and CXCL10 mRNA expression was detectable only in S. pyogenes-stimulated macrophages. S. pyogenes-induced mRNA expression of CCL2, CCL7, CXCL9, and CXCL10 peaked at 12 h after stimulation, and L. rhamnosus-induced expression of these chemokines was highest at 24 h after stimulation.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 1. Kinetics of chemokine-mRNA expression in S. pyogenes (GAS)- or L. rhamnosus (LAB)-stimulated human macrophages. Macrophages were stimulated with GAS or LAB in a 1:1 bacteria:macrophage ratio. Total cellular RNA was collected at different time points and analyzed by Northern blotting. The experiment was done three times with similar results.

Chemokine secretion in bacteria-stimulated macrophages
Next, we analyzed whether the up-regulation of chemokine mRNA expression correlated with secretion of chemokines. Chemokine levels were measured from cell-culture supernatants by ELISA. S. pyogenes- and L. rhamnosus-stimulated macrophages produced CCL2, CCL3, and CXCL8 at 2 h, and CCL5 and CCL7 became detectable at 6 h after stimulation (Fig. 2 ). S. pyogenes-stimulated macrophages produced CCL20 already at 2 h, whereas in L. rhamnosus-stimulated macrophages, CCL20 production was detectable at 6 h. The secreted amounts of these chemokines increased up to 24 h except for CXCL8, which reached its maximum at 12 h. A major difference between the two bacteria was observed in CXCL9 and CXCL10 production. CXCL9 production was detectable only in S. pyogenes-stimulated macrophage supernatants. S. pyogenes stimulation also resulted in over 20-fold higher CXCL10 production at 24 h compared with that of L. rhamnosus. Maximal CXCL9 and CXCL10 levels were detected at 24 h after bacterial stimulation (Fig. 2) . No CCL19 protein production was detected from macrophage cell-culture supernatants (data not shown).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. Chemokine production in S. pyogenes (GAS)- or L. rhamnosus (LAB)-stimulated human macrophages. Cell-culture supernatants from bacteria-stimulated macrophages were collected, and chemokine levels were determined by ELISA. Results are the means (±1 SD unit) of three independent experiments performed with supernatants of cell cultures from four different blood donors. No CCL19 protein production was detectable. Note the differences in scale from one chemokine to other.

The effect of protein synthesis inhibition on bacteria-induced chemokine mRNA synthesis
We have previously shown that S. pyogenes and L. rhamnosus can enhance host-cell cytokine gene expression directly by activating nuclear factor-{kappa}B (NF-{kappa}B) [25 ]. Some target-gene expression could also be activated indirectly, e.g., via the production of proinflammatory cytokines. To elucidate whether bacteria-induced chemokine gene expression was direct or dependent on ongoing protein synthesis, macrophages were stimulated with bacteria in the absence or presence of protein synthesis inhibitor CHX. CHX treatment of macrophages reduced S. pyogenes-stimulated CCL2, CCL7, CXCL9, and CXCL10 mRNA expression at 4- and/or 8-h time points. In this time frame, L. rhamnosus-induced expression of the above chemokine genes was weak or undetectable, and CHX was able to partially block the induction of CCL2 mRNA at the 8-h time point. Bacteria-induced CCL3, CCL5, CCL19, CCL20, and CXCL8 mRNA levels remained the same or were enhanced in response to treatment of cells with bacteria and CHX (Fig. 3 ).



View larger version (77K):
[in this window]
[in a new window]
 
Figure 3. Effect of protein synthesis inhibition on S. pyogenes (GAS)- or L. rhamnosus (LAB)-induced chemokine mRNA expression. To study the requirement of de novo protein synthesis in chemokine mRNA expression, macrophages were stimulated with GAS or LAB in the absence or presence of protein synthesis inhibitor CHX (10 µg/ml), which was added 30 min after the beginning of bacterial stimulation. The experiment was done two times with similar results.

The effect of anti-IFN-{alpha}/ß neutralization on bacteria-induced chemokine gene expression
Stimulation of macrophages with S. pyogenes or L. rhamnosus leads to the production of proinflammatory cytokines including IFN-{alpha}/ß [25 ]. As IFN-{alpha}/ß has been shown to be involved in at least CCL2, CCL7, and CXCL10 gene expression [21 ], we analyzed whether IFN-{alpha}/ß has a role as a chemokine-inducing factor in bacteria-stimulated macrophages. Macrophages were stimulated with S. pyogenes or L. rhamnosus in the presence or absence of neutralizing anti-IFN-{alpha} antibodies, which completely abolished S. pyogenes-induced mRNA expression of CCL19, whereas the induction of CCL2, CCL5, CCL7, CXCL9, and CXCL10 mRNAs was only partially reduced at 12- or 24-h time points (Fig. 4 ). Treatment of cells with anti-IFN-{alpha} antibodies also reduced L. rhamnosus-induced CCL2 and CXCL9 mRNA levels at 24 h. IFN-{alpha}/ß neutralization had no effect on bacteria-induced CCL3, CCL20, or CXCL8 mRNA expression (Fig. 4) . IFN-{alpha} stimulation of macrophages indicated that at least CCL2, CCL7, CXCL10, and to some extent, CXCL9 genes are under the regulation of type I IFNs (Fig. 4) .



View larger version (88K):
[in this window]
[in a new window]
 
Figure 4. The effect of IFN-{alpha}/ß neutralization on S. pyogenes (GAS)- or L. rhamnosus (LAB)-induced chemokine gene expression. Macrophages were stimulated with GAS or LAB at 1:1 bacteria:macrophage ratio followed by addition of neutralizing anti-IFN-{alpha}/ß antibodies 1 h after the beginning of bacterial stimulation. Anti-IFN-{alpha}/ß antibody treatment was repeated at 12 h for the 24-h samples. IFN-{alpha} stimulation of macrophages was done with 100 IU/ml IFN-{alpha} for 3 h. Total cellular RNA was isolated, and analysis of chemokine mRNA expression was performed by Northern blotting. Results from one of three experiments performed are shown.

The effect of IFN-{alpha}, IL-1ß, IL-6, and TNF-{alpha} on chemokine-mRNA expression
As IFN-{alpha}/ß was at least partially regulating the expression of several chemokine genes during bacterial stimulation, we analyzed more systematically the role of proinflammatory cytokines and IFN-{alpha} in chemokine mRNA expression. In this analysis, we concentrated on CCL19, CCL20, CXCL9, and CXCL10 genes. Macrophages were stimulated with IFN-{alpha}, IL-1ß, IL-6, or TNF-{alpha} alone or in different combinations for 2 h followed by isolation of total cellular RNA and Northern blot analysis. IL-1ß and TNF-{alpha} to a lesser extent were found to induce mRNA expression of CCL19 and CCL20 (Fig. 5 ). No CCL19 or CCL20 mRNA expression was observed in response to stimulation with IFN-{alpha} or IL-6. Some enhancement of CCL19 mRNA expression was seen when cells were stimulated with a combination of TNF-{alpha} and IFN-{alpha}, but apparently no other synergistic effects between these cytokine combinations were seen. CXCL9 and CXCL10 genes behaved differently, as stimulation with IFN-{alpha} but not with IL-1ß, IL-6, or TNF-{alpha} induced mRNA expression of these chemokines (Fig. 5) . The expression level of CXCL9 was lower compared with that of CXCL10. Stimulation of macrophages with IFN-{alpha} together with IL-1ß or TNF-{alpha} led to a very strong synergistic enhancement of CXCL9 and CXCL10 gene expression (Fig. 5) . IL-6 was found to have no role in the regulation of these chemokine genes.



View larger version (101K):
[in this window]
[in a new window]
 
Figure 5. The effect of proinflammatory cytokines on CCL19, CCL20, CXCL9, and CXCL10 mRNA expression. Macrophages were stimulated with IFN-{alpha} (100 IU/ml) and/or IL-1ß (10 ng/ml), IL-6 (20 ng/ml), or TNF-{alpha} (10 ng/ml) for 2 h. Total RNA was collected, and chemokine mRNA expression was analyzed by Northern blotting. The experiment was done twice with similar results.

Migration of Th1 cells by bacteria-stimulated macrophage supernatants
Th1 cells express CCR5 and CXCR3 and are thus responsive for CCL3, CCL5, CXCL9, and CXCL10 [26 27 28 29 30] (Fig. 6B ). As S. pyogenes and L. rhamnosus enhanced the mRNA expression and production of these chemokines, we hypothesized that cell-culture supernatants from bacteria-stimulated macrophages would stimulate the migration of Th1 cells. Cell-culture supernatants from control or bacteria-stimulated macrophages were added to migration chambers containing Th1 cells, and the amount of migrated cells was counted. To analyze the role of CCR5 and CXCR3 ligands in Th1 chemotaxis, T cells were treated with saturating amounts of CCL3 or CXCL10 before migration assay to block the respective chemokine receptors.

Cell-culture supernatants from L. rhamnosus-stimulated macrophages induced Th1 migration approximately two times more efficiently than supernatants from control macrophages (Fig. 6A) . Pretreatment of Th1 cells with CXCL10 did not significantly reduce the ability of L. rhamnosus-stimulated macrophage supernatants to induce Th1 migration. In contrast, pretreatment of Th1 cells with CCL3 reduced chemotaxis nearly to the same level as control. Supernatants from S. pyogenes-stimulated macrophages induced a sevenfold increase in Th1 cell chemotaxis compared with that induced by control macrophage supernatants (Fig. 6A) . Th1 cells treated with CXCL10 before migration assay showed a clear reduction in Th1 migration activity. CCL3 pretreatment had only a minor effect on the ability of S. pyogenes-stimulated macrophage supernatants to induce Th1 chemotaxis.


arrow
DISCUSSION
 
In the present study, we show that stimulation of macrophages with pathogenic S. pyogenes or nonpathogenic L. rhamnosus GG induces mRNA expression of CCL2, CCL3, CCL5, CCL7, CCL19, CCL20, CXCL8, CXCL9, and CXCL10. Chemokine production was also detected at protein level with the exception of CCL19. S. pyogenes was a more potent inducer of chemokine genes than L. rhamnosus with the exception of CXCL8. Previous studies have mostly concentrated on the ability of pathogenic bacteria to induce chemokine production. Our data with S. pyogenes are well in line with previous reports showing that Gram-positive Staphylococcus aureus, Listeria monocytogenes, and Streptococcus pneumoniae, as well as certain Gram-negative bacteria, induce chemokine production in various cell types [31 32 33 34 ]. In the present study, we demonstrate that also nonpathogenic, Gram-positive bacteria, such as L. rhamnosus, are able to induce chemokine production in human macrophages. Certain kinetic and quantitative differences between S. pyogenes- and L. rhamnosus-induced chemokine production were, however, seen (Figs. 1 and 2) .

Inhibition of macrophage protein synthesis by CHX reduced bacteria-induced mRNA expression of CCL2, CCL7, CXCL9, and CXCL10, indicating that activation of these chemokine genes required ongoing protein synthesis. Neutralization of IFN-{alpha}/ß during bacterial stimulation reduced CCL2, CCL5, CCL7, CXCL9, and CXCL10 mRNA expression and surprisingly, also that of CCL19. As IFN-{alpha} neutralization did not completely block bacteria-induced expression of these chemokine mRNAs, other factors in addition to IFN-{alpha} must be involved in the regulation of these chemokine genes. As S. pyogenes and L. rhamnosus are able to induce IFN-{alpha}/ß, TNF-{alpha}, IL-6 [24 ], and IL-1ß production in macrophages (data not shown), we analyzed the ability of these proinflammatory cytokines to induce chemokine production. CCL19 and CCL20 genes were found to be up-regulated by IL-1ß and TNF-{alpha} but not by IFN-{alpha}. A recent report described that CCL20 is regulated by TNF-{alpha} [35 ], whereas no information on cytokine-dependent expression of CCL19 is yet available. Stimulation of macrophages with IFN-{alpha} plus IL-1ß or TNF-{alpha} resulted in markedly increased mRNA expression of CXCL9 and CXCL10 compared with stimulation with IFN-{alpha} alone. Possible synergy between IFN-{alpha} and TNF-{alpha} was also seen for the CCL19 gene, although stimulation with IFN-{alpha} alone did not induce any CCL19 mRNA expression. Our results suggest that S. pyogenes- or L. rhamnosus-induced IL-1ß, TNF-{alpha}, and IFN-{alpha} are involved in enhancing the expression of CCL19, CCL20, CXCL9, and CXCL10. The mechanisms for the synergy between IFN-{alpha} and IL-1ß or TNF-{alpha} are likely to be cooperative binding of IFN regulatory factor, signal transducer and activator of transcription, and/or NF-{kappa}B transcription factors to chemokine promoter elements, as has been demonstrated for CCL5 [36 ]. Furthermore, CXCL9 and CXCL10 have IFN-stimulated response element and NF-{kappa}B sites in their promoter regions [37 , 38 ].

Of interest was the observation that S. pyogenes and L. rhamnosus induced CCL19 and CCL20 mRNA expression in human macrophages. CCL20 is a chemoattractant for immature DCs, and mature DCs respond to CCL19 [39 ]. It has been proposed that CCL19 expression is limited to mature DCs, driving their homing to lymphoid tissue [40 ]. However, recent evidence suggests that also neutrophils are able to produce CCL19 [41 ]. Our finding that S. pyogenes and L. rhamnosus are able to induce CCL20 protein production in macrophages could be important in vivo by recruiting immature DCs to the site of inflammation and thus promoting immune response toward an adaptive phase. Despite mRNA expression, no CCL19 protein production was detectable from bacteria-stimulated macrophage supernatants. As the CCL19 mRNA expression peaked at 24 h, it could be that CCL19 production is measurable only at later time points. Alternatively, the produced amounts of CCL19 could be so low that they remained under the detection limit of the CCL19 ELISA.

Local chemokine milieu has a significant role in determining the course of adaptive-immunity response as a result of a differential expression of chemokine receptors in polarized T cell populations [26 , 28 , 29 ]. Supernatants from S. pyogenes- or L. rhamnosus-stimulated macrophages induced the migration of Th1 cells, whereas such an effect for resting CD4+ cells was not detected (data not shown). Cell-culture supernatants from S. pyogenes-stimulated macrophages induced Th1 migration almost three times more efficiently compared with supernatants from L. rhamnosus-stimulated macrophages (Fig. 6A) . This is well in line with the better ability of S. pyogenes to induce CXCL9 and CXCL10 production in macrophages compared with that of L. rhamnosus (Figs. 1 and 2) . Blocking Th1 cell-surface CXCR3 with a saturating amount of CXCL10 did not affect the Th1 migration induced by L. rhamnosus-stimulated macrophage supernatants, whereas CCR5 neutralization reduced the migration by 40%. In contrast, CXCR3-blocking reduced the migration of Th1 cells induced by S. pyogenes-stimulated macrophage supernatant by ~55%, and CCR5 neutralization did not exert a significant effect. These results indicate that CXCR3 ligands CXCL9 and CXCL10 are the most important inducers of Th1 migration in S. pyogenes-stimulated macrophages, and in L. rhamnosus stimulation, CCR5 ligands CCL3 and CCL5 dominate.

Pathogenic S. pyogenes was a more potent inducer of Th1 chemokines CXCL9 and CXCL10 than L. rhamnosus. It has previously been demonstrated that purified S. pyogenes superantigens or S. pyogenes culture supernatants are able to induce Th1 cytokine responses in monocytes [42 ]. It could be that in our experimental setting, S. pyogenes produces small amounts of superantigens, which may contribute to the enhanced Th1 chemokine production in S. pyogenes-stimulated macrophages. Norrby-Teglund and colleagues [43 ] have reported that monocyte/macrophages and T cells are the most common leukocyte populations in S. pyogenes-infected tissue. Our finding that stimulation of macrophages with S. pyogenes leads to the production of Th1-attracting chemokines CXCL9 and CXCL10 could provide one explanation for the accumulation of T cells to S. pyogenes-infected tissue.

The ability of nonpathogenic L. rhamnosus to induce chemokine production and enhance leukocyte chemotaxis could be one of its immunostimulatory mechanisms. CXCL8, which is a chemoattractant for neutrophils [44 ], was induced better by L. rhamnosus than by S. pyogenes. As neutrophils are involved in forming the first line of defense against bacteria, L. rhamnosus-induced CXCL8 production could promote neutrophil accumulation and enhance inflammatory responses. The L. rhamnosus strain used in this study was recently proposed to promote antiallergic processes in humans by inducing Th1 immune response [10 ]. Certain L. rhamnosus strains, including the one used in this study, have been shown to induce the production of Th1 cytokines in human monocytes/macrophages [13 , 24 , 45 , 46 ], which could relate to their Th2-suppressing, antiallergic properties. Our finding that L. rhamnosus-stimulated macrophage supernatants promote chemotaxis of Th1 cells may in part explain the antiallergic effects of L. rhamnosus.

In this study, we show that pathogenic and nonpathogenic Gram-positive bacteria are able to induce inflammatory chemokine production in human macrophages. Our data suggests that direct as well as indirect cytokine-mediated mechanisms are involved in the regulation of chemokine gene expression by Gram-positive bacteria. The differences between S. pyogenes- and L. rhamnosus-induced chemokine gene expression could be partly explained by their differential ability to induce IFN-{alpha}/ß production. We also demonstrate that S. pyogenes and L. rhamnosus stimulate Th1 cell chemotaxis. The present data together with previous observations on the ability of these bacteria to induce IL-12, IL-18, and IFN-{alpha}/ß production [24 , 25 ] suggest that pathogenic S. pyogenes and nonpathogenic L. rhamnosus are able to stimulate Th1 immune responses.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by the Medical Research Council of the Academy of Finland, the Finnish Cancer Foundation, the Sigrid Juselius Foundation, the Maud Kuistila Foundation, and by institutional grants from the Istituto Superiore di Sanità, the "Special Project AIDS", and "1% Project" (EC). We are grateful to Mari Aaltonen, Valma Mäkinen, Teija Westerlund, and Marika Yliselä for expert technical assistance. We also thank T. Grassi for help and discussion.

Received April 29, 2002; revised April 23, 2003; accepted May 9, 2003.


arrow
REFERENCES
 
    1
  1. Aderem, A., Underhill, D. M. (1999) Mechanisms of phagocytosis in macrophages Annu. Rev. Immunol. 17,593-623[CrossRef][Medline]
  2. 2
  3. Bagglioni, M., Dewald, B., Moser, B. (1997) Human chemokines: an update Annu. Rev. Immunol. 15,675-705[CrossRef][Medline]
  4. 3
  5. Moser, B., Loetscher, P. (2001) Lymphocyte traffic control by chemokines Nat. Immunol. 2,123-128[CrossRef][Medline]
  6. 4
  7. Zlotnik, A., Yoshie, O. (2000) Chemokines: a new classification system and their role in immunity Immunity 12,121-127[CrossRef][Medline]
  8. 5
  9. Cunningham, M. W. (2000) Pathogenesis of group A streptococcal infections Clin. Microbiol. Rev. 13,470-511[Abstract/Free Full Text]
  10. 6
  11. Fischetti, V. A. (1989) Streptococcal M protein: molecular design and biological behavior Clin. Microbiol. Rev. 2,285-314[Abstract/Free Full Text]
  12. 7
  13. Schlievert, P. M. (1993) Role of superantigens in human disease J. Infect. Dis. 167,997-1002[Medline]
  14. 8
  15. Cross, M. L., Stevenson, L. M., Gill, H. S. (2001) Anti-allergy properties of fermented foods: an important immunoregulatory mechanisms of lactic acid bacteria? Int. Immunopharmacol. 1,891-901[CrossRef][Medline]
  16. 9
  17. Hatakka, K., Savilahti, E., Pönkä, A., Meurman, J. H., Poussa, T., Näse, L., Saxelin, M., Korpela, R. (2001) Effect of long term consumption of probiotic milk on infections in children attending day care centres: double blind, randomised trial BMJ 322,1-5[Abstract/Free Full Text]
  18. 10
  19. Kalliomäki, M., Salminen, S., Arvilommi, H., Kero, P., Koskinen, P., Isolauri, E. (2001) Probiotics in primary prevention of atopic disease: a randomised placebo-controlled test Lancet 357,1076-1079[CrossRef][Medline]
  20. 11
  21. Saxelin, M. (1997) Lactobacillus GG-a human probiotic strain with thorough clinical documentation Food Rev. Int. 13,293-313
  22. 12
  23. Inngjerdingen, M., Bassam, D., Maghazachi, A. A. (2001) Expression and regulation of chemokine receptors in human natural killer cells Blood 97,367-375[Abstract/Free Full Text]
  24. 13
  25. Miettinen, M., Vuopio-Varkila, J., Varkila, K. (1996) Production of human tumor necrosis factor alpha, interleukin-6, and interleukin-10 is induced by lactic acid bacteria Infect. Immun. 64,5403-5405[Abstract]
  26. 14
  27. Holm, S. E., Falsen, E. (1967) An antigen free medium for cultivation of b-hemolytic streptococci Acta Pathol. Microbiol. Scand. 69,264-276
  28. 15
  29. Pirhonen, J., Sareneva, T., Kurimoto, M., Julkunen, I., Matikainen, S. (1999) Virus infection activates IL-1 beta and IL-18 production in human macrophages by a caspase-1-dependent pathway J. Immunol. 162,7322-7329[Abstract/Free Full Text]
  30. 16
  31. Ronni, T., Sareneva, T., Pirhonen, J., Julkunen, I. (1995) Activation of IFN-alpha, IFN-gamma, MxA, and IFN regulatory factor 1 genes in influenza A virus-infected human peripheral blood mononuclear cells J. Immunol. 154,2764-2774[Abstract]
  32. 17
  33. Mogensen, K. E., Pyhälä, L., Cantell, K. (1975) Raising antibodies to human leukocyte interferon Acta Pathol. Microbiol. Scand. 83,443-450
  34. 18
  35. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., Rutter, W. J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease Biochemistry 18,5294-5299[CrossRef][Medline]
  36. 19
  37. Glisin, V., Crkvenjakov, R., Byus, C. (1974) Ribonucleic acid isolated by cesium chloride centrifugation Biochemistry 13,2633-2637[CrossRef][Medline]
  38. 20
  39. Rossi, D. L., Vicari, A. P., Franz-Bacon, K., McClanahan, T. K., Zlotnik, A. (1997) Identification through bioinformatics of two new macrophage proinflammatory human chemokines: MIP-3alpha and MIP-3beta J. Immunol. 158,1033-1036[Abstract]
  40. 21
  41. Matikainen, S., Pirhonen, J., Miettinen, M., Lehtonen, A., Govenius-Vintola, C., Sareneva, T., Julkunen, I. (2000) Influenza A and Sendai viruses induce differential chemokine gene expression and transcription factor activation in human macrophages Virology 276,138-147[CrossRef][Medline]
  42. 22
  43. Mustafa, A. S., Kvalheim, G., Dege, M., Godal, T. (1986) Mycobacterium bovis BCG-induced human T-cell clones from BCG-vaccinated healthy subjects: antigen specificity and lymphokine production Infect. Immun. 53,491-497[Abstract/Free Full Text]
  44. 23
  45. Lande, R., Giacomini, E., Grassi, T., Remoli, M. E., Iona, E., Miettinen, M., Julkunen, I., Coccia, E. M. (2003) IFN-alpha/beta released by mycobacterium tuberculosis-infected human dendritic cells induces the expression of CXCL10: selective recruitment of NK and activated T cells J. Immunol. 170,1174-1182[Abstract/Free Full Text]
  46. 24
  47. Miettinen, M., Matikainen, S., Vuopio-Varkila, J., Pirhonen, J., Varkila, K., Kurimoto, M., Julkunen, I. (1998) Lactobacilli and streptococci induce interleukin-12 (IL-12), IL-18, and gamma interferon production in human peripheral blood mononuclear cells Infect. Immun. 66,6058-6062[Abstract/Free Full Text]
  48. 25
  49. Miettinen, M., Lehtonen, A., Julkunen, I., Matikainen, S. (2000) Lactobacilli and streptococci activate NF-{kappa}B and STAT signaling pathways in human macrophages J. Immunol. 164,3733-3740[Abstract/Free Full Text]
  50. 26
  51. Bonecchi, R., Bianchi, G., Bordignon, P. P., D’Ambrosio, D., Lang, R., Borsatti, A., Sozzani, S., Allavena, P., Gray, P. A., Mantovani, A., Sinigaglia, F. (1998) Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s J. Exp. Med. 187,129-134[Abstract/Free Full Text]
  52. 27
  53. Liao, F., Rabin, R. L., Yanelli, J. R., Koniaris, L. G., Vanguri, P., Farber, J. M. (1995) Human Mig chemokine: biochemical and functional characterization J. Exp. Med. 182,1301-1314[Abstract/Free Full Text]
  54. 28
  55. Sallusto, F., Lenig, D., Mackay, C. R., Lanzavecchia, A. (1998) Flexible programs of chemokine receptor expression on human polarized T helper 1 and 2 lymphocytes J. Exp. Med. 187,875-883[Abstract/Free Full Text]
  56. 29
  57. Siveke, J. T., Hamann, A. (1998) T helper 1 and T helper 2 cells respond differentially to chemokines J. Immunol. 160,550-554[Abstract/Free Full Text]
  58. 30
  59. Taub, D. D., Lloyd, A. R., Conlon, K., Wang, J. M., Ortaldo, J. R., Harada, A., Matsushima, K., Kelvin, D. J., Oppenheim, J. J. (1993) Recombinant human interferon-inducible protein 10 is a chemoattractant for human monocytes and T lymphocytes and promotes T cell adhesion to endothelial cells J. Exp. Med. 177,1809-1814[Abstract/Free Full Text]
  60. 31
  61. Eckmann, L., Kagnoff, M. F., Fierer, J. (1993) Epithelial cells secrete chemokine IL-8 in response to bacterial entry Infect. Immun. 61,4569-4574[Abstract/Free Full Text]
  62. 32
  63. Hachicha, M., Rathanaswami, P., Naccache, P. H., McColl, S. R. (1998) Regulation of chemokine gene expression in human peripheral blood neutrophils phagocytosing microbial pathogens J. Immunol. 160,449-454[Abstract/Free Full Text]
  64. 33
  65. Lauw, F. N., Simpson, A. J. H., Prins, J. M., van Deventer, S. J. H., Chaowagul, W., White, N. J., van der Poll, T. (2000) The CXC chemokines gamma interferon (IFN-{gamma})-inducible protein 10 and monokine induced by IFN-{gamma} are released during severe melioidosis Infect. Immun. 68,3888-3893[Abstract/Free Full Text]
  66. 34
  67. Wang, Z-M., Liu, C., Dziarski, R. (2000) Chemokines are the main proinflammatory mediators in human monocytes activated by Staphylococcus aureus, peptidoglycan, and endotoxin J. Biol. Chem. 275,20260-20267[Abstract/Free Full Text]
  68. 35
  69. Harant, H., Eldershaw, S. A., Lindley, I. J. (2001) Human macrophage inflammatory protein-3alpha/CCL20/LARC/Exodus/SCYA20 is transcriptionally upregulated by tumor necrosis factor-alpha via a non-standard NF-kappaB site FEBS Lett. 509,439-445[CrossRef][Medline]
  70. 36
  71. Génin, P., Algarté, M., Roof, P., Lin, R., Hiscott, J. (2000) Regulation of RANTES chemokine gene expression requires cooperativity between NF-{kappa}B and IFN-regulatory factor transcription factors J. Immunol. 164,5352-5361[Abstract/Free Full Text]
  72. 37
  73. Ohmori, Y., Hamilton, T. A. (1993) Cooperative interaction between interferon (IFN) stimulus response element and kappa B sequence motifs controls IFN gamma- and lipopolysaccharide-stimulated transcription from the murine IP-10 promoter J. Biol. Chem. 268,6677-6688[Abstract/Free Full Text]
  74. 38
  75. Ohmori, Y., Schreiber, R. D., Hamilton, T. A. (1997) Synergy between interferon-{gamma} and tumor necrosis factor-{alpha} in transcriptional activation is mediated by cooperation between signal transducer and activator of transcription 1 and nuclear factor {kappa}B J. Biol. Chem. 272,14899-14907[Abstract/Free Full Text]
  76. 39
  77. Dieu, M-R., Vanbervliet, B., Vicari, A., Bridon, J-M., Oldham, E., Aït-Yahia, S., Brière, F., Zlotnik, A., Lebecque, S., Caux, C. (1998) Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites J. Exp. Med. 188,373-386[Abstract/Free Full Text]
  78. 40
  79. Sallusto, F., Palermo, B., Lenig, D., Miettinen, M., Matikainen, S., Julkunen, I., Forster, R., Burgstahler, R., Lipp, M., Lanzavecchia, A. (1999) Distinct patterns and kinetics of chemokine production regulate dendritic cell function Eur. J. Immunol. 29,1617-1625[CrossRef][Medline]
  80. 41
  81. Scapini, P., Laudanna, C., Pinardi, C., Allavena, P., Mantovani, A., Sozzani, S., Cassatella, M. A. (2001) Neutrophils produce biologically active macrophage inflammatory protein-3{alpha} (MIP-3{alpha})/CCL20 and MIP-3ß/CCL19 Eur. J. Immunol. 31,1981-1988[CrossRef][Medline]
  82. 42
  83. Norrby-Teglund, A., Lustig, R., Kotb, M. (1997) Differential induction of Th1 versus Th2 cytokines by group A streptococcal toxic shock syndrome isolates Infect. Immun. 65,5209-5215[Abstract]
  84. 43
  85. Norrby-Teglund, A., Thulin, P., Gan, B. S., Kotb, M., McGeer, A., Andersson, J., Low, D. E. (2001) Evidence for superantigen involvement in severe group A streptococcal tissue infections J. Infect. Dis. 184,853-860[CrossRef][Medline]
  86. 44
  87. Huber, A. R., Kunkel, S. L., Todd, R. F., III, Weiss, S. J. (1991) Regulation of transendothelial neutrophil migration by endogenous interleukin-8 Science 254,99-102[Abstract/Free Full Text]
  88. 45
  89. Hessle, C., Hanson, L. Å., Wold, A. E. (1999) Lactobacilli from human gastrointestinal mucosa are strong stimulators of IL-12 production Clin. Exp. Immunol. 116,276-282[CrossRef][Medline]
  90. 46
  91. Maassen, C. B. M., van Holten-Neelen, C., Balk, F., den Bak-Glashouwer, M-J. H., Leer, R. J., Laman, J. D., Boersma, W. J. A., Claassen, E. (2000) Strain-dependent induction of cytokine profiles in gut by orally administered Lactobacillus strains Vaccine 18,2613-2623[CrossRef][Medline]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
M. Hafez, K. Hayes, M. Goldrick, G. Warhurst, R. Grencis, and I. S. Roberts
The K5 Capsule of Escherichia coli Strain Nissle 1917 Is Important in Mediating Interactions with Intestinal Epithelial Cells and Chemokine Induction
Infect. Immun., July 1, 2009; 77(7): 2995 - 3003.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Miettinen, V. Veckman, S. Latvala, T. Sareneva, S. Matikainen, and I. Julkunen
Live Lactobacillus rhamnosus and Streptococcus pyogenes differentially regulate Toll-like receptor (TLR) gene expression in human primary macrophages
J. Leukoc. Biol., October 1, 2008; 84(4): 1092 - 1100.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Benoit, B. Desnues, and J.-L. Mege
Macrophage Polarization in Bacterial Infections
J. Immunol., September 15, 2008; 181(6): 3733 - 3739.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Ren, Y. Xie, G. Jiang, J. Fan, J. Yeung, W. Li, P. K. H. Tam, and J. Savill
Apoptotic Cells Protect Mice against Lipopolysaccharide-Induced Shock
J. Immunol., April 1, 2008; 180(7): 4978 - 4985.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
V. Veckman and I. Julkunen
Streptococcus pyogenes activates human plasmacytoid and myeloid dendritic cells
J. Leukoc. Biol., February 1, 2008; 83(2): 296 - 304.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
H. M. Linge, I. Sastalla, D. P. Nitsche-Schmitz, A. Egesten, and I.-M. Frick
Protein FOG is a moderate inducer of MIG/CXCL9, and group G streptococci are more tolerant than group A streptococci to this chemokine's antibacterial effect
Microbiology, November 1, 2007; 153(11): 3800 - 3808.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. G. Chan, M. Mayer, E. M. Davis, S. A. Halperin, T.-J. Lin, and S. F. Lee
Role of D-Alanylation of Streptococcus gordonii Lipoteichoic Acid in Innate and Adaptive Immunity
Infect. Immun., June 1, 2007; 75(6): 3033 - 3042.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. E. Pietila, V. Veckman, A. Lehtonen, R. Lin, J. Hiscott, and I. Julkunen
Multiple NF-{kappa}B and IFN Regulatory Factor Family Transcription Factors Regulate CCL19 Gene Expression in Human Monocyte-Derived Dendritic Cells
J. Immunol., January 1, 2007; 178(1): 253 - 261.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
E. Giacomini, A. Sotolongo, E. Iona, M. Severa, M. E. Remoli, V. Gafa, R. Lande, L. Fattorini, I. Smith, R. Manganelli, et al.
Infection of Human Dendritic Cells with a Mycobacterium tuberculosis sigE Mutant Stimulates Production of High Levels of Interleukin-10 but Low Levels of CXCL10: Impact on the T-Cell Response.
Infect. Immun., June 1, 2006; 74(6): 3296 - 3304.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
J. Melchjorsen, J. Siren, I. Julkunen, S. R. Paludan, and S. Matikainen
Induction of cytokine expression by herpes simplex virus in human monocyte-derived macrophages and dendritic cells is dependent on virus replication and is counteracted by ICP27 targeting NF-{kappa}B and IRF-3.
J. Gen. Virol., May 1, 2006; 87(Pt 5): 1099 - 1108.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. Rothenbacher, S. Muller-Scholze, C. Herder, W. Koenig, and H. Kolb
Differential Expression of Chemokines, Risk of Stable Coronary Heart Disease, and Correlation with Established Cardiovascular Risk Markers
Arterioscler. Thromb. Vasc. Biol., January 1, 2006; 26(1): 194 - 199.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
O. Goldmann, M. Rohde, G. S. Chhatwal, and E. Medina
Role of Macrophages in Host Resistance to Group A Streptococci
Infect. Immun., May 1, 2004; 72(5): 2956 - 2963.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
S Ghosh, D van Heel, and R J Playford
Probiotics in inflammatory bowel disease: is it all gut flora modulation?
Gut, May 1, 2004; 53(5): 620 - 622.
[Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
V. Veckman, M. Miettinen, J. Pirhonen, J. Siren, S. Matikainen, and I. Julkunen
Streptococcus pyogenes and Lactobacillus rhamnosus differentially induce maturation and production of Th1-type cytokines and chemokines in human monocyte-derived dendritic cells
J. Leukoc. Biol., May 1, 2004; 75(5): 764 - 771.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0402212v1
74/3/395    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Veckman, V.
Right arrow Articles by Julkunen, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Veckman, V.
Right arrow Articles by Julkunen, I.