PeproTech Inc.
Originally published online as doi:10.1189/jlb.0702351 on May 22, 2003

Published online before print May 22, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0702351v1
74/1/60    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bolton, S. J.
Right arrow Articles by Wardlaw, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bolton, S. J.
Right arrow Articles by Wardlaw, A. J.
(Journal of Leukocyte Biology. 2003;74:60-68.)
© 2003 by Society for Leukocyte Biology

Expression of and functional responses to protease-activated receptors on human eosinophils

Sarah J. Bolton*, Clare A. McNulty*, Rebecca J. Thomas*, Colin R. A. Hewitt{dagger} and Andrew J. Wardlaw*

Institute for Lung Health,
* Division of Respiratory Medicine, Leicester Warwick Medical School, and
{dagger} Department of Microbiology and Immunology, School of Biological Sciences, Maurice Shock Medical Science Building, Leicester University, United Kingdom

Correspondence: Sarah Bolton, Division of Respiratory Medicine, Leicester University, Clinical Sciences, Glenfield Hospital, Groby Road, Leicester LE3 9QP, UK. E-mail: sjb73{at}leicester.ac.uk


arrow
ABSTRACT
 
Eosinophil recruitment to airway tissue is a key feature of asthma, and release of a wide variety of toxic mediators from eosinophils leads to the tissue damage that is a hallmark of asthma pathology. Factors that control the release of these toxic mediators are targets for potential therapeutic intervention. Protease-activated receptors (PARs) are a novel class of receptors that are activated by cleavage of the N terminus of the receptor by proteases such as thrombin or trypsin-like enzymes. To date, PAR1–4 have been identified, and there are several studies that have demonstrated the expression of PARs in airway tissue, particularly the respiratory epithelium. We have investigated whether eosinophils express PARs and if activation of these receptors will then trigger a functional response. Using a combination of reverse transcriptase-polymerase chain reaction, Western blotting, and flow cytometry analysis, we have demonstrated that eosinophils express PAR1 and PAR2. FACS analysis showed that PAR1 could be clearly detected on the surface of the cells, whereas PAR2 appeared to be primarily intracellular. Trypsin and the PAR2 agonist peptide were seen in trigger shape change, release of cysteinyl leukotrienes, and most obviously, generation of reactive oxygen species. In contrast, thrombin had no effect on eosinophil function. The PAR1 agonist peptide did have a minor effect on eosinophil function, but this was most likely down to its ability to activate PAR1 and PAR2. These results demonstrate that PAR2 is the major PAR receptor that is capable of modulating eosinophil function.

Key Words: trypsin • thrombin • activation


arrow
INTRODUCTION
 
Eosinophils are thought to be one of the major effector cells in asthma, and there is a strong association between the specific accumulation of eosinophils in the airways of asthmatics and symptoms. Once present in the tissue, they respond to specific stimuli and release a variety of proinflammatory mediators such as lipid metabolites and cytotoxic granule proteins. Release of these mediators causes tissue damage within the airways and contributes to the characteristic pathological hallmarks of asthma [1 ]. The mechanisms that control eosinophil activation, which cause the subsequent tissue damage, are therefore targets for potential therapeutic intervention.

The first steps in selective eosinophil recruitment to airway tissue are egress from the bloodstream, and this involves selective adhesion and transmigration across the vascular endothelium [2 ]. Initial adhesion is mediated by P-selectin glycoprotein ligand 1 [3 , 4 ] and vascular cell adhesion molecule–very late activation antigen 4 interactions [5 , 6 ], and the subsequent firm adhesion is mediated by CD18–intercellular adhesion molecule 1 interactions [7 , 8 ]. Transmigration of eosinophils across endothelium in culture has been shown to affect subsequent eosinophil function [9 ], and in vitro cross-linking of the CD18 integrin has been shown to activate eosinophils, resulting in degranulation [eosinophil peroxidase (EPO) and eosinophil-derived neurotoxin], cysteinyl leukotriene (cys-LT) release, and superoxide generation [10 11 12 ]. Mediator release and degranulation can also be triggered by chemokines in conjunction with an interleukin (IL)-5 priming step [13 , 14 ]. IL-5 is a key cytokine involved in regulating eosinophils [15 ] and is often used to prime eosinophils in vitro before exposure to a main stimuli resulting in, e.g., chemotaxis or degranulation [16 17 18 ].

Protease-activated receptors (PARs) are a novel family of G-protein-coupled receptors that are activated upon cleavage of the N terminus of the receptor by proteases. This cleavage exposes a previously cryptic, tethered ligand, which then binds intramolecularly to the second extracellular loop to activate the associated G-protein (reviewed in refs. [19 , 20 ]). To date, four PARs have been identified that are typically activated by thrombin (PAR1, -3, and -4) or trypsin (PAR2 and -4). PARs are expressed on a variety of cells including platelets, endothelial and epithelial cells, neutrophils, and mononuclear cells and can elicit various responses including platelet aggregation, chemotaxis, cell proliferation, and raising intracellular calcium (reviewed in refs. [21 22 23 ]).

PARs are expressed on platelets and are known to be involved in key processes during haemostasis, but they also appear to play an additional, non-haemostasis role in other cell types such as epithelium and some leukocytes, and evidence is beginning to accumulate for a role for PARs in airway disease. PARs have been shown to exhibit pro-inflammatory properties [24 25 26 27 ] that appear to be mediated by an ability to promote selectin-mediated leukocyte adhesion during inflammation [24 , 25 ]. The data from a PAR2 knockout mouse and a mouse over-expressing PAR2 [26 ] have provided particularly compelling evidence that PARs contribute to allergic airway inflammation in mice. In humans, it has been shown recently that the PARs are expressed in airway tissue in vivo [28 29 30 ] and in vitro [31 ], and an airway-associated protease, mast cell tryptase, is known to activate PAR2 [32 ]. There is now convincing evidence for a role for PARs in the asthmatic airway, as ligands and receptors are located in the general milieu of inflammatory and traumatized airway. Furthermore, the observation that PARs are involved in selectin-mediated adhesion suggests an involvement with eosinophils. We were therefore interested to know whether eosinophils, a key cell type in airway disease, expressed PARs and whether activation of the PARS could affect eosinophil function. We have shown the presence of PAR1 and -2 on human eosinophils, but there was no difference between normal and asthmatic donors. Activation of PARs induced shape change, generation of reactive oxygen species (ROS), and to a lesser extent, the release of cys-LT. This study and another one recently published [33 ] demonstrate that PARs are present and functional on eosinophils, giving rise to the possibility that they may play a role in asthma pathology.


arrow
MATERIALS AND METHODS
 
Anti-PAR antibodies
Mouse monoclonal antibodies (mAb) to the N-terminal of PAR1 [ATAP2, mouse immunoglobulin G1 (IgG1)] and PAR2 (SAM11, mouse IgG2a) and goat polyclonal antibodies (pAb) directed against the C terminus of each of the PARs were purchased from Santa Cruz (Autogen Bioclear, Wiltshire, UK). Peptides used to generate the pAb were also purchased from Santa Cruz and used at a ratio of 5:1 (peptide:pAb) to eliminate Western blotting staining. The mAb were suitable for fluorescein-activated cell sorter (FACS) analysis but not Western blotting [personal communication with Dr. S. J. Compton (University of Hull, UK; ATAP2) and Dr. C. R. A. Hewitt (SAM11)], and the pAb are suitable for Western blotting but not FACS (S. J. Bolton, unpublished observations).

PAR ligands and agonist peptides
Thrombin was purchased from Enzyme Research Laboratories (Cardiff, UK). Trypsin (Cat. No. T1005, chymotrypsin-depleted) was purchased from Sigma (Dorset, UK). Peptides corresponding to the tethered ligand of PAR1, -2, and -4 were synthesized in C-terminal amide form and purified by high-pressure liquid chromatography using standard techniques by the Protein and Nucleic Acid Chemistry Laboratory (PNACL; University of Leicester, UK; PAR1–4). Scrambled control peptides for PAR1 and -2 (SC1 and SC2, respectively) were synthesized at the University of Southampton (UK). Sequences were as follows: PAR1, SFLLRN; PAR2, SLIGKVD; PAR4, GYPGQV; SC1, FSLLRN; SC2, LSIGKV.

Polymerase chain reaction (PCR) primers
PCR primers were designed using PrimerEdit software and were subject to BLAST analysis to confirm their specificity for human PAR1–4. Primers were as follows: PAR1 forward primer: 492 cggcagtgattggcagtttg 511; PAR1 reverse primer: 791 tcgagcagggtttcattgagc 771; expected product size: 300 bp. PAR2 forward primer: 125 ttgatggcacatccgacgtc 144; PAR2 reverse primer: 523 aatacctctgcacactgaggcag 501; expected product size: 399 bp. PAR3 forward primer: 1 atgaaagccctcatctttgcag 22; PAR3 reverse primer: 372 tctggtcctgaagaaaagcatcc 350; expected product size: 372 bp. PAR4 forward primer: 106 gatgacagcacgccctcaatc126; PAR4 reverse primer: 348 catcagcagcatggtggagg 329; expected product size: 242 bp.

Isolation of eosinophils and other leukocytes
Peripheral venous blood was taken from normal, healthy volunteers showing mild or no atopic symptoms. Asthmatic subjects with an elevated eosinophil count (>0.5x109/L) were chosen from patients attending routine respiratory clinics at the Glenfield Hospital (Leicester, UK). The asthmatic group would be defined as having a suggestive improvement in forced expiratory volume in 1 s, 10 min after 200 µg inhaled salbutamol or methacholine airway hyper-responsiveness (PC20>8 ng/ml). Eosinophil purification was as described previously [3 ] by density gradient centrifugation and negative immunomagnetic selection using the magnetic cell sorter system with anti-CD16-conjugated beads (Miltenyi Biotec, Bergisch Gladbach, Germany). Neutrophils were isolated from nonatopic volunteers by density gradient centrifugation. Purity of both cells types was determined by Kimura staining and was >95%. Where mixed granulocyte populations were used, the blood was processed as for neutrophil isolation, and the percent eosinophils was determined. Peripheral blood mononuclear cells were recovered from the buffy coat obtained during eosinophil or neutrophil isolation following a macrophage-depletion step by incubating on tissue-culture plastic for 30 min.

Human umbilical vein endothelial cell (HUVEC) isolation
HUVECs were isolated from human umbilical cords adapted from Jaffe et al. [34 ] and were used at passage 1. Cells were cultured on fibronection-coated dishes until confluence and detached using a 1-mM EDTA/5-mM EGTA solution.

Reverse transcriptase (RT)-PCR
Total RNA was isolated using RNeasy mini-spin columns (Qiagen, West Sussex, UK) according to the maunfacturer’s instructions. DNA contamination was removed using DNase I (Invitrogen, Paisley, Scotland), and RT reactions using the Sensiscript RT kit (Qiagen) were carried out according to the manufacturer’s instructions using 50 ng RNA and random hexamers (Invitrogen) as primers. Controls where the RT enzyme was omitted were also included. One-tenth of the RT reaction was then added to a PCR reaction using Taq MasterMix (Qiagen). Half of the PCR reaction was then subject to agarose gel electrophoresis and was stained with ethidium bromide.

Flow cytometry
Isolated leukocytes were stained fresh for detection of surface expression of PARs or fixed in 4% paraformaldehyde and permeabilized in 0.1% saponin for detection of surface and intracellular PARs. Cells (2.5–5x105) were incubated with anti-PAR mAb at 20 µg/ml. Bound antibody was detected using a biotinylated anti-mouse antibody (Dako, Cambridgeshire, UK; both 20 µg/ml) followed by R-phycoerythrin (RPE) streptavidin (Dako; 30 µg/ml). Platelet contamination was assessed using a RPE-conjugated anti-CD41 antibody (Serotec, Oxfordshire, UK). Where mixed granulocyte populations were used, the eosinophils were distinguished using an anti-CD9 antibody (Serotec).

Western blotting and immunoprecipitation
Cells were lysed in radio immunoprecipitation assay (RIPA) buffer containing protease inhibitors and were homogenized, and the debris was pelleted. For Western blotting, lysates were diluted 1:2 in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)-loading buffer (Sigma), and 0.5 x 106 cells/lane were subject to SDS-PAGE (10% gel) and electroblotted to nitrocellulose (APBiotec, Hertfordshire, UK) according to standard protocols. Filters were blocked in 5% milk powder before being incubated in primary pAb antibody (anti-PAR1 and -3, 2 µg/ml; anti-PAR2 and -4, 0.4 µg/ml). Bound antibody was detected with horseradish peroxidase anti-goat antibody (Dako; 0.25 µg/ml) and enhanced chemiluminescence (ECL) reagents (Amersham, Little Chalfont, UK). Filters were exposed to blue X-ray film for an average of 30 s. For immunoprecipitation, goat IgG-cleared cell lysates were incubated with anti-PAR4 pAb followed by Protein AG-agarose. Immune-complexed beads were subject to SDS-PAGE and electroblotted to polyvinylidene difluoride membrane, and two bands of ~40 and 80 kDa were identified. Sequencing was performed by PNACL (University of Leicester) using standard techniques.

Intracellular calcium release
Purified eosinophils were resuspended at 5 x 106/ml in Krebs buffer [120 mM NaCl, 4.8 mM KCl, 1.2 mM KH2PO4, 1.2 mM MgSO4, 1.3 mM CaCl2, 25 mM HEPES, 0.1% bovine serum albumin (BSA), 10 mM glucose]. Fura 2 AM(Sigma) was added to a final concentration of 2 µM, and the cells were incubated at 37°C for 1 h. The cells were then washed and resuspended in fresh Krebs buffer at 5 x 105/ml and kept at 37°C. Cell suspension (2 ml) was placed in a spectrophotometer (luminescence spectrophotometer LS50B, Perkin Elmer Life Sciences, Cambridge, UK), and a baseline reading at 340 and 380 nm was obtained. Readings were taken every second at a temperature of 37°C. Agonists were added, and the reading continued for a further 300–500 s. Data are expressed as the 340/380 ratio.

Gated autofluorescence/forward scatter (FSc; GAFS) assay
The GAFS assay was performed as described by Sabroe et al. [35 ]. Briefly, mixed granulocyte populations were incubated in assay buffer [phosphate-buffered saline with 0.9 mM calcium, 0.5 mM magnesium (Invitrogen), 10 mM HEPES (Invitrogen), 0.1% BSA, 10 mM glucose] at room temperature for 30 min, pelleted, and resuspended in fresh buffer at 5.5 x 106/ml. After a further 5 min at room temperature, 5 x 105 cells were stimulated with agonists [100 nM platelet-activating factor (PAF; Bachem UK, Merseyside), 30 nM eotaxin (PeproTech EC Ltd., London, UK), 500 nM thrombin, 1–0.1 µM trypsin, and 1–0.1 mM PAR peptides] at 37°C for 5 and 30 min. Cells were fixed in 1% paraformaldehyde (Cytofix, Becton Dickinson, San Jose, CA) and kept on iced water until analyzed by FACScan. Eosinophils were easily distinguished from neutrophils by their autofluorescence under high FL2 conditions. Preliminary experiments using mouse mAb against CD9 (Serotec) and CCR3 (a generous gift from Millenium Pharmaceuticals, Cambridge, MA) confirmed that the autofluorescent population was indeed eosinophils (data not shown).

Degranulation and measurement of cys-LT release
Purified eosinophils were resuspended at 8 x 106/ml in assay buffer (see above). Where indicated, cells were stimulated with 5 ng/ml recombinant human IL-5 (R&D Systems, Minneapolis, MN) for 30 min at 37°C. Cells (4 x 105/50 µl) were then added to a 96-well plate (Falcon Probind, Becton Dickinson) coated with 30 µg/ml human IgG (Sigma), blocked in 2.5% human serum albumin (HSA; First Link Ltd., West Midlands, UK), and incubated at 37°C for 10 min. Equal volumes of agonists (50 µl 2x concentrate, 500 nM thrombin, 1–0.1 µM trypsin, 1–0.1 mM PAR peptides, and 1:20 IgG-sepharose beads) were added to the cells, and the plate returned to the incubator for 60 min. Each agonist was assayed in triplicate. The plate was centrifuged at 600 g for 10 min, 4°C, and 50 µl aliquots of supernatant (equivalent to 2 x 105 cells) were stored at - 80°C. cys-LT were measured using a commercially available enzyme immunoassay (EIA) from Cayman Chemicals (Alexis Corporation, Nottinghamshire, UK), which detects 100% of LTC4 and LTD4, and results were expressed as pg/ml/106 cells.

Measurement of ROS generation by chemiluminescence
Eosinophils were resuspended at 1 x 106/ml in assay buffer (see above) containing 50 µM lucigenin. Cells (2x105) were added to wells of a 96-well plate (Nunclon TC plate, Nalge Nunc International, Rochester, NY; blocked with 2.5% HSA), and baseline readings at 37°C were obtained for 10 min. Agonists (1 µM PAF, 500 nM thrombin, 1–0.1 µM trypsin, and 1–0.1 mM PAR peptides) were added to cells, and readings were taken every 2–3 min for up to 90 min. Each agonist was assayed in duplicate. The Wallac Victor2 platereader (Perkin Elmer Life Sciences) was used as a luminometer, and the results are expressed as arbitrary units versus time.

Statistical analysis
Data are shown as mean ± SEM, and paired t-tests were performed using GraphPad Prism version 3.00 (GraphPad Software, San Diego, CA).


arrow
RESULTS
 
Eosinophils express RNA for PAR1 and -2
We used a RT-PCR approach to determine which of the PARs human eosinophils express. Eosinophils (Fig. 1A ) were shown to express only PAR1 and -2. To determine the specificity of our PCR primers, RT-PCR was initially performed on neutrophils, mononuclear cells, and HUVECs, as their individual PAR profile has been previously investigated [19 , 22 , 36 37 38 ]. Figure 1 shows that as expected, neutrophils expressed only PAR2 (Fig. 1B) , mononuclear cells expressed PAR1, -2, and -4 (Fig. 1C) , and HUVECS expressed PAR1, -2, and -3 (Fig. 1D) . PCR reactions for all cell types were positive for ß-actin, and reactions where the RT enzyme was omitted did not generate any PCR products, indicating that bands seen were not a result of genomic DNA contamination (data not shown). The PCR products for PAR1 and -2 from two separate donors were directly sequenced and subject to BLAST analysis, which confirmed they were PAR1 and -2 (data not shown).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 1. RT-PCR analysis of human leukocytes and endothelial cells for PAR RNA expression. Total RNA was extracted from human eosinophils (A), neutrophils (B), mononuclear cells (C), or endothelial cells (HUVECs; D) and was subject to RT-PCR using random hexamer primers for the RT step and PAR-specific primers for the PCR step. PCR products were analyzed by agarose gel electrophoresis and compared with a 100-bp ladder (left lane). Expected product sizes were: PAR1, 300 bp; PAR2, 399 bp; PAR3, 372 bp; PAR4, 242 bp. Figure is a representative example of five different donors.

Western blot analysis of PAR expression in human
Eosinophils (Fig. 2A ) and mononuclear cells (Fig. 2B) were analyzed by Western blotting using goat pAb against PAR1–4. The predicted MW for PARs is ~55 kDa, but bands with an apparent higher MW may be seen as a result of differential glycosylation. PAR1 (80 kDa), PAR2 (55 kDa), and PAR4 (80 and 40 kDa) were detected in eosinophils (Fig. 2A) and the positive control, mononuclear cells, as expected (Fig. 2B) . In eosinophils (Fig. 2A) , PAR1 was detected as a single band of approximately 80 kDa, but this was seen in only 50% of the donors (three out of six). The PAR1 peptide was not effective at eliminating this band when incubated with the antibody before incubation (data not shown). PAR2 was detected as a single band of ~55 kDa in all donors, and this band could be eliminated from the blot by prior incubation of the pAb with the relevant PAR2 peptide. No bands were detected with the PAR3 antibody, despite a band being seen in HUVEC lysates (data not shown). Surprisingly, PAR4 was detected in eosinophils from all donors, despite the lack of apparent RNA expression. PAR4 was detected as a doublet of ~40 and 80 kDa, the same as in the mononuclear cells. The appearance of both of these bands in eosinophils (data not shown) or mononuclear cells (Fig. 2B) could be eliminated by prior incubation of the pAb with the PAR4 peptide used to generate the pAb. Bands were occasionally seen following incubation with the goat IgG (GtIgG) control antibody, but these did not match any of the bands detected with the PAR pAb. Also, incubation of the goat IgG with the PAR2 or PAR4 peptide did not eliminate these nonspecific bands (data not shown). Immunoprecipitation of eosinophils with the PAR4 pAb pulled down two proteins with the appropriate MW seen previously on Western blots. The 80–85 kDa band was not able to be sequenced as a result of N-terminal blocking. However, we were able to get some sequence (seven amino acids) from the lower band, which following BLAST analysis, did not appear to be related to PAR4.



View larger version (79K):
[in this window]
[in a new window]
 
Figure 2. Western blot analysis of human leukocytes for PAR protein expression. Purified human eosinophils (A) or mononuclear cells (B) were lysed into RIPA buffer separated by SDS-PAGE and transferred to nitrocellulose. Filters were probed with pAb to each of the PARs and were detected using ECL. In some experiments, the antibody was incubated with a fivefold excess of the peptide, which was used to generate the pAb. Molecular weights (MW) in kDa are shown at the left of each blot. Blots are representative examples of eosinophils, n = 5 donors; mononuclear cells, n = 3; peptide blots, n = 3 each. GtIgG, goat IgG.

Flow cytometry analysis of eosinophils for PARs
Purified eosinophils were immunostained with anti-PAR mAb, and typical representative FACS histogram plots (n=4) of anti-PAR mAb (solid line) compared with the appropriate isotype-control antibodies (dotted line) are shown in Figure 3 . Surface-only (unfixed, Fig. 3A and 3C ) and surface and intracellular expression (fixed and permeabilized, Fig. 3B and 3D ) were examined. PAR1 (ATAP2 mAb, Fig. 3A and 3B ) was detected on fixed and fixed and permeabilized cells. However, PAR2 (SAM11, Fig. 3C and 3D ) could only be detected intracellularly. Incubation of eosinophils with an anti-CD41 antibody demonstrated that the eosinophil preparations were free of contaminating platelets (data not shown).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 3. Flow cytometry of human eosinophils for PAR1 and PAR2. Purified human eosinophils were stained with mAb to PAR1 (ATAP2, A and B) or PAR2 (SAM11, C and D). Cells were unfixed to study surface-only expression (A and C) or fixed and permeabilized to look at surface and intracellular levels (B and D). mAb are shown by the solid line, and appropriate isotype controls are represented by the dotted lines. (A–D) Representative example of four independent experiments. The levels of PAR1 and PAR2 in purified eosinophils or mixed granulocyte population following fixation and permeabilization were measured in control and asthmatic donors (each group, n=4). (E) The results are shown as a ratio of the mean fluorescence intensity (MFI) of PAR mAb:isotype control.

Expression of PAR1 and -2 in normal and asthmatic donors
Eosinophils (purified or in a mixed granulocyte population identified using anti-CD9 antibody) were fixed, permeabilized, and stained using ATAP2 or SAM11. The ratio of the MFI of the mouse IgG control to PAR mAb was determined, and the results are shown in Figure 3E . The levels of PAR1 were lower than PAR2, but there was no difference between normal donors (n=7) and asthmatic donors (n=4).

PAR1 agonist peptide causes an increase in cytosolic calcium
Addition of PAF to Fura 2-loaded eosinophils resulted in a transient increase in intracellular calcium (Fig. 4A ), and this was used as a positive control in all calcium experiments (n=6). Thrombin (0.5–5 µM) and trypsin (0.1–1 µM) were ineffective in raising intracellular calcium (data not shown). However, the PAR1 agonist peptide (0.1 mM) did produce a rise in intracellular calcium, and a typical trace (n=5) is shown in Figure 4B . Agonist peptides for PAR2 and -4 did not have any effect in this assay. Where there was no effect with the agonist, PAF was added to ensure that the cells were responsive, and an increase in the 340/380 ratio was seen (data not shown).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 4. Increases in intracellular calcium in response to PAR1. Purified human eosinophils were loaded with Fura 2 AM in Krebs buffer, and the increases in intracellular calcium in response to various agonists were measured in a spectrophotometer. The results are presented as a ratio of the readings at 340 and 380 nm. PAF was used as a positive control and consistently raised calcium levels (A). PAR1 also raised levels of intracellular calcium (B). The traces are representative examples of six (PAF) or five (PAR1) independent experiments.

Activation of PARs induces eosinophil and neutrophil shape change
We used the GAFS assay to measure the effect on shape change of thrombin, trypsin, or agonist peptides for PAR1, -2, and -4 on mixed populations of eosinophils and neutrophils. The data shown in Figure 5G and 5H , was gathered from normal and asthmatic donors. There was no difference between the two groups, so the data have been pooled together. Eosinophils were defined by gating the autofluorescence population on the FL2 channel (Fig. 5A , R1=eosinophils; R2=neutrophils), and the resting mean FSc for each population was measured (Fig. 5B 5C 5D) . Data in Figure 5G and 5H , are shown as a percent increase in the mean FSc compared with the resting (buffer only) controls (100%). Eotaxin (30 nM) was used to stimulate shape change in eosinophils but not neutrophils (Fig. 5B) , and PAF was used as a positive control for eosinophils (Fig. 5B and 5E) and neutrophils (Fig. 5B and 5F) and induced a significant increase in FSc in both cell types (Fig. 5G and 5H) . The effect of PAR activation on eosinophils is summarized in Figure 5G .



View larger version (36K):
[in this window]
[in a new window]
 
Figure 5. GAFS assay to measure shape change in response to PAR agonists in eosinophils (Eos) and neutrophils (Neuts). The GAFS assay was used to assess shape change by measuring increases in FSc of a mixed population of eosinophils and neutrophils using flow cytometry. The eosinophil population (R1) is distinguished from the neutrophils (R2) by their autofluorescent properties on the FL2 channel (A). Resting eosinophils and neutrophils (C and D) showed an increase in mean FSc when stimulated with PAF (E, P<0.001; F, P<0.001). (B) The mean FSc of resting and stimulated cells from a typical experiment is shown. Eotaxin was also used as a control to increase the mean FSc in eosinophils only. (G and H) The results shown are expressed as the percent increase in FSc induced by each agonist compared with buffer-stimulated cells after 5 and 30 min incubation (n=6). Eosinophils (G) responded to the PAR1 peptide at both time points (5 min, P=0.004; 30 min, P=0.010) but not to thrombin. Activation via trypsin or PAR2 peptide (P=0.008) was only seen after 30 min. Neutrophils (H) responded to trypsin after 30 min (P=0.033) and at 5 and 30 min with peptides to PAR1 (5 min, P=0.023; 30 min, P=0.009) and PAR2 (5 min, P=0.021; 30 min, P=0.001). PAR4 was considered ineffective in this assay in either cell type.

Thrombin (500 nM) had no effect on eosinophils, but the PAR1 peptide (1 mM) induced significant increases in mean FSc at 5 and 30 min. Trypsin (1 µM) and the PAR2 peptide (1 mM) increased mean FSc but only after 30 min, and this increase was only significant for the PAR2 peptide. The PAR4 peptide (1 mM) did not induce shape change in eosinophils. Neutrophils also showed shape change in response to PAR activation (Fig. 5H) , and they showed a significant increase in mean FSc with trypsin after 30 min but not 5 min. There was no response to thrombin, as expected, as neutrophils do not express the PAR1 receptor. The PAR1 and PAR2 peptide induced significant change in mean FSc in neutrophils at both time points.

Activation of PARs induces cys-LT release
Purified eosinophils were primed with IL-5 (5 ng/ml) and then stimulated with thrombin (500 nM), trypsin (0.1 µM), or agonist peptides to PAR1 and -2 (0.1 mM). Cells not primed with IL-5 did not induce any cys-LT release (data not shown). IgG-coupled sepharose beads were used as a positive control, and they induced release of over 4 ng/ml cys-LT/million cells (data not shown). The results were variable between donors, and only the PAR2 agonist peptide caused any significant release of cys-LT compared with medium alone (Fig. 6 ).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 6. Release of cys-LT from human eosinophils in response to PAR activation. Purified human eosinophils were primed with 5 ng/ml IL-5 and treated with PAR agonists for 60 min. Cell-free supernatants were assayed for cys-LT using a commercially available EIA (n=4–7). Release of cys-LT was very donor-variable, and only PAR2 peptide stimulated significant release compared with assay buffer alone (P=0.0189). As a positive control, eosinophils were treated with IgG-coupled sepharose beads, and release of over 4 ng/ml cys-LT was detected (data not shown).

Activation of PARs induces ROS generation in eosinophils
Eosinophils were stimulated with endogenous ligands and agonist peptides, and the generation of ROS was measured by chemiluminescence. PAF was used as a positive control and was able to stimulate ROS generation (Fig. 7A ). Compared with the buffer, thrombin (500 nM) had no effect, but trypsin (1 µM) was able to stimulate ROS generation at comparable levels to PAF (Fig. 7A) . As was seen in the shape change assay (Fig. 5) , activation was only observed after at least 30 min incubation. The PAR2 agonist peptide (0.5 mM) was also able to induce ROS (Fig. 7B) . The control PAR2 peptide (0.5 mM) induced significantly less ROS compared with the active peptide (Fig. 7B) , although it did induce some ROS generation compared with buffer alone. ROS generation to the PAR1-active and -scrambled peptides was variable, but as there was no response to thrombin, the data are not shown.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 7. Generation of ROS in human eosinophils in response to PAR activation. Eosinophils were resuspended in assay buffer containing lucigenin and stimulated with PAR ligands and peptides. ROS generation was measured by chemiluminescence, and 1 µM PAF was used as a positive control (P=0.0041). Thrombin was inactive, whereas trypsin (P=0.0062) or the PAR2 peptide (P=0.0107) induced significant ROS generation. The PAR2 control peptide also stimulated some ROS generation, but this was significantly reduced compared with the active peptide (P=0.0175).


arrow
DISCUSSION
 
Eosinophils express PAR RNA
Using RT-PCR, we have demonstrated that eosinophils express PAR1 and -2. We validated our PCR primers by examining the expression on HUVECs (PAR1–3), neutrophils (PAR2 only), and mononuclear cells (PAR1, -2, and -4), and our results were in agreement with previously published reports [22 , 36 37 38 ]. However, Kahn et al. [37 ] also demonstrated expression of PAR1 and -3 on neutrophils and PAR3 on mononuclear cells, but the levels were very low compared with the other PARs present, and their RT-PCR strategy used PAR-specific primers for the RT step, increasing the sensitivity. Using the same PCR primers used by Kahn et al. [37 ], the only other report demonstrated, of PAR expression on eosinophils, suggested that eosinophils expressed PAR2 and -3 but not PAR1 [33 ]. The reasons for this discrepancy between our results and those of Miike et al. [33 ] are not known.

Eosinophils express PAR1 and -2 proteins
We also looked for expression of PAR protein in eosinophils using commercially available PAR antibodies. We used mAb to PAR1 and -2 (ATAP2 and SAM11), which have been widely documented within the PAR field, as well as some pAb to all four PARs. Western blotting with the PAR pAb demonstrated that like the RT-PCR, eosinophils express PAR1 and -2. PARs have a predicted MW of approximately 55 kDa, and increases in the apparent MW to approximately 80 kDa are attributed to post-translational glycosylation [39 , 40 ]. Detection of PAR1 with the pAb was somewhat donor-variable but could be detected as a single band of ~80 kDa. We have assumed this variability to be a result of the pAb, as PAR1 was detected in all donors using RT-PCR (n=5) and flow cytometry with mAb ATAP2 (n=11). In contrast, PAR2 was seen in all donors as a single band with the appropriate MW of ~55 kDa, indicating little post-translation glycosylation. The apparent detection of PAR4 in eosinophils was unexpected but initially convincing, as the two bands were identical to those seen in mononuclear cells, which are known to express PAR4. Additionally, the bands could be eliminated by prior incubation of the pAb with the peptide used to generate the pAb. This observation could not be explained by the possibility of platelet contamination, as flow cytometry staining with an antiplatelet antibody was negative. However, subsequent sequencing of the smaller band did not reveal any homology to PAR4, which caused us to question the specificity of the pAb. However, the larger band could not be sequenced, as it was N-terminally blocked, and this band, which is similar in size to PAR1, could be PAR4. The possibility that there is an eosinophil-specific PAR4 still remains but does require significant further investigation.

The mouse mAb ATAP2 and SAM11 [36 , 41 ] were used for standard flow cytometry, and we were able to detect PAR1 before and after permeabilization, indicating that this PAR is present on the cell surface and possibly intracellularly too. PAR2 could only be detected following permeabilization, suggesting a predominantly intracellular localization. It has also been reported that the PAR1 antibody, WEDE15, stained eosinophils in human bronchial biopsies [29 ], providing further evidence that despite the Miike report [33 ], eosinophils do express PAR1. We have also found WEDE15 to stain eosinophils when used for flow cytometry (S. J. Bolton, unpublished observations). It was intriguing to find a lack of PAR2 on the surface of eosinophils, despite the ability of the SAM11 antibody to recognize surface PAR2 [36 ] on endothelial cells.

In the context of PARs and airway inflammation, a study by Knight et al. [29 ] demonstrated that PAR2 was up-regulated on epithelium in the asthmatic airway, but the authors did not document any increased leukocyte staining. Unfortunately, in our study, there did not appear to be any difference in the levels of PAR expression in control subjects compared with asthmatics subjects. This is the first time that a comparison has been made of PAR expression between control and asthmatic individuals, and it will be of interest to extend the study to include other pulmonary diseases such as severe asthma or eosinophilic pneumonia.

PARs and eosinophil activation
In our hands, PAR-mediated activation of eosinophils was difficult to detect, and assays for EPO and ß-hexosaminidase after PAR stimulation gave generally negative results (S. J. Bolton, unpublished observations). Although we have shown the presence of PAR1 on the surface of eosinophils, we have not been able to detect a response with thrombin in any assay. The thrombin was active and was capable of stimulating platelets to bind fluorescein isothiocyanate-conjugated fibrinogen when assessed by flow cytometry (data not shown). By contrast, the PAR1 agonist peptide appeared to be functional and could trigger rises in intracellular calcium as well as shape change but not mediator release. This ability of the PAR1 peptide but not thrombin to stimulate eosinophils was also the experience of Miike et al. [33 ] and is presumably a result of the dual activity of the SFLLRN peptide, which can stimulate PAR1 and PAR2 [42 43 44 ]. This lack of specificity of the PAR1 peptide explains why we were able to show that the PAR1 peptide can activate neutrophils, which only express PAR2. Similarly, the control peptides may also have some degree of activity but with much reduced potency compared with the endogenous ligand (Fig. 7 and ref. [45 ]). The possibility that PAR1 is involved in other aspects of eosinophil function, e.g., recruitment to sites of inflammation, requires further investigation.

Our data with trypsin and the PAR2 peptide suggest that it may not be involved in immediate responses (such as raising intracellular calcium) but was more effective over a period of time, as there was a significant response in the ROS assay after 30 min and in the GAFS assay at 30 min but not 5 min. In support of this, Miike et al. [33 ] demonstrated that superoxide generation in response to trypsin and PAR2 peptide was low at 15 min but increased rapidly by 30–60 min. Our data suggest that PAR2 is present at undetectable levels on the cell surface and that once these few receptors become activated, PAR2 is redistributed from intracellular stores to the surface of the cell. It is intriguing to speculate on the identity of this exogenous stimulus, e.g., cytokines from recruited lymphocytes or other proteases, such as mast cell tryptase, which could be provided by the microenvironment of the asthmatic airway.

It has been demonstrated that thrombin and trypsin-like enzymes are chemotactic for leukocytes [46 , 47 ], and a role for PARs in other areas of eosinophil biology, e.g., adhesion and recruitment to inflamed airways, represents interesting avenues for future investigation. It is clear that PARs are expressed on eosinophils, and there is increasing evidence that PARs play a role in airway disease. However, further clarification of the exact expression and function of PARs on eosinophils and their contribution to airway disease pathology is needed.


arrow
ACKNOWLEDGEMENTS
 
The National Asthma Campaign funded this work. We thank Dr. Chris Jones for help with the platelet activation, Dr. Ken Young for his help with the calcium experiments, and Dr. Adele Hartnell for help with the GAFS assay.

Received July 9, 2002; revised March 12, 2003; accepted March 21, 2003.


arrow
REFERENCES
 
    1
  1. Wardlaw, A. J., Brightling, C., Green, R., Woltmann, G., Pavord, I. (2000) Eosinophils in asthma and other allergic diseases Br. Med. Bull. 56,985-1003[Abstract/Free Full Text]
  2. 2
  3. Wardlaw, A. J. (1999) Molecular basis for the selective eosinophil trafficking in asthma: a multistep paradigm J. Allergy Clin. Immunol. 104,917-926[CrossRef][Medline]
  4. 3
  5. Symon, F. A., Walsh, G. M., Watson, S. R., Wardlaw, A. J. (1994) Eosinophil adhesion to nasal polyp endothelium is P-selectin-dependent J. Exp. Med. 180,371-376[Abstract/Free Full Text]
  6. 4
  7. Symon, F. A., Lawrence, M. B., Williamson, M. L., Walsh, G. M., Watson, S. R., Wardlaw, A. J. (1996) Functional and structural characterization of the eosinophil P-selectin ligand J. Immunol. 157,1711-1719[Abstract]
  8. 5
  9. Dobrina, A., Menegazzi, R., Carlos, T. M., Nardon, E., Cramer, R., Zacchi, T., Harlan, J. M., Patriarca, P. (1991) Mechanisms of eosinophil adherence to cultured vascular endothlial cells. Eosinophils bind to the cytokine-induced ligand vascular cell adhesion molecule-1 via the very late activation antigen-4 integrin receptor J. Clin. Invest. 88,20-26
  10. 6
  11. Walsh, G. M., Mermodd, J., Hartnell, A., Kay, A., Wardlaw, A. J. (1991) Human eosinophil, but not neutrophil, adherence to IL-1-stimulated human umbilical vascular endothelial cells is alpha 4 beta 1 (very late antigen-4) dependent J. Immunol. 146,3419-3423[Abstract]
  12. 7
  13. Broide, D. H., Sullivan, S., Gifford, T., Sriramarao, P. (1998) Inhibition of pulmonary eosinophilia in P-selectin- and ICAM-1-deficient mice Am. J. Respir. Cell Mol. Biol. 18,218-225[Abstract/Free Full Text]
  14. 8
  15. McNulty, C. A., Symon, F. A., Wardlaw, A. J. (1999) Characterization of the integrin and activation steps mediating human eosinophil and neutrophil adhesion to chronically inflamed airway endothelium Am. J. Respir. Cell Mol. Biol. 20,1251-1259[Abstract/Free Full Text]
  16. 9
  17. Yamamoto, H., Sedgwick, J. B., Vrtis, R. F., Busse, W. W. (2000) The effect of transendothelial migration on eosinophil function Am. J. Respir. Cell Mol. Biol. 23,379-388[Abstract/Free Full Text]
  18. 10
  19. Kaneko, M., Horie, S., Kato, M., Gleich, G. J., Kita, H. (1995) A crucial role for b2 integrin in the activation of eosinophils stimulated by IgG J. Immunol. 155,2631-2641[Abstract]
  20. 11
  21. Kato, M., Abraham, R. T., Okada, S., Kita, H. (1998) Ligation of the b2 integrin triggers activation and degranulation of human eosinophils Am. J. Respir. Cell Mol. Biol. 18,675-686[Abstract/Free Full Text]
  22. 12
  23. Munoz, N. M., Hamann, K. J., Rabe, K. F., Sano, H., Zhu, X., Leff, A. R. (1999) Augmentation of eosinophil degranulation and LTC4 secretion by integrin-mediated endothelial cell adhesion Am. J. Physiol. 277,L802-L810
  24. 13
  25. Bates, M. E., Green, V. L., Bertics, P. J. (2000) ERK1 and ERK2 activation by chemotactic factors in human eosinophils is interleukin 5-dependent and contributes to leukotriene C4 biosynthesis J. Biol. Chem. 275,10968-10975[Abstract/Free Full Text]
  26. 14
  27. Takao, F., Kato, Y., Nagase, H., Atsuta, J., Terada, A., Iguchi, K., Kamiya, H., Morita, Y., Kitaura, M., Kawasaki, H., Yoshie, O., Hirai, K. (2000) Chemokines induce eosinophil degranulation through CCR-3 J. Allergy Clin. Immunol. 106,507-513[CrossRef][Medline]
  28. 15
  29. Greenfeder, S., Umland, S. P., Cuss, F. M., Chapman, R. W., Egan, R. W. (2001) Th2 cytokines and asthma. The role of interleukin-5 in allergic eosinophilic disease Respir. Res. 2,71-79[CrossRef][Medline]
  30. 16
  31. van Oosterhout, A. J. M., van der Poel, A., Koenderman, L., Roos, D., Nijkamp, F. P. (1994) Interleukin-5 potentiates sulfidopeptide leukotriene production by human eosinophils Mediat. Inflamm. 3,53-55
  32. 17
  33. Sehmi, R., Wardlaw, A. J., Cromwell, O., Kurihara, K., Waltmann, P., Kay, A. (1992) Interleukin-5 selectively enhances the chemotactic response of eosinophils obtained from normal but not eosinophilic subjects Blood 79,2952-2959[Abstract/Free Full Text]
  34. 18
  35. Ebisawa, M., Yamada, T., Bickel, C., Klunk, D., Schleimer, R. P. (1994) Eosinophil transendothelial migration induced by cytokines III. Effect of the chemokine RANTES J. Immunol. 153,2153-2160[Abstract]
  36. 19
  37. MacFarlane, S. R., Seatter, M. J., Kanke, T., Hunter, G. D., Plevin, R. (2001) Protease-activated receptors Pharmacol. Rev. 53,245-282[Abstract/Free Full Text]
  38. 20
  39. Coughlin, S. R. (2000) Thrombin signalling and protease-activated receptors Nature 407,258-264[CrossRef][Medline]
  40. 21
  41. Brass, L. F., Molino, M. (1997) Protease-activated G protein-coupled receptors on human platelets and endothelial cells Thromb. Haemost. 78,234-241[Medline]
  42. 22
  43. Hou, L., Howells, G. L., Kapas, S., Macey, M. G. (1998) The protease-activated receptors and their cellular expression and function in blood-related cells Br. J. Haematol. 101,1-9
  44. 23
  45. Cocks, T. M., Moffatt, J. D. (2000) Protease-activated receptors: sentries for inflammation Trends Pharmacol. Sci. 21,103-108[CrossRef][Medline]
  46. 24
  47. Vergnolle, N. (1999) Proteinase-activated receptor-1-activating peptides induce leukocyte rolling, adhesion and extravasation in vivo J. Immunol. 163,5064-5069[Abstract/Free Full Text]
  48. 25
  49. Lindner, J. R., Kahn, M. L., Coughlin, S. R., Sambrano, G. R., Schauble, E., Bernstein, D., Foy, D., Hafezi-Moghadam, A., Ley, K. (2000) Delayed onset of inflammation in protease-activated receptor-2-deficient mice J. Immunol. 165,6504-6510[Abstract/Free Full Text]
  50. 26
  51. Schmidlin, F., Amadesi, S., Dabbagh, K., Lewis, D. E., Knott, P., Bunnett, N. W., Gater, P. R., Geppetti, P., Bertrand, C., Stevens, M. E. (2002) Protease-activated receptor 2 mediates eosinophil infiltration and hyperreactivity in allergic inflammation of the airway J. Immunol. 169,5315-5321[Abstract/Free Full Text]
  52. 27
  53. Vergnolle, N., Derian, C. K., D’Andrea, M. R., Steinhoff, M., Andrade-Gordon, P. (2002) Characterization of thrombin-induced leukocyte rolling and adherence: a potential proinflammatory role for proteinase-activated receptor-4 J. Immunol. 169,1467-1473[Abstract/Free Full Text]
  54. 28
  55. D’Andrea, M. R., Derian, C. K., Leturcq, D., Baker, S. M., Brunmark, A., Ling, P., Darrow, A. L., Santulli, R. J., Brass, L. F., Andrade-Gordon, P. (1998) Characterization of protease-activated receptor-2 immunoreactivity in normal human tissue J. Histochem. Cytochem. 46,157-164[Abstract/Free Full Text]
  56. 29
  57. Knight, D. A., Lim, S., Scaffidi, A. K., Roche, N., Chung, F., Stewart, G. A., Thompson, P. J. (2001) Protease-activated receptors in human airways; upregulation of PAR-2 in respiratory epithelium from patients with asthma J. Allergy Clin. Immunol. 108,797-803[CrossRef][Medline]
  58. 30
  59. Cocks, T. M., Moffatt, J. D. (2001) Protease-activated receptor-2 (PAR2) in the airways Pulm. Pharmacol. Ther. 14,183-191[CrossRef][Medline]
  60. 31
  61. Schmidlin, F., Amadesi, S., Vidil, R., Trevisani, M., Martinet, N., Caughey, G., Tognetto, M., Cavallesco, G., Mapp, C., Geppetti, P., Bunnett, N. W. (2001) Expression and function of proteinase-activated receptor 2 in human bronchial smooth muscle Am. J. Respir. Crit. Care Med. 164,1276-1281[Abstract/Free Full Text]
  62. 32
  63. Molino, M., Barnathan, E. S., Numerof, R., Clark, J., Dreyer, M., Cumashi, A., Hoxie, J. A., Schechter, N., Woolkalis, M. J., Brass, L. F. (1997b) Interactions of mast cell tryptase with thrombin receptors and PAR2 J. Biol. Chem. 272,4043-4049[Abstract/Free Full Text]
  64. 33
  65. Miike, S., McWilliam, A. S., Kita, H. (2001) Trypsin induces activation and inflammatory mediator release from human eosinophils through protease-activated receptor-2 J. Immunol. 167,6615-6622[Abstract/Free Full Text]
  66. 34
  67. Jaffe, E. A., Nachman, R. L., Becker, C. G., Minick, C. R. (1973) Culture of human endothelial cells derived from umbilical veins: identification by morphological and immunological criteria J. Clin. Invest. 52,2745-2756
  68. 35
  69. Sabroe, I., Hartnell, A., Jopling, L. A., Bel, S., Ponath, P. D., Pease, J. E., Collins, P. D., Williams, T. J. (1999) Differential regulation of eosinophil chemokine signaling via CCR3 and non-CCR3 pathways J. Immunol. 162,2946-2955[Abstract/Free Full Text]
  70. 36
  71. O’Brien, P. J., Prevost, N., Molino, M., Hollinger, M. K., Woolkalis, M. J., Woulfe, D. S., Brass, L. F. (2000) Thrombin responses in human endothelial cells. Contributions from receptors other than PAR1 include transactivation of PAR2 by thrombin-cleaved PAR1 J. Biol. Chem. 275,13502-13509[Abstract/Free Full Text]
  72. 37
  73. Kahn, M. L., Nakanishi-Matsui, M., Shapiro, M. J., Ishihara, H., Coughlin, S. R. (1999) Protease-activated receptors 1 and 4 mediate activation of human platelets by thrombin J. Clin. Invest. 103,879-887[Medline]
  74. 38
  75. Howells, G. L., Macey, M. G., Chinni, C., Hou, L., Fox, M. T., Harriott, P., Stone, S. R. (1997) Proteinase-activated receptor-2: expression by human neutrophils J. Cell Sci. 110,881-887[Abstract]
  76. 39
  77. DeFea, K. A., Zalevsky, J., Thoma, M. S., Dery, O., Mullins, R. D., Bunnett, N. W. (2000) b-Arrestin-dependent endocytosis of proteinase-activated receptor 2 is required for intracellular targeting of activated ERK1/2 J. Cell Biol. 148,1267-1281[Abstract/Free Full Text]
  78. 40
  79. Compton, S., Sandhu, S., Wijesuriya, S., Hollenberg, M. D. (2002) Glycosylation of human proteinase-activated receptor 2 (hPAR2): role in cell surface expression and signalling Biochem. J. 368,495-505[CrossRef][Medline]
  80. 41
  81. Molino, M., Woolkalis, M. J., Reavey-Cantwell, J., Pratico, D., Andrade-Gordon, P., Barnathan, E. S., Brass, L. F. (1997a) Endothelial cell thrombin receptors and PAR2. Two protease-activated receptors located in a single cellular environment J. Biol. Chem. 272,11133-11141[Abstract/Free Full Text]
  82. 42
  83. Blackheart, B. D., Emilsson, K., Nguyen, D., Teng, W., Martelli, A. J., Nystedt, S., Sundelin, J., Scarborough, R. M. (1996) Ligand cross-reactivity within the protease-activated receptor family J. Biol. Chem. 271,16466-16471[Abstract/Free Full Text]
  84. 43
  85. al-Ani, B., Saifeddine, M., Kawabata, A., Renaux, B., Mokashi, S., Hollenberg, M. D. (1999) Proteinase-activated receptor 2 (PAR2): development of a ligand-binding assay correlating with activation of PAR2 by PAR1- and PAR2-derived peptide ligands J. Pharmacol. Exp. Ther. 290,753-760[Abstract/Free Full Text]
  86. 44
  87. Hollenberg, M. D., Saifeddine, M., al-Ani, B., Kawabata, A. (1997) Proteinase-activated receptors: structural requirements for activity, receptor cross-reactivity and receptor selectivity of receptor activating peptides Can. J. Physiol. Pharmacol. 75,832-841[CrossRef][Medline]
  88. 45
  89. Stenton, G. R., Nohara, O., Dery, R. E., Vliagoftis, H., Gilchrist, M., Johri, A., Wallace, J. L., Hollenberg, M. D., Moqbel, R., Befus, A. D. (2002) Proteinase-activated receptor (PAR)-1 and -2 agonists induce mediator release from mast cells by pathways distinct from PAR-1 and PAR-2 J. Pharmacol. Exp. Ther. 302,466-474[Abstract/Free Full Text]
  90. 46
  91. Bizios, R., Lai, L., Fenton, J., Malik, A. (1986) Thrombin-induced chemotaxis and aggregation of neutrophils J. Cell. Physiol. 128,485-490[CrossRef][Medline]
  92. 47
  93. He, S., Peng, Q., Walls, A. F. (1997) Potent induction of a neutrophil and eosinophil-rich infiltrate in vivo by human mast cell tryptase: selective enhancement of eosinophil recruitment by histamine J. Immunol. 159,6216-6225[Abstract]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. Shinagawa, V. A. Ploplis, and F. J. Castellino
A severe deficiency of coagulation factor VIIa results in attenuation of the asthmatic response in mice
Am J Physiol Lung Cell Mol Physiol, May 1, 2009; 296(5): L763 - L770.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
E Hyun, P Andrade-Gordon, M Steinhoff, and N Vergnolle
Protease-activated receptor-2 activation: a major actor in intestinal inflammation
Gut, September 1, 2008; 57(9): 1222 - 1229.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
V. Shpacovitch, M. Feld, M. D. Hollenberg, T. A. Luger, and M. Steinhoff
Role of protease-activated receptors in inflammatory responses, innate and adaptive immunity
J. Leukoc. Biol., June 1, 2008; 83(6): 1309 - 1322.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Zoudilova, P. Kumar, L. Ge, P. Wang, G. M. Bokoch, and K. A. DeFea
beta-Arrestin-dependent Regulation of the Cofilin Pathway Downstream of Protease-activated Receptor-2
J. Biol. Chem., July 13, 2007; 282(28): 20634 - 20646.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. Ramachandran, L. R. Sadofsky, Y. Xiao, A. Botham, M. Cowen, A. H. Morice, and S. J Compton
Inflammatory mediators modulate thrombin and cathepsin-G signaling in human bronchial fibroblasts by inducing expression of proteinase-activated receptor-4
Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L788 - L798.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
N. Tyagi, K. C. Sedoris, M. Steed, A. V. Ovechkin, K. S. Moshal, and S. C. Tyagi
Mechanisms of homocysteine-induced oxidative stress
Am J Physiol Heart Circ Physiol, December 1, 2005; 289(6): H2649 - H2656.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
U. Johansson, C. Lawson, M. Dabare, D. Syndercombe-Court, A. C. Newland, G. L. Howells, and M. G. Macey
Human peripheral blood monocytes express protease receptor-2 and respond to receptor activation by production of IL-6, IL-8, and IL-1{beta}
J. Leukoc. Biol., October 1, 2005; 78(4): 967 - 975.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. M. Swartz, J. Bystrom, K. D. Dyer, T. Nitto, T. A. Wynn, and H. F. Rosenberg
Plasminogen activator inhibitor-2 (PAI-2) in eosinophilic leukocytes
J. Leukoc. Biol., October 1, 2004; 76(4): 812 - 819.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0702351v1
74/1/60    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bolton, S. J.
Right arrow Articles by Wardlaw, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bolton, S. J.
Right arrow Articles by Wardlaw, A. J.