Published online before print May 22, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Institute for Lung Health,
* Division of Respiratory Medicine, Leicester Warwick Medical School, and
Department of Microbiology and Immunology, School of Biological Sciences, Maurice Shock Medical Science Building, Leicester University, United Kingdom
Correspondence: Sarah Bolton, Division of Respiratory Medicine, Leicester University, Clinical Sciences, Glenfield Hospital, Groby Road, Leicester LE3 9QP, UK. E-mail: sjb73{at}leicester.ac.uk
|
|
|---|
Key Words: trypsin thrombin activation
|
|
|---|
The first steps in selective eosinophil recruitment to airway tissue are egress from the bloodstream, and this involves selective adhesion and transmigration across the vascular endothelium [2 ]. Initial adhesion is mediated by P-selectin glycoprotein ligand 1 [3 , 4 ] and vascular cell adhesion moleculevery late activation antigen 4 interactions [5 , 6 ], and the subsequent firm adhesion is mediated by CD18intercellular adhesion molecule 1 interactions [7 , 8 ]. Transmigration of eosinophils across endothelium in culture has been shown to affect subsequent eosinophil function [9 ], and in vitro cross-linking of the CD18 integrin has been shown to activate eosinophils, resulting in degranulation [eosinophil peroxidase (EPO) and eosinophil-derived neurotoxin], cysteinyl leukotriene (cys-LT) release, and superoxide generation [10 11 12 ]. Mediator release and degranulation can also be triggered by chemokines in conjunction with an interleukin (IL)-5 priming step [13 , 14 ]. IL-5 is a key cytokine involved in regulating eosinophils [15 ] and is often used to prime eosinophils in vitro before exposure to a main stimuli resulting in, e.g., chemotaxis or degranulation [16 17 18 ].
Protease-activated receptors (PARs) are a novel family of G-protein-coupled receptors that are activated upon cleavage of the N terminus of the receptor by proteases. This cleavage exposes a previously cryptic, tethered ligand, which then binds intramolecularly to the second extracellular loop to activate the associated G-protein (reviewed in refs. [19 , 20 ]). To date, four PARs have been identified that are typically activated by thrombin (PAR1, -3, and -4) or trypsin (PAR2 and -4). PARs are expressed on a variety of cells including platelets, endothelial and epithelial cells, neutrophils, and mononuclear cells and can elicit various responses including platelet aggregation, chemotaxis, cell proliferation, and raising intracellular calcium (reviewed in refs. [21 22 23 ]).
PARs are expressed on platelets and are known to be involved in key processes during haemostasis, but they also appear to play an additional, non-haemostasis role in other cell types such as epithelium and some leukocytes, and evidence is beginning to accumulate for a role for PARs in airway disease. PARs have been shown to exhibit pro-inflammatory properties [24 25 26 27 ] that appear to be mediated by an ability to promote selectin-mediated leukocyte adhesion during inflammation [24 , 25 ]. The data from a PAR2 knockout mouse and a mouse over-expressing PAR2 [26 ] have provided particularly compelling evidence that PARs contribute to allergic airway inflammation in mice. In humans, it has been shown recently that the PARs are expressed in airway tissue in vivo [28 29 30 ] and in vitro [31 ], and an airway-associated protease, mast cell tryptase, is known to activate PAR2 [32 ]. There is now convincing evidence for a role for PARs in the asthmatic airway, as ligands and receptors are located in the general milieu of inflammatory and traumatized airway. Furthermore, the observation that PARs are involved in selectin-mediated adhesion suggests an involvement with eosinophils. We were therefore interested to know whether eosinophils, a key cell type in airway disease, expressed PARs and whether activation of the PARS could affect eosinophil function. We have shown the presence of PAR1 and -2 on human eosinophils, but there was no difference between normal and asthmatic donors. Activation of PARs induced shape change, generation of reactive oxygen species (ROS), and to a lesser extent, the release of cys-LT. This study and another one recently published [33 ] demonstrate that PARs are present and functional on eosinophils, giving rise to the possibility that they may play a role in asthma pathology.
|
|
|---|
PAR ligands and agonist peptides
Thrombin was purchased from Enzyme Research Laboratories (Cardiff, UK). Trypsin (Cat. No. T1005, chymotrypsin-depleted) was purchased from Sigma (Dorset, UK). Peptides corresponding to the tethered ligand of PAR1, -2, and -4 were synthesized in C-terminal amide form and purified by high-pressure liquid chromatography using standard techniques by the Protein and Nucleic Acid Chemistry Laboratory (PNACL; University of Leicester, UK; PAR14). Scrambled control peptides for PAR1 and -2 (SC1 and SC2, respectively) were synthesized at the University of Southampton (UK). Sequences were as follows: PAR1, SFLLRN; PAR2, SLIGKVD; PAR4, GYPGQV; SC1, FSLLRN; SC2, LSIGKV.
Polymerase chain reaction (PCR) primers
PCR primers were designed using PrimerEdit software and were subject to BLAST analysis to confirm their specificity for human PAR14. Primers were as follows: PAR1 forward primer: 492 cggcagtgattggcagtttg 511; PAR1 reverse primer: 791 tcgagcagggtttcattgagc 771; expected product size: 300 bp. PAR2 forward primer: 125 ttgatggcacatccgacgtc 144; PAR2 reverse primer: 523 aatacctctgcacactgaggcag 501; expected product size: 399 bp. PAR3 forward primer: 1 atgaaagccctcatctttgcag 22; PAR3 reverse primer: 372 tctggtcctgaagaaaagcatcc 350; expected product size: 372 bp. PAR4 forward primer: 106 gatgacagcacgccctcaatc126; PAR4 reverse primer: 348 catcagcagcatggtggagg 329; expected product size: 242 bp.
Isolation of eosinophils and other leukocytes
Peripheral venous blood was taken from normal, healthy volunteers showing mild or no atopic symptoms. Asthmatic subjects with an elevated eosinophil count (>0.5x109/L) were chosen from patients attending routine respiratory clinics at the Glenfield Hospital (Leicester, UK). The asthmatic group would be defined as having a suggestive improvement in forced expiratory volume in 1 s, 10 min after 200 µg inhaled salbutamol or methacholine airway hyper-responsiveness (PC20>8 ng/ml). Eosinophil purification was as described previously [3
] by density gradient centrifugation and negative immunomagnetic selection using the magnetic cell sorter system with anti-CD16-conjugated beads (Miltenyi Biotec, Bergisch Gladbach, Germany). Neutrophils were isolated from nonatopic volunteers by density gradient centrifugation. Purity of both cells types was determined by Kimura staining and was >95%. Where mixed granulocyte populations were used, the blood was processed as for neutrophil isolation, and the percent eosinophils was determined. Peripheral blood mononuclear cells were recovered from the buffy coat obtained during eosinophil or neutrophil isolation following a macrophage-depletion step by incubating on tissue-culture plastic for 30 min.
Human umbilical vein endothelial cell (HUVEC) isolation
HUVECs were isolated from human umbilical cords adapted from Jaffe et al. [34
] and were used at passage 1. Cells were cultured on fibronection-coated dishes until confluence and detached using a 1-mM EDTA/5-mM EGTA solution.
Reverse transcriptase (RT)-PCR
Total RNA was isolated using RNeasy mini-spin columns (Qiagen, West Sussex, UK) according to the maunfacturers instructions. DNA contamination was removed using DNase I (Invitrogen, Paisley, Scotland), and RT reactions using the Sensiscript RT kit (Qiagen) were carried out according to the manufacturers instructions using 50 ng RNA and random hexamers (Invitrogen) as primers. Controls where the RT enzyme was omitted were also included. One-tenth of the RT reaction was then added to a PCR reaction using Taq MasterMix (Qiagen). Half of the PCR reaction was then subject to agarose gel electrophoresis and was stained with ethidium bromide.
Flow cytometry
Isolated leukocytes were stained fresh for detection of surface expression of PARs or fixed in 4% paraformaldehyde and permeabilized in 0.1% saponin for detection of surface and intracellular PARs. Cells (2.55x105) were incubated with anti-PAR mAb at 20 µg/ml. Bound antibody was detected using a biotinylated anti-mouse antibody (Dako, Cambridgeshire, UK; both 20 µg/ml) followed by R-phycoerythrin (RPE) streptavidin (Dako; 30 µg/ml). Platelet contamination was assessed using a RPE-conjugated anti-CD41 antibody (Serotec, Oxfordshire, UK). Where mixed granulocyte populations were used, the eosinophils were distinguished using an anti-CD9 antibody (Serotec).
Western blotting and immunoprecipitation
Cells were lysed in radio immunoprecipitation assay (RIPA) buffer containing protease inhibitors and were homogenized, and the debris was pelleted. For Western blotting, lysates were diluted 1:2 in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)-loading buffer (Sigma), and 0.5 x 106 cells/lane were subject to SDS-PAGE (10% gel) and electroblotted to nitrocellulose (APBiotec, Hertfordshire, UK) according to standard protocols. Filters were blocked in 5% milk powder before being incubated in primary pAb antibody (anti-PAR1 and -3, 2 µg/ml; anti-PAR2 and -4, 0.4 µg/ml). Bound antibody was detected with horseradish peroxidase anti-goat antibody (Dako; 0.25 µg/ml) and enhanced chemiluminescence (ECL) reagents (Amersham, Little Chalfont, UK). Filters were exposed to blue X-ray film for an average of 30 s. For immunoprecipitation, goat IgG-cleared cell lysates were incubated with anti-PAR4 pAb followed by Protein AG-agarose. Immune-complexed beads were subject to SDS-PAGE and electroblotted to polyvinylidene difluoride membrane, and two bands of
40 and 80 kDa were identified. Sequencing was performed by PNACL (University of Leicester) using standard techniques.
Intracellular calcium release
Purified eosinophils were resuspended at 5 x 106/ml in Krebs buffer [120 mM NaCl, 4.8 mM KCl, 1.2 mM KH2PO4, 1.2 mM MgSO4, 1.3 mM CaCl2, 25 mM HEPES, 0.1% bovine serum albumin (BSA), 10 mM glucose]. Fura 2 AM(Sigma) was added to a final concentration of 2 µM, and the cells were incubated at 37°C for 1 h. The cells were then washed and resuspended in fresh Krebs buffer at 5 x 105/ml and kept at 37°C. Cell suspension (2 ml) was placed in a spectrophotometer (luminescence spectrophotometer LS50B, Perkin Elmer Life Sciences, Cambridge, UK), and a baseline reading at 340 and 380 nm was obtained. Readings were taken every second at a temperature of 37°C. Agonists were added, and the reading continued for a further 300500 s. Data are expressed as the 340/380 ratio.
Gated autofluorescence/forward scatter (FSc; GAFS) assay
The GAFS assay was performed as described by Sabroe et al. [35
]. Briefly, mixed granulocyte populations were incubated in assay buffer [phosphate-buffered saline with 0.9 mM calcium, 0.5 mM magnesium (Invitrogen), 10 mM HEPES (Invitrogen), 0.1% BSA, 10 mM glucose] at room temperature for 30 min, pelleted, and resuspended in fresh buffer at 5.5 x 106/ml. After a further 5 min at room temperature, 5 x 105 cells were stimulated with agonists [100 nM platelet-activating factor (PAF; Bachem UK, Merseyside), 30 nM eotaxin (PeproTech EC Ltd., London, UK), 500 nM thrombin, 10.1 µM trypsin, and 10.1 mM PAR peptides] at 37°C for 5 and 30 min. Cells were fixed in 1% paraformaldehyde (Cytofix, Becton Dickinson, San Jose, CA) and kept on iced water until analyzed by FACScan. Eosinophils were easily distinguished from neutrophils by their autofluorescence under high FL2 conditions. Preliminary experiments using mouse mAb against CD9 (Serotec) and CCR3 (a generous gift from Millenium Pharmaceuticals, Cambridge, MA) confirmed that the autofluorescent population was indeed eosinophils (data not shown).
Degranulation and measurement of cys-LT release
Purified eosinophils were resuspended at 8 x 106/ml in assay buffer (see above). Where indicated, cells were stimulated with 5 ng/ml recombinant human IL-5 (R&D Systems, Minneapolis, MN) for 30 min at 37°C. Cells (4 x 105/50 µl) were then added to a 96-well plate (Falcon Probind, Becton Dickinson) coated with 30 µg/ml human IgG (Sigma), blocked in 2.5% human serum albumin (HSA; First Link Ltd., West Midlands, UK), and incubated at 37°C for 10 min. Equal volumes of agonists (50 µl 2x concentrate, 500 nM thrombin, 10.1 µM trypsin, 10.1 mM PAR peptides, and 1:20 IgG-sepharose beads) were added to the cells, and the plate returned to the incubator for 60 min. Each agonist was assayed in triplicate. The plate was centrifuged at 600 g for 10 min, 4°C, and 50 µl aliquots of supernatant (equivalent to 2 x 105 cells) were stored at - 80°C. cys-LT were measured using a commercially available enzyme immunoassay (EIA) from Cayman Chemicals (Alexis Corporation, Nottinghamshire, UK), which detects 100% of LTC4 and LTD4, and results were expressed as pg/ml/106 cells.
Measurement of ROS generation by chemiluminescence
Eosinophils were resuspended at 1 x 106/ml in assay buffer (see above) containing 50 µM lucigenin. Cells (2x105) were added to wells of a 96-well plate (Nunclon TC plate, Nalge Nunc International, Rochester, NY; blocked with 2.5% HSA), and baseline readings at 37°C were obtained for 10 min. Agonists (1 µM PAF, 500 nM thrombin, 10.1 µM trypsin, and 10.1 mM PAR peptides) were added to cells, and readings were taken every 23 min for up to 90 min. Each agonist was assayed in duplicate. The Wallac Victor2 platereader (Perkin Elmer Life Sciences) was used as a luminometer, and the results are expressed as arbitrary units versus time.
Statistical analysis
Data are shown as mean ± SEM, and paired t-tests were performed using GraphPad Prism version 3.00 (GraphPad Software, San Diego, CA).
|
|
|---|
![]() View larger version (34K): [in a new window] |
Figure 1. RT-PCR analysis of human leukocytes and endothelial cells for PAR RNA expression. Total RNA was extracted from human eosinophils (A), neutrophils (B), mononuclear cells (C), or endothelial cells (HUVECs; D) and was subject to RT-PCR using random hexamer primers for the RT step and PAR-specific primers for the PCR step. PCR products were analyzed by agarose gel electrophoresis and compared with a 100-bp ladder (left lane). Expected product sizes were: PAR1, 300 bp; PAR2, 399 bp; PAR3, 372 bp; PAR4, 242 bp. Figure is a representative example of five different donors.
|
55 kDa, but bands with an apparent higher MW may be seen as a result of differential glycosylation. PAR1 (80 kDa), PAR2 (55 kDa), and PAR4 (80 and 40 kDa) were detected in eosinophils (Fig. 2A)
and the positive control, mononuclear cells, as expected (Fig. 2B)
. In eosinophils (Fig. 2A) , PAR1 was detected as a single band of approximately 80 kDa, but this was seen in only 50% of the donors (three out of six). The PAR1 peptide was not effective at eliminating this band when incubated with the antibody before incubation (data not shown). PAR2 was detected as a single band of
55 kDa in all donors, and this band could be eliminated from the blot by prior incubation of the pAb with the relevant PAR2 peptide. No bands were detected with the PAR3 antibody, despite a band being seen in HUVEC lysates (data not shown). Surprisingly, PAR4 was detected in eosinophils from all donors, despite the lack of apparent RNA expression. PAR4 was detected as a doublet of
40 and 80 kDa, the same as in the mononuclear cells. The appearance of both of these bands in eosinophils (data not shown) or mononuclear cells (Fig. 2B)
could be eliminated by prior incubation of the pAb with the PAR4 peptide used to generate the pAb. Bands were occasionally seen following incubation with the goat IgG (GtIgG) control antibody, but these did not match any of the bands detected with the PAR pAb. Also, incubation of the goat IgG with the PAR2 or PAR4 peptide did not eliminate these nonspecific bands (data not shown). Immunoprecipitation of eosinophils with the PAR4 pAb pulled down two proteins with the appropriate MW seen previously on Western blots. The 8085 kDa band was not able to be sequenced as a result of N-terminal blocking. However, we were able to get some sequence (seven amino acids) from the lower band, which following BLAST analysis, did not appear to be related to PAR4.
![]() View larger version (79K): [in a new window] |
Figure 2. Western blot analysis of human leukocytes for PAR protein expression. Purified human eosinophils (A) or mononuclear cells (B) were lysed into RIPA buffer separated by SDS-PAGE and transferred to nitrocellulose. Filters were probed with pAb to each of the PARs and were detected using ECL. In some experiments, the antibody was incubated with a fivefold excess of the peptide, which was used to generate the pAb. Molecular weights (MW) in kDa are shown at the left of each blot. Blots are representative examples of eosinophils, n = 5 donors; mononuclear cells, n = 3; peptide blots, n = 3 each. GtIgG, goat IgG.
|
![]() View larger version (22K): [in a new window] |
Figure 3. Flow cytometry of human eosinophils for PAR1 and PAR2. Purified human eosinophils were stained with mAb to PAR1 (ATAP2, A and B) or PAR2 (SAM11, C and D). Cells were unfixed to study surface-only expression (A and C) or fixed and permeabilized to look at surface and intracellular levels (B and D). mAb are shown by the solid line, and appropriate isotype controls are represented by the dotted lines. (AD) Representative example of four independent experiments. The levels of PAR1 and PAR2 in purified eosinophils or mixed granulocyte population following fixation and permeabilization were measured in control and asthmatic donors (each group, n=4). (E) The results are shown as a ratio of the mean fluorescence intensity (MFI) of PAR mAb:isotype control.
|
PAR1 agonist peptide causes an increase in cytosolic calcium
Addition of PAF to Fura 2-loaded eosinophils resulted in a transient increase in intracellular calcium (Fig. 4A
), and this was used as a positive control in all calcium experiments (n=6). Thrombin (0.55 µM) and trypsin (0.11 µM) were ineffective in raising intracellular calcium (data not shown). However, the PAR1 agonist peptide (0.1 mM) did produce a rise in intracellular calcium, and a typical trace (n=5) is shown in Figure 4B
. Agonist peptides for PAR2 and -4 did not have any effect in this assay. Where there was no effect with the agonist, PAF was added to ensure that the cells were responsive, and an increase in the 340/380 ratio was seen (data not shown).
![]() View larger version (22K): [in a new window] |
Figure 4. Increases in intracellular calcium in response to PAR1. Purified human eosinophils were loaded with Fura 2 AM in Krebs buffer, and the increases in intracellular calcium in response to various agonists were measured in a spectrophotometer. The results are presented as a ratio of the readings at 340 and 380 nm. PAF was used as a positive control and consistently raised calcium levels (A). PAR1 also raised levels of intracellular calcium (B). The traces are representative examples of six (PAF) or five (PAR1) independent experiments.
|
![]() View larger version (36K): [in a new window] |
Figure 5. GAFS assay to measure shape change in response to PAR agonists in eosinophils (Eos) and neutrophils (Neuts). The GAFS assay was used to assess shape change by measuring increases in FSc of a mixed population of eosinophils and neutrophils using flow cytometry. The eosinophil population (R1) is distinguished from the neutrophils (R2) by their autofluorescent properties on the FL2 channel (A). Resting eosinophils and neutrophils (C and D) showed an increase in mean FSc when stimulated with PAF (E, P<0.001; F, P<0.001). (B) The mean FSc of resting and stimulated cells from a typical experiment is shown. Eotaxin was also used as a control to increase the mean FSc in eosinophils only. (G and H) The results shown are expressed as the percent increase in FSc induced by each agonist compared with buffer-stimulated cells after 5 and 30 min incubation (n=6). Eosinophils (G) responded to the PAR1 peptide at both time points (5 min, P=0.004; 30 min, P=0.010) but not to thrombin. Activation via trypsin or PAR2 peptide (P=0.008) was only seen after 30 min. Neutrophils (H) responded to trypsin after 30 min (P=0.033) and at 5 and 30 min with peptides to PAR1 (5 min, P=0.023; 30 min, P=0.009) and PAR2 (5 min, P=0.021; 30 min, P=0.001). PAR4 was considered ineffective in this assay in either cell type.
|
Activation of PARs induces cys-LT release
Purified eosinophils were primed with IL-5 (5 ng/ml) and then stimulated with thrombin (500 nM), trypsin (0.1 µM), or agonist peptides to PAR1 and -2 (0.1 mM). Cells not primed with IL-5 did not induce any cys-LT release (data not shown). IgG-coupled sepharose beads were used as a positive control, and they induced release of over 4 ng/ml cys-LT/million cells (data not shown). The results were variable between donors, and only the PAR2 agonist peptide caused any significant release of cys-LT compared with medium alone (Fig. 6
).
![]() View larger version (12K): [in a new window] |
Figure 6. Release of cys-LT from human eosinophils in response to PAR activation. Purified human eosinophils were primed with 5 ng/ml IL-5 and treated with PAR agonists for 60 min. Cell-free supernatants were assayed for cys-LT using a commercially available EIA (n=47). Release of cys-LT was very donor-variable, and only PAR2 peptide stimulated significant release compared with assay buffer alone (P=0.0189). As a positive control, eosinophils were treated with IgG-coupled sepharose beads, and release of over 4 ng/ml cys-LT was detected (data not shown).
|
![]() View larger version (21K): [in a new window] |
Figure 7. Generation of ROS in human eosinophils in response to PAR activation. Eosinophils were resuspended in assay buffer containing lucigenin and stimulated with PAR ligands and peptides. ROS generation was measured by chemiluminescence, and 1 µM PAF was used as a positive control (P=0.0041). Thrombin was inactive, whereas trypsin (P=0.0062) or the PAR2 peptide (P=0.0107) induced significant ROS generation. The PAR2 control peptide also stimulated some ROS generation, but this was significantly reduced compared with the active peptide (P=0.0175).
|
|
|
|---|
Eosinophils express PAR1 and -2 proteins
We also looked for expression of PAR protein in eosinophils using commercially available PAR antibodies. We used mAb to PAR1 and -2 (ATAP2 and SAM11), which have been widely documented within the PAR field, as well as some pAb to all four PARs. Western blotting with the PAR pAb demonstrated that like the RT-PCR, eosinophils express PAR1 and -2. PARs have a predicted MW of approximately 55 kDa, and increases in the apparent MW to approximately 80 kDa are attributed to post-translational glycosylation [39
, 40
]. Detection of PAR1 with the pAb was somewhat donor-variable but could be detected as a single band of
80 kDa. We have assumed this variability to be a result of the pAb, as PAR1 was detected in all donors using RT-PCR (n=5) and flow cytometry with mAb ATAP2 (n=11). In contrast, PAR2 was seen in all donors as a single band with the appropriate MW of
55 kDa, indicating little post-translation glycosylation. The apparent detection of PAR4 in eosinophils was unexpected but initially convincing, as the two bands were identical to those seen in mononuclear cells, which are known to express PAR4. Additionally, the bands could be eliminated by prior incubation of the pAb with the peptide used to generate the pAb. This observation could not be explained by the possibility of platelet contamination, as flow cytometry staining with an antiplatelet antibody was negative. However, subsequent sequencing of the smaller band did not reveal any homology to PAR4, which caused us to question the specificity of the pAb. However, the larger band could not be sequenced, as it was N-terminally blocked, and this band, which is similar in size to PAR1, could be PAR4. The possibility that there is an eosinophil-specific PAR4 still remains but does require significant further investigation.
The mouse mAb ATAP2 and SAM11 [36 , 41 ] were used for standard flow cytometry, and we were able to detect PAR1 before and after permeabilization, indicating that this PAR is present on the cell surface and possibly intracellularly too. PAR2 could only be detected following permeabilization, suggesting a predominantly intracellular localization. It has also been reported that the PAR1 antibody, WEDE15, stained eosinophils in human bronchial biopsies [29 ], providing further evidence that despite the Miike report [33 ], eosinophils do express PAR1. We have also found WEDE15 to stain eosinophils when used for flow cytometry (S. J. Bolton, unpublished observations). It was intriguing to find a lack of PAR2 on the surface of eosinophils, despite the ability of the SAM11 antibody to recognize surface PAR2 [36 ] on endothelial cells.
In the context of PARs and airway inflammation, a study by Knight et al. [29 ] demonstrated that PAR2 was up-regulated on epithelium in the asthmatic airway, but the authors did not document any increased leukocyte staining. Unfortunately, in our study, there did not appear to be any difference in the levels of PAR expression in control subjects compared with asthmatics subjects. This is the first time that a comparison has been made of PAR expression between control and asthmatic individuals, and it will be of interest to extend the study to include other pulmonary diseases such as severe asthma or eosinophilic pneumonia.
PARs and eosinophil activation
In our hands, PAR-mediated activation of eosinophils was difficult to detect, and assays for EPO and ß-hexosaminidase after PAR stimulation gave generally negative results (S. J. Bolton, unpublished observations). Although we have shown the presence of PAR1 on the surface of eosinophils, we have not been able to detect a response with thrombin in any assay. The thrombin was active and was capable of stimulating platelets to bind fluorescein isothiocyanate-conjugated fibrinogen when assessed by flow cytometry (data not shown). By contrast, the PAR1 agonist peptide appeared to be functional and could trigger rises in intracellular calcium as well as shape change but not mediator release. This ability of the PAR1 peptide but not thrombin to stimulate eosinophils was also the experience of Miike et al. [33
] and is presumably a result of the dual activity of the SFLLRN peptide, which can stimulate PAR1 and PAR2 [42
43
44
]. This lack of specificity of the PAR1 peptide explains why we were able to show that the PAR1 peptide can activate neutrophils, which only express PAR2. Similarly, the control peptides may also have some degree of activity but with much reduced potency compared with the endogenous ligand (Fig. 7
and ref. [45
]). The possibility that PAR1 is involved in other aspects of eosinophil function, e.g., recruitment to sites of inflammation, requires further investigation.
Our data with trypsin and the PAR2 peptide suggest that it may not be involved in immediate responses (such as raising intracellular calcium) but was more effective over a period of time, as there was a significant response in the ROS assay after 30 min and in the GAFS assay at 30 min but not 5 min. In support of this, Miike et al. [33 ] demonstrated that superoxide generation in response to trypsin and PAR2 peptide was low at 15 min but increased rapidly by 3060 min. Our data suggest that PAR2 is present at undetectable levels on the cell surface and that once these few receptors become activated, PAR2 is redistributed from intracellular stores to the surface of the cell. It is intriguing to speculate on the identity of this exogenous stimulus, e.g., cytokines from recruited lymphocytes or other proteases, such as mast cell tryptase, which could be provided by the microenvironment of the asthmatic airway.
It has been demonstrated that thrombin and trypsin-like enzymes are chemotactic for leukocytes [46 , 47 ], and a role for PARs in other areas of eosinophil biology, e.g., adhesion and recruitment to inflamed airways, represents interesting avenues for future investigation. It is clear that PARs are expressed on eosinophils, and there is increasing evidence that PARs play a role in airway disease. However, further clarification of the exact expression and function of PARs on eosinophils and their contribution to airway disease pathology is needed.
Received July 9, 2002; revised March 12, 2003; accepted March 21, 2003.
|
|
|---|
This article has been cited by other articles:
![]() |
K. Shinagawa, V. A. Ploplis, and F. J. Castellino A severe deficiency of coagulation factor VIIa results in attenuation of the asthmatic response in mice Am J Physiol Lung Cell Mol Physiol, May 1, 2009; 296(5): L763 - L770. [Abstract] [Full Text] [PDF] |
||||
![]() |
E Hyun, P Andrade-Gordon, M Steinhoff, and N Vergnolle Protease-activated receptor-2 activation: a major actor in intestinal inflammation Gut, September 1, 2008; 57(9): 1222 - 1229. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Shpacovitch, M. Feld, M. D. Hollenberg, T. A. Luger, and M. Steinhoff Role of protease-activated receptors in inflammatory responses, innate and adaptive immunity J. Leukoc. Biol., June 1, 2008; 83(6): 1309 - 1322. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zoudilova, P. Kumar, L. Ge, P. Wang, G. M. Bokoch, and K. A. DeFea beta-Arrestin-dependent Regulation of the Cofilin Pathway Downstream of Protease-activated Receptor-2 J. Biol. Chem., July 13, 2007; 282(28): 20634 - 20646. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ramachandran, L. R. Sadofsky, Y. Xiao, A. Botham, M. Cowen, A. H. Morice, and S. J Compton Inflammatory mediators modulate thrombin and cathepsin-G signaling in human bronchial fibroblasts by inducing expression of proteinase-activated receptor-4 Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L788 - L798. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tyagi, K. C. Sedoris, M. Steed, A. V. Ovechkin, K. S. Moshal, and S. C. Tyagi Mechanisms of homocysteine-induced oxidative stress Am J Physiol Heart Circ Physiol, December 1, 2005; 289(6): H2649 - H2656. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Johansson, C. Lawson, M. Dabare, D. Syndercombe-Court, A. C. Newland, G. L. Howells, and M. G. Macey Human peripheral blood monocytes express protease receptor-2 and respond to receptor activation by production of IL-6, IL-8, and IL-1{beta} J. Leukoc. Biol., October 1, 2005; 78(4): 967 - 975. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Swartz, J. Bystrom, K. D. Dyer, T. Nitto, T. A. Wynn, and H. F. Rosenberg Plasminogen activator inhibitor-2 (PAI-2) in eosinophilic leukocytes J. Leukoc. Biol., October 1, 2004; 76(4): 812 - 819. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||