science pharmaceutical expo biotech jobs

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abedin, M. J.
Right arrow Articles by Hirashima, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abedin, M. J.
Right arrow Articles by Hirashima, M.
(Journal of Leukocyte Biology. 2003;73:650-656.)
© 2003 by Society for Leukocyte Biology

Potential roles of galectins in myeloid differentiation into three different lineages

Mohammad J. Abedin, Yumiko Kashio, Masako Seki, Kazuhiro Nakamura and Mitsuomi Hirashima

Department of Immunology and Immunopathology, Kagawa Medical University, Japan

Correspondence: Prof. Mitsuomi Hirashima, Department of Immunology and Immunopathology, Kagawa Medical University, 1750-1 Ikenobe, Miki-Cho, Kita-Gun, Kagawa 761-0793, Japan. E-mail: mitsuomi{at}kms.ac.jp


arrow
ABSTRACT
 
Little is known about the roles of galectins, a family of ß-galactoside-binding lectins, in myeloid cell differentiation. In the present experiments, we used HL-60 cells as a model of myeloid cell differentiation. The HL-60 cells were differentiated into eosinophil-, monocyte-, and neutrophil-like cells by coculture with sodium butyrate under a mild alkaline condition, phorbol 12-myristate 13-acetate, and dimethyl sulfoxide, respectively. Thus, the expression of galectins in HL-60 cells during differentiation into three different lineages was assessed. Reverse transcriptase-polymerase chain reaction analyses revealed that undifferentiated HL-60 cells expressed galectin-1, -3, -8, -9, and -10 (identical to Charcot Leyden crystal) mRNAs, and galectin-2, -4, and -7 were negligible before and after the differentiations. We failed to detect evident changes in the mRNA levels of galectin-1 and -8 during the differentiations. However, during the eosinophilic differentiation, galectin-9 mRNA expression was gradually decreased, whereas galectin-10 mRNA expression was increased. During the course of monocytic differentiation, galectin-9 mRNA expression was down-regulated, whereas galectin-3 mRNA expression was up-regulated. Moreover, only galectin-10 mRNA expression was enhanced in the process of neutrophilic differentiation. These changes in galectin expressions were confirmed by Western blot and flow cytometry analyses. It is thus suggested that changes in the expressions of galectin-3, -9, and -10 are potentially important for myeloid cell differentiation into specific lineages.

Key Words: HL-60 • eosinophil • neutrophil • monocyte


arrow
INTRODUCTION
 
HL-60, a human promyelocytic leukemic cell line, has been widely studied as a model of myeloid cell differentiation [1 , 2 ]. This cell line proliferates as promyelocytes, but it maturates beyond the promyelocyte stage by coculturing with some external chemical agents. For example, when HL-60 cells are exposed to dimethyl sulfoxide (DMSO), they lose their proliferative potential [3 ] and show sharply decreased expression of oncogene products (c-myc and c-fos) [4 , 5 ]. After 5–7 days culture with DMSO, HL-60 cells show characteristic neutrophilic morphology [3 ]. In contrast, exposure of HL-60 cells to phorbol 12-myristate 13-acetate (PMA) or to sodium butyrate under a mild alkaline condition induces differentiation into monocyte- and eosinophil-like cells, respectively [6 7 8 9 ].

The galectins are a rapidly growing family of ß-galactoside-binding lectins [10 11 12 13 14 15 16 17 18 19 ]. They have two essential biochemical properties: affinity for ß-galactoside sugars [i.e., a carbohydrate-recognition domain (CRD)] and characteristic, homologous amino acid sequences. All known galectins lack a signal peptide and are supposed to be secreted as soluble proteins by a nonclassical secretory pathway [15 ]. Thus far, 14 galectins (galectin-1 to -14) have been discovered in mammals. Among them, galectin-1, -2, -5, -7, -10, -11, -13, and -14 (prototype galectins), and galectin-3 (chimera-type galectin) have a single CRD, whereas galectin-4, -6, -8, -9, and -12 (tandem-repeat-type galectins) have two homologous CRDs [14 , 15 ]. Analysis of GenBank databases has led to the identification of more galectin-like proteins in mammals, invertebrates, and plants, confirming that these carbohydrate-binding proteins have been highly conserved throughout evolution [14 ]. Galectins, including galectin-1, -3, -8, and -9, are expressed with a broad tissue distribution [16 , 17 , 20 , 21 ], whereas the expression pattern of some galectins, such as galectin-2, -4, and -7, is restricted to a few cell types and tissues [14 ]. Among the various galectins, galectin-1 and -3 have been well studied [22 23 24 25 26 27 ]. Implications regarding the involvement of galectins in a wide variety of functions, such as cell adhesion, chemotaxis, cell-growth regulation, immunomodulation, cell differentiation, apoptosis [28 ], embryogenesis [29 ], metastasis, and pre-mRNA splicing, raise the possibility that galectins are widely used [17 18 19 20 21 22 23 24 25 26 27 ].

To our knowledge, no detailed study of galectins during myeloid differentiation has previously appeared. Therefore, in the present study, we measured the relative amount of various galectins in HL-60 cells that were differentiated into different lineages in response to butyrate, PMA, and DMSO. We confirmed the differentiations based on the morphological and functional changes in these HL-60 cells and analyzed the levels of galectins in the process of HL-60 differentiation into each lineage by reverse transcriptase-polymerase chain reaction (RT-PCR), flow cytometry, and Western blot analyses.


arrow
MATERIALS AND METHODS
 
Cell culture and differentiation
HL-60 cells were maintained in RPMI-1640 medium (Sigma Chemical Co., St. Louis, MO) containing 10% heat-inactivated fetal calf serum (FCS; Intergen Co., Purchase, NY), 50 IU/ml penicillin, 50 µg/ml streptomycin, and 0.25 µg/ml amphotericin-B (Sigma Chemical Co.), buffered with 25 mM HEPES. pH was adjusted to 7.8. Cells were cultured to a density of 5 x 105 cells/ml. To differentiate the HL-60 cells into the eosinophilic lineage, they were passaged for more than 8 weeks in the indicated medium. Eosinophilic differentiation was induced by resuspending HL-60 cells in fresh medium and adding Na-butyrate at a final concentration of 0.5 mM [9 ]. Monocytic and neutrophilic differentiations were induced by PMA and DMSO at final concentrations of 160 nM and 176 mM, respectively, and at a pH of 7.2 [6 7 8 ]. The cells were cultured for 7 days in a humidified atmosphere of 5% CO2 at 37°C. Cell viability was determined by trypan blue exclusion and was always more than 91%, 90%, and 92% during the eosinophilic, monocytic, and neutrophilic differentiations, respectively.

Evaluation of differentiation
Cytospin slide preparations of 0.2 ml aliquots of cell suspension were prepared using a Shandon Southern Cytospin. Wright-Giemsa staining was done for the morphological assessment of the cells. Differentiations were confirmed by Luxol Fast Blue (LFB) stain, {alpha}-naphthyl acetate esterase (ANAE) stain, and naphthol AS-D chloroacetate esterase (CAE) stain for eosinophilic, monocytic, and neutrophilic lineages, respectively [30 ]. Moderately and strongly stained cells were regarded as the differentiated cells.

In vitro chemotaxis
Cellular chemotactic activity (CCA) was evaluated in vitro using eosinophil-, monocyte-, and neutrophil-like cells derived separately from HL-60 cells as described [31 ]. In brief, CCA was evaluated using a 48-well chamber (Neuro Probe, Gaithersburg, MD) containing a polyvinyl pyrrolidone (PVP)-free membrane with a 12-µm pore size. HL-60 cell-derived eosinophil-/monocyte-/neutrophil-like cells (1x106 cell/ml) and varied concentrations of the indicated chemoattractants were placed in the top and bottom chambers, respectively. After 2 h of incubation at 37°C in a humidified atmosphere of 5% CO2, the filters were removed and stained with Diff-Quick (Baxter Healthcare, Deerfield, IL). The respective numbers of stained eosinophil-/monocyte-/neutrophil-like cells were counted under a microscope. Five high-power fields (hpf; 40x10) were selected for cell counting using the calibrated graticule. CCA was presented as the mean number (±SEM) of migrated cells/5 hpf in triplicate.

RT-PCR analysis
Total RNA from HL-60 cells was isolated using the Trizol reagent (Gibco-BRL, Grand Island, NY) on the indicated days of differentiation. Total RNA (to be used as a positive control in the RT-PCR analysis of nonexpressed galectins, i.e., galectin-2, -4, and -7) from human placenta was isolated in the same condition. Using a Gene Amp RNA PCR kit (Perkin-Elmer, Wellesley, MA), 0.5 µg total RNA was reverse-transcribed to DNA (RT) in one step followed by a PCR to amplify transcripts of human galectin-1, -2, -3, -4, -7, -8, -9, and -10 and glyceraldehyde 3-phosphate dehydrogenase (G3PDH). RT reaction and PCR steps were performed following the instructions provided by the manufacturer. The following primer sequences (synthesized at Amersham Pharmacia Biotech, Little Chalfont, UK) were used: galectin-1 sense: TGGTCGCCAGCAACCTGAATCTCA, galectin-1 antisense: TAGTTGATGGCCTCCAGGTTGAGG; galectin-2 sense: AAGATCACAGGCAGCATCGCCGAT, galectin-2 antisense: CTTACGCTCAGGTAGCTCAGGTGG; galectin-3 sense: ACCCATCTTCTGGACAGCCAAGTG, galectin-3 antisense: CACTGCAACCTTGAAGTGGTCAGG; galectin-4 sense: CACATGAAGCGGTTCTTCGTGAAC, galectin-4 antisense: TCAGCTGTTGATGGCAATGTCCGG; galectin-7 sense: TCCCAATGCCAGCAGGTTCCATGT, galectin-7 antisense: GAAGCCGTCGTCTGACGCGATGAT; galectin-8 sense: TCCAGGTGGATCTGCAGAATGGCA, galectin-8 antisense: GATCCTGTGGCCATAGAGCAGAGT; galectin-9 sense: CAGGCACCCATGGCTCAAACTAC, galectin-9 antisense: TATCAGACTCGGTAACGGGGGT; galectin-10 sense: GACAATCAAAGGGCGACCAC, galectin-10 antisense: ATCCCAAGTTCACGTAGAGACAGG.

Thirty PCR cycles were used for amplification of all transcripts, and all reactions were performed in a Gene Amp PCR System 9600 (Perkin-Elmer Applied Biosystems, Boston, MA). PCR products were run on a 1.5% agarose gel containing ethidium bromide (1 µg/ml) for visualization under UV. The intensity of bands was quantified using the NIH Image 1.61 program.

Reagents
Glutathione-S-transferase (GST) fusion proteins containing galectin-3, -9, and -10, respectively, were prepared and cleaved to remove GST. Recombinant proteins were used for immunization of rabbits. Rabbit antibodies to human galectin-3, -9, and -10 were affinity-purified.

Flow cytometry analysis
To assess the amount of galectins on the cell surface, cells were collected by centrifugation and washed with phosphate-buffered saline (PBS) containing 0.01% Na-azide and 2% FCS, followed by an incubation of 1 h on ice with 25 µg/ml rabbit anti-galectin-3, -9, or -10 antibody. After two washes with PBS, cells were incubated on ice with 25 µg/ml fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit immunoglobulin G (IgG) antibody (Santa Cruz Biotechnology, Santa Cruz, CA) for 45 min. To assess the amount of intracellular galectins [32 33 34 ], experiments were conducted after a modification of the method described above. In brief, the cells were incubated in PBS containing 30 mM lactose monohydrate for 30 min to eliminate surface-bound galectin and were then fixed with ice-cold PBS containing 4% paraformaldehyde for 10 min. After washing with PBS, cells were resuspended in 25 µl saponin buffer (PBS containing 0.1% saponin and 10 mM HEPES buffer, pH 7.4). After addition of 25 µg/ml rabbit anti-galectin-3, -9, or -10 antibody in saponin buffer, the cells were incubated on ice for 1 h followed by a wash and incubation with FITC-conjugated goat anti-rabbit IgG antibody for 45 min.

Western blotting
Cell lysates were prepared by addition of an indicated volume (1x108 cells/ml) of lysis buffer (10 mM Tris HCl, 150 mM NaCl, 2 mM EDTA, 2 mM EGTA, 0.5 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, antipain, pepstatin-A, and 1 mM dithiothreitol) to cell pellets followed by sonication. An equal volume of 2x sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer was added to the cell lysate, and the sample mixtures were boiled for 5 min. Samples (106 cells/lane) were run on a 12% SDS-PAGE gel and were then transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad Laboratories, Hercules, CA). The membrane was blocked by 5% skim milk in Tris-buffered saline (TBS; Tris base 20 mM, NaCl 137 mM, pH 7.6). After three subsequent washes with washing buffer (1% skim milk in TBS containing 0.01% sodium azide), the membrane was incubated overnight with 0.5 µg/ml purified rabbit antigalectin-3, -9, or -10 antibodies at room temperature. The membrane was washed three times followed by incubation with horseradish peroxidase (HRP)-conjugated anti-rabbit antibody (Amersham Life Science, Little Chalfont, UK) for 2 h at room temperature. After three subsequent washes, the membrane was immersed in the enhanced chemiluminescence (ECL) reagents, and specific bands were visualized by exposing the membrane to an X-ray film.


arrow
RESULTS
 
Morphological changes in HL-60 cells after Na-butyrate, PMA, and DMSO stimulation
Results of cell stainings are shown in Figure 1A . Resting HL-60 cells contained few LFB-positive granules (Fig. 1A a) but possessed profuse LFB-positive granules after Na-butyrate (0.5 mM) stimulation for 7 days (Fig. 1A 1b) , proving the differentiation of HL-60 cells into the eosinophilic lineage. No or few ANAE-positive granules were found in resting HL-60 cells (Fig. 1A 1c) , whereas many ANAE-positive granules were found after PMA (160 nM) treatment for 7 days (Fig. 1A 1d) , proving monocytic differentiation. Resting HL-60 cells contained very few naphthol AS-D CAE-positive granules (Fig. 1A 1e) , although after treatment with DMSO (176 mM) for 7 days, a good number of naphthol AS-D CAE-positive granules (Fig. 1A 1f) were observed, proving neutrophilic differentiation.



View larger version (32K):
[in this window]
[in a new window]
  		Figure 1. Evaluation of differentiation. (A) Morphological changes in HL-60 cells after Na-butyrate, PMA, and DMSO stimulation: For 7 days, HL-60 cells were cultured without (a) or with (b) 0.5 mM Na-butyrate at pH 7.8; without (c) or with (d) 160 nM PMA at pH 7.2; and without (e) or with (f) 176 mM DMSO at pH 7.2. Cells were harvested on days 0 and 7. Cytospin slide preparations of suspension cultures were stained by LFB (a, b), ANAE (c, d), and naphthol AS-D CAE (e, f; original x500). (B) Percentage of differentiation of HL-60 cells into different lineages: The cells were collected at the indicated intervals during the three differentiations for purposes of morphological evaluation. The degree of differentiation is expressed as the percentage of positively stained cells with LFB stain ({square}), ANAE stain ({circ}), and naphthol AS-D CAE stain ({blacksquare}), respectively. Moderately and strongly stained cells were regarded as the differentiated cells. Representative data from one of three duplicate experiments are shown.

The numbers of LFB-positive, ANAE-positive, and naphthol AS-D CAE-positive cells were counted on days 0, 1, 4, and 7. The number of positive cells increased in an almost linear manner up to 7 days in all three differentiations (Fig. 1B) .

Functional changes in HL-60 cells after Na-butyrate, PMA, and DMSO stimulation
Results of chemotaxis of HL-60 cell-derived eosinophil-, monocyte-, and neutrophil-like cells toward lineage-specific chemoattractants are shown in Figure 2 . HL-60 cell-derived, eosinophil-like cells were attracted by galectin-9 (300 nM). The number of attracted cells was increased with the duration of stimulation. These differentiated cells were also attracted by eotaxin (5 nM) but not by other lineage-specific chemoattractants such as IL-8 or MCP-1 (Fig. 2A) . Conversely, HL-60 cell-derived, monocyte-like cells were attracted by MCP-1 (5 nM). The number of responding cells was increased with the duration of stimulation, whereas these cells were not attracted by IL-8, eotaxin, or galectin-9 (Fig. 2B) . IL-8 (5 nM) attracted HL-60 cell-derived, neutrophil-like cells, whereas other lineage-specific chemoattractants (MCP-1, eotaxin, or galectin-9) did not attract these cells (Fig. 2C) .



View larger version (21K):
[in this window]
[in a new window]
  		Figure 2. Chemotaxis of HL-60 cell-derived eosinophil-, monocyte-, and neutrophil-like cells toward lineage-specific chemoattractants. In the in vitro assays used in the experiments, a PVP-free membrane with a 12-µm pore size separates the top chamber, which contains HL-60 cell-derived eosinophil (A)-, monocyte (B)-, and neutrophil-like (C) cells from the bottom chamber, containing PBS with or without test chemoattractants. After 2 h of incubation at 37°C in a humidified atmosphere of 5% CO2, the filter was removed and stained with Diff-Quick. The data represent the mean number of HL-60 cells migrated ± SEM in triplicate assays. MCP-1, Monocyte chemoattractant protein-1; IL-8, interleukin-8.

These findings, taken together with the data of morphological changes, thus confirmed that HL-60 cells treated with the reagents were differentiated phenotypically and functionally into the respective lineages.

Time course of mRNA expression of galectins during differentiation of HL-60 cells into three lineages
The mRNA levels in galectins were analyzed on days 0, 1, 4, and 7 in three types of the differentiations using primers of eight known galectins (galectin-1 to -10; except galectin-5 and -6). Galectin -2, -4, and -7 mRNAs were not detectable at all. Galectin-1 and -8 mRNA expressions were detected at a constant level during the differentiations into the three lineages. Among the galectins tested, only galectin-3, -9, and -10 showed variable mRNA levels. Time courses of mRNA expression of galectins are described in Table 1 . All the changes in galectin-3, -9, and -10 mRNA expressions occurred in a time-dependent manner (Fig. 3A ). The respective galectin levels were semiquantified by the ratio of each galectin and G3PDH (data not shown). During eosinophilic differentiation, mRNA expression of galectin-9 showed a sixfold reduction, whereas mRNA expression of galectin-10 showed a 5.5-fold increase. Conversely, mRNA expression of galectin-9 showed a 3.4 -fold decrease, whereas mRNA expression of galectin-3 showed a threefold increase during monocytic differentiation. Moreover, during neutrophilic differentiation, a 7.4-fold up-regulation of galectin-10 mRNA expression was observed.


View this table:
[in this window]
[in a new window]
  		Table 1. Galectin mRNA Levels Detected by RT-PCR Analysis



View larger version (51K):
[in this window]
[in a new window]
  		Figure 3. Expression of mRNAs of galectins. (A) RT-PCR analysis of variably expressed galectins: Total RNA from HL-60 cells was isolated on the indicated days during the three differentiations. RT-PCR analysis was performed using primers of human galectin-3, -9, and -10 and G3PDH. An equal amount of total RNA of G3PDH was used as a control for the integrity of mRNA. PCR products were separated by 1.5% agarose gel electrophoresis, followed by staining with ethidium bromide (1 µg/ml) for visualization under UV. Galectin-9 and -10 mRNA levels during eosinophilic differentiation, galectin-9 and -3 mRNA levels during monocytic differentiation, and galectin-10 mRNA levels during neutrophilic differentiation are shown. (B) RT-PCR analysis of constantly expressed galectins: Total RNA was isolated from unstimulated and stimulated HL-60 cells. RT-PCR was performed using the primers of galectin-1 and -8 and G3PDH. mRNAs of unstimulated HL-60 cells and those of cells stimulated for 7 days with Na-butyrate, PMA, and DMSO are shown in lanes 1, 2, 3, and 4, respectively. (C) RT-PCR analysis of nonexpressed galectins: Total RNA was isolated from human placental tissue and unstimulated and stimulated HL-60 cells under the same, identical condition. RT-PCR was performed using the primers of galectin-2, -4, and -7 and G3PDH. mRNAs of unstimulated HL-60 cells and cells stimulated for 7 days with Na-butyrate, PMA, and DMSO are shown in lanes 2, 3, 4, and 5, respectively. As a positive control, human placental mRNA-derived signals are shown in lane 1. Representative data of one of three duplicate experiments are shown. bp, Base pairs.

In the case of the mRNAs of galectin-1 and -8, we failed to detect any evident changes before (lane 1) or after the differentiation into any lineage. Lanes 2, 3, and 4 indicate 7 days differentiation of HL-60-derived eosinophil-, monocyte-, and neutrophil-like cells, respectively (Fig. 3B) . Moreover, the mRNAs of galectin-2, -4, and -7 were negligible before (lane2) and after the differentiation. Lanes 3, 4, and 5 indicate 7 days differentiation of HL-60-derived eosinophil-, monocyte-, and neutrophil-like cells, respectively (Fig. 3C) . The mRNA-derived signals of placental galectin-2, -4, and -7, used as positive controls, are shown in lane 1 of Figure 3C .

Kinetics of expression of cytosolic and surface galectins
We confirmed the evidences found in the RT-PCR analysis by flow cytometry. Expressions of respective galectin levels were analyzed on days 0 and 7. Results of flow cytometry analysis of cytosolic galectins are shown in Figure 4A . Cytosolic galectin-9 was attenuated, and cytosolic galectin-10 was enhanced during eosinophilic differentiation. During monocytic differentiation, cytosolic galectin-9 was reduced, and cytosolic galectin-3 was up-regulated. In addition, increment of cytosolic galectin-10 was observed during neutrophilic differentiation.



View larger version (35K):
[in this window]
[in a new window]
  		Figure 4. Flow cytometry analysis. (A) Kinetics of expression of cytosolic galectins: The cells were collected before and after the differentiations. Cells were washed with 30 mM lactose monohydrate to eliminate surface-bound galectins, followed by fixation in 4% paraformaldehyde. After washing, cells were stained with rabbit anti-galectin-3, -9, and -10 antibodies, respectively, in saponin buffer, followed by staining with FITC-conjugated goat anti-rabbit IgG. (B) Kinetics of expression of surface galectins: The cells were stained with rabbit anti-galectin-3, -9, and -10 antibodies, respectively, followed by staining with FITC-conjugated goat anti-rabbit IgG. The thin line represents the fluorescence intensity of the control IgG, and the thick line represents the fluorescence intensity of the respective galectin. Representative data from one of three duplicate experiments are shown.

Results of flow cytometry analysis of surface galectins are shown in Figure 4B . Surface galectin-9 level was reduced, and surface galectin-10 level was enhanced during eosinophilic differentiation. During monocytic differentiation, surface galectin-9 level was decreased, and surface galectin-3 level was increased. In addition, up-regulation of surface galectin-10 was observed during neutrophilic differentiation. The changes in the surface galectins were loosely similar to those in the cytosolic galectins in all three differentiations, although the intensity of these changes was more marked in the cytoplasm.

Western blot of galectins from HL-60 cell-derived eosinophil-, monocyte-, and neutrophil-like cells
We further confirmed the data of RT-PCR and flow cytometry analyses by Western blot analysis, as shown in Figure 5 . To analyze the respective galectin levels, cell lysates were prepared on days 0, 1, 4, and 7. Galectin-9 expression was gradually decreased, and galectin-10 expression was gradually increased during eosinophilic differentiation. Moreover, during monocytic differentiation, galectin-9 was decreased, and galectin-3 was enhanced. During neutrophilic differentiation, the only change was that galectin-10 was gradually up-regulated.



View larger version (70K):
[in this window]
[in a new window]
  		Figure 5. Western blot analysis of galectins from HL-60 cell-derived eosinophil-, monocyte-, and neutrophil-like cells. Lysates of HL-60-derived eosinophil-, monocyte-, and neutrophil-like cells were prepared on days 0, 1, 4, and 7 of differentiations, followed by electrophoresis and transferral to a PVDF membrane. Western blot analysis was performed using purified rabbit anti-galectin-3, -9, and -10 antibody (0.5 µg/ml), respectively, followed by incubation in HRP-conjugated anti-rabbit antibody, and finally, specific bands were visualized by immersing the membrane in the ECL reagents. Representative data from one of three duplicate experiments are shown.


arrow
DISCUSSION
 
Galectin-9 is a T cell-derived, novel eosinophil-activating factor that exhibits potent chemoattractant activity [31 , 35 , 36 ]. We have described here that HL-60 cell-derived, eosinophil-like cells, like normal human eosinophils, are attracted by galectin-9 and eotaxin (Fig. 2A) . Therefore, those HL-60 cell-derived, eosinophil-like cells could be substituted for human eosinophils in the routine chemoattraction assay in the laboratory to study the molecular mechanism of chemoattractant activity of galectin-9 for eosinophils. This would be very useful, given that human eosinophils are often difficult to obtain in large quantities.

Recently, we reported that galectin-9 is associated not only with chemoattraction but also with apoptosis of eosinophils [37 ], implying that those cells must express the receptors for galectin-9, which remains to be biochemically characterized. Similarly, based on the fact that galectin-3 is a potent chemoattractant for monocytes and macrophages, HL-60-derived, monocyte-like cells can be substituted for monocytes and macrophages to study the functions of galectin-3 [38 ].

Our present data reveal that the levels of galectin-3, -9, and -10 change, in a time-dependent manner, during the differentiations into the three different lineages (Figs. 3 and 5) . It has been well established that galectin-3 expression is intimately related to the process of myeloid differentiation [39 ], especially in macrophage differentiation [40 ]. The fact that galectin-3 expression is up-regulated during the differentiation of HL-60 cells into monocytic lineage also supports the above evidence (Figs. 3 and 5) .

Butyrate induces down-regulation of galectin-9 mRNA and up-regulation of galectin-10 mRNA during eosinophilic differentiation (Fig. 3A) . PMA induces reduction of galectin-9 mRNA and increment of galectin-3 (and no increment of galectin-10 mRNA) during monocytic differentiation (Table 1) . Moreover, during neutrophilic differentiation, DMSO induces up-regulation of galectin-10 mRNA only (Fig. 3A) . Therefore, the present results imply that the signal for various galectin expressions differs according to the type of myeloid differentiation, although the mechanism of regulation has not yet been clarified.

We found that galectin-10 was up-regulated during not only eosinophilic but also neutrophilic differentiations of HL-60 cells (Fig. 3A) . This Charcot Leyden crystal (CLC) protein is spontaneously crystallized in allergic, inflammatory areas [41 , 42 ]. Therefore, the possibility cannot be excluded that neutrophils are also the source of CLC protein in these sites. Although CLC protein has been thought to be dominant in eosinophils, it has been shown that neutrophils also contain CLC protein–one-eighth times as much protein as eosinophils include [43 ]–and that they play a crucial role in the modulation of allergic conditions [44 , 45 ]. Furthermore, such a restricted expression pattern is similar to that of galectin-3 in macrophages, basophils, and mast cells [41 ]. It has been found that galectin-3 modulates adhesion and differentiation of myeloid cells [39 ]. Therefore, as its level is also up-regulated during eosinophilic and neutrophilic differentiation of HL-60 cells, it is possible that galectin-10 plays a similar role in the process of myeloid cell differentiation.

The present experiments could provide new information on the regulation of galectin-3, -9, and -10 in myeloid cell differentiation into specific lineages. Galectin expression is involved not only in myeloid cell differentiation but also in neoplasm biology. Indeed, higher galectin-3 and -8 expressions are frequently associated with poor prognosis [46 , 47 ], but higher galectin-9 expression is linked to better prognosis in melanoma patients [34 ]. Therefore, further study on the molecular mechanisms involved in galectin expressions and functions may open new avenues not only in basic biomedical research but also in disease diagnosis, prognosis, and clinical therapy.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by a grant from the Ministry of Education, Science, Sports and Culture, Japan. M. J. A. also acknowledges a scholarship from the Ministry of Education, Science, Sports and Culture, Japan.

Received April 3, 2002; revised October 11, 2002; accepted November 22, 2002.


arrow
REFERENCES
 
    1
  1. Newburger, P. E., Chovaniec, M. E., Greenberger, J. S., Cohen, H. J. (1979) Functional changes in human leukemic cell line HL-60. A model for myeloid differentiation J. Cell Biol. 82,315-322[Abstract/Free Full Text]
    2. 2
  2. Collins, S. J., Gallo, R. C., Gallagher, R. E. (1977) Continuous growth and differentiation of human myeloid leukemic cells in suspension culture Nature 270,347-349[CrossRef][Medline]
    3. 3
  3. Collins, S. J., Ruscetti, F. W., Gallagher, R. E., Gallo, R. C. (1978) Terminal differentiation of human promyelocytic leukemia cells induced by dimethyl sulfoxide and other polar compounds Proc. Natl. Acad. Sci. USA 75,2458-2462[Abstract/Free Full Text]
    4. 4
  4. Birnie, G. D. (1988) The HL60 cell line: a model system for studying human myeloid cell differentiation Br. J. Cancer Suppl. 9,41-45[Medline]
    5. 5
  5. Tsuda, T., Fukumoto, Y., Hamamori, T., Takai, Y. (1987) Involvement of two intracellular messenger systems, protein kinase C and cyclic AMP, in the regulation of c-fos gene expression in human promyelocytic leukemia (HL-60) cells J. Biochem. (Tokyo) 102,1579-1583[Abstract/Free Full Text]
    6. 6
  6. Rovera, G., Santoli, D., Damsky, C. (1979) Human promyelocytic leukemia cells in culture differentiate into macrophage-like cells when treated with a phorbol diester Proc. Natl. Acad. Sci. USA 76,2779-2783[Abstract/Free Full Text]
    7. 7
  7. Nuzhat, A., John, F. W., Maurice, J. W. (1991) The human promyelocytic HL-60 cell line: a model of myeloid cell differentiation using dimethyl sulphoxide, phorbol ester and butyrate Biochem. Int. 23,591-602[Medline]
    8. 8
  8. Boyd, A. W., Metcalf, D. (1984) Induction of differentiation in HL60 leukaemic cells: a cell cycle dependent all-or-none event Leuk. Res. 8,27-43[CrossRef][Medline]
    9. 9
  9. Fischkoff, S. A. (1988) Graded increase in probability of eosinophilic differentiation of HL-60 promyelocytic leukemia cells induced by culture under alkaline conditions Leuk. Res. 12,679-686[CrossRef][Medline]
    10. 10
  10. Wells, V., Mallucci, L. (1991) Identification of an autocrine negative growth factor: mouse beta-galactoside-binding protein is a cytostatic factor and cell growth regulator Cell 64,91-97[CrossRef][Medline]
    11. 11
  11. Levi, G., Tarrab-Hazdai, R., Teichberg, V. I. (1983) Prevention and therapy with electrolectin of experimental autoimmune myasthenia gravis in rabbits Eur. J. Immunol. 13,500-507[Medline]
    12. 12
  12. Offner, H. (1990) Recombinant human beta-galactoside binding lectin suppresses clinical and histological signs of experimental autoimmune encephalomyelitis J. Neuroimmunol. 28,177-184[CrossRef][Medline]
    13. 13
  13. Perillo, N. L., Marcus, M. E., Baum, L. G. (1998) Galectins: versatile modulators of cell adhesion, cell proliferation, and cell death J. Mol. Med. 76,402-412[CrossRef][Medline]
    14. 14
  14. Ravinovich, G. A., Rubinstein, N., Fainboim, L. (2002) Unlocking the secrets of galectins: a challenge at the frontier of glyco-immunology J. Leukoc. Biol. 71,741-752[Abstract/Free Full Text]
    15. 15
  15. Dunphy, J. L., Barcham, G. J., Bischof, R. J., Young, A. R., Nash, A., Meensen, E. N. (2002) Isolation and characterization of a novel eosinophil-specific galectin released into the lungs in response to allergen challenge J. Biol. Chem. 277,14916-14924[Abstract/Free Full Text]
    16. 16
  16. Leffler, H. (1997) Introduction to galectins Trends GlycoSci. Glycobiotech. 9,9-19
    17. 17
  17. Barondes, S. H., Castronovo, V., Cooper, D. N. W., Cummings, R. D., Hirabayashi, J., Hughes, C., Kasai, K-I., Leffler, H., Liu, F-T. (1994) Galectins: a family of animal beta-galactoside-binding lectins Cell 76,597-598[CrossRef][Medline]
    18. 18
  18. Rabinovich, G. A. (1999) Galectins: an evolutionarily conserved family of animal lectins with multifunctional properties; a trip from the gene to clinical therapy Cell Death Differ. 6,711-721[CrossRef][Medline]
    19. 19
  19. Hirashima, M. (1999) Ecalectin as a T cell-derived eosinophil chemoattractant Int. Arch. Allergy Immunol. 120,7-10
    20. 20
  20. Kasai, K-I., Barondes, S. H. (1991) Human breast carcinoma cDNA encoding a galactoside-binding lectin homologous to mouse Mac-2 antigen Gene 99,279-283[CrossRef][Medline]
    21. 21
  21. Vespa, G. N., Lewis, L. A., Kozak, K. R., Moran, M., Nguyen, J. T., Baum, L. G., Miceli, M. C. (1999) Galectin-1 specifically modulates TCR signals to enhance TCR apoptosis but inhibit IL-2 production and proliferation J. Immunol. 162,799-806[Abstract/Free Full Text]
    22. 22
  22. Inohara, H., Akahani, S., Raz, A. (1998) Galectin-3 stimulates cell proliferation Exp. Cell Res. 245,294-302[CrossRef][Medline]
    23. 23
  23. Perillo, N. L., Pace, K. E., Scilhamer, J. J., Baum, L. G. (1995) Apoptosis of T-cells mediated by galectin-1 Nature 378,736-739[CrossRef][Medline]
    24. 24
  24. Sato, S., Ouelett, N., Pelletier, I., Simard, M., Rancourt, A., Bergeron, M. G. (2002) Role of galectin-3 as an adhesion molecule for neutrophil extravasation during streptococcal pneumonia J. Immunol. 168,1813-1822[Abstract/Free Full Text]
    25. 25
  25. Inufusa, H., Nakamura, M., Adachi, T., Aga, M., Kurimoto, M., Nakatani, Y., Wakano, T., Miyake, M., Okuno, K., Shiozaki, H., Yasutomi, M. (2001) Role of galectin-3 in adenocarcinoma liver metastasis Int. J. Oncol. 19,913-919[Medline]
    26. 26
  26. Nangia-Makker, P., Honjo, Y., Sarvis, R., Akahani, S., Hogan, V., Pienta, K. J., Raz, A. (2000) Galectin-3 induces endothelial cell morphogenesis and angiogenesis Am. J. Pathol. 156,899-909[Abstract/Free Full Text]
    27. 27
  27. Matarrese, P., Fusco, P., Tinari, N., Natoli, C., Liu, F-T., Semeraro, M. L., Malorni, W., Iacobelli, S. (2000) Galectin-3 overexpression protects from apoptosis by improving cell adhesion properties Int. J. Cancer 15,545-554[CrossRef]
    28. 28
  28. Wada, J., Ota, K., Kumar, A., Wallner, E. I., Kanwar, Y. S. (1997) Developmental regulation, expression, and apoptotic potential of galectin-9, a beta-galactoside binding lectin J. Clin. Invest. 99,2452-2461[Medline]
    29. 29
  29. Saxen, L., Sariloa, H. (1987) Early organogenesis of the kidney Pediatr. Nephrol. 1,385-392[CrossRef][Medline]
    30. 30
  30. Yourno, J., Goldberg, J., Douglas, A. N., William, J. W. (1980) Rapid in situ cytochemical classification of CFU-C colonies in soft agar culture: permanent whole culture preparations J. Histochem. Cytochem. 28,991-996[Abstract]
    31. 31
  31. Matsushita, N., Nishi, N., Seki, M., Matsumoto, R., Kuwabara, I., Liu, F-T., Hata, Y., Nakamura, T., Hirashima, M. (2000) Requirement of divalent galactoside-binding activity of ecalectin/galectin-9 for eosinophil chemoattraction J. Biol. Chem. 275,8355-8360[Abstract/Free Full Text]
    32. 32
  32. Shankey, T. V. (1993) Analysis of intracellular antigens using direct antibody conjugates Robinson, J. P. eds. Handbook of Flow Cytometry Methods ,87 Wiley-Liss New York, NY.
    33. 33
  33. Krug, N., Madden, J., Redington, A. E., Lackie, P., Djukanovic, R., Schauer, U., Holgate, S. T., Frew, A. J., Howarth, P. H. (1996) T cell cytokine profile evaluated at the single cell level in BAL and blood in allergic asthma Am. J. Respir. Cell Mol. Biol. 14,319-326[Abstract]
    34. 34
  34. Kageshita, T., Kashio, Y., Yamauchi, A., Seki, M., Abedin, M. J., Nishi, N., Shoji, H., Nakamura, T., Ono, T., Hirashima, M. (2002) Possible role of galectin-9 in cell aggregation and apoptosis of human melanoma cell lines and its clinical significance Int. J. Cancer 99,809-816[CrossRef][Medline]
    35. 35
  35. Matsumoto, R., Matsumoto, H., Seki, M., Hata, M., Asano, Y., Kanegasaki, S., Stevens, R. L., Hirashima, M. (1998) Human ecalectin, a variant of human galectin-9, is a novel eosinophil chemoattractant produced by T lymphocytes J. Biol. Chem. 273,16976-16984[Abstract/Free Full Text]
    36. 36
  36. Chabot, S., Kashio, Y., Seki, M., Shirato, Y., Nakamura, K., Nishi, N., Nakamura, T., Matsumoto, R., Hirashima, M. (2002) Regulation of galectin-9 expression and release in Jurkat T cell line cells Glycobiology 12,111-118[Abstract/Free Full Text]
    37. 37
  37. Saita, N., Goto, E., Yamamoto, T., Cho, I., Tsumori, K., Kohrogi, H., Maruo, K., Ono, T., Takeya, M., Kashio, Y., Nakamura, K., Hirashima, M. (2002) Association of galectin-9 with eosinophil apoptosis Int. Arch. Allergy Immunol. 128,42-50[CrossRef][Medline]
    38. 38
  38. Sano, H., Hsu, D. K., Yu, L., Apgar, J. R., Kuwabara, I., Yamanaka, T., Hirashima, M., Liu, F-T. (2000) Human galectin-3 is a novel chemoattractant for monocytes and macrophages J. Immunol. 165,2156-2164[Abstract/Free Full Text]
    39. 39
  39. Le Marer, N. (2000) Galectin-3 expression in differentiating human myeloid cells Cell Biol. Int. 24,245-251[CrossRef][Medline]
    40. 40
  40. Liu, F-T., Hsu, D. K., Zuberi, R. I., Kuwabara, I., Chi, E. Y., Handerson, W. R., Jr (1995) Expression and function of galectin-3, a beta-galactoside binding lectin, in human monocytes and macrophages Am. J. Pathol. 147,1016-1028[Abstract]
    41. 41
  41. Dyer, K. D., Rosenberg, H. F. (2001) Transcriptional regulation of galectin-10 (eosinophil Charcot-Leyden crystal protein): a GC box (-44 to -50) controls butyric acid induction of gene expression Life Sci. 69,201-212[CrossRef][Medline]
    42. 42
  42. Ackerman, S. J., Swaminathan, G. J., Leonidas, D. D., Savage, M. P., Patrick, S., Parry, S., Nightingale, T., Acharya, K. R. (2000) Eosinophil proteins; structural biology of Charcot-Leyden crystal protein (Galectin-10): new insights into an old protein Respir. Med. 94,1014-1016[CrossRef]
    43. 43
  43. Spry, C. J. F. (1988) Eosinophils: A Comprehensive Review and Guide to the Scientific and Medical Literature ,64-65 Oxford Medical New York, NY.
    44. 44
  44. Yoshida, T., Kubota, Y., Nishimoto, M., Okada, H., Hirashima, M. (2002) CD35 expression on peripheral blood granulocytes of patients with atopic dermatitis J. Dermatol. Sci. 28,42-47[CrossRef][Medline]
    45. 45
  45. Burg, N. D., Pillinger, M. H. (2001) The neutrophil: function and regulation in innate and humoral immunity Clin. Immunol. 99,7-17[CrossRef][Medline]
    46. 46
  46. Shimonishi, T., Miyazaki, K., Kono, N., Sabit, H., Tuneyama, K., Harada, K., Hirabayashi, J., Kasai, K., Nakanuma, Y. (2001) Expression of endogenous galectin-1 and galectin-3 in intrahepatic cholangiocarcinoma Hum. Pathol. 32,302-310[CrossRef][Medline]
    47. 47
  47. Henno, S., Brichory, F., Langanay, T., Desrues, B., Bidon, N., Delaval, P., Ramee, M. P., Dazord, L., Caulet-Maugendre, S. (2002) Expression of Po66-CBP, a galectin-8, in different types of primary and secondary broncho-pulmonary tumors Oncol. Rep. 9,177-180[Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
S.-Y. Dai, R. Nakagawa, A. Itoh, H. Murakami, Y. Kashio, H. Abe, S. Katoh, K. Kontani, M. Kihara, S.-L. Zhang, et al.
Galectin-9 Induces Maturation of Human Monocyte-Derived Dendritic Cells
J. Immunol., September 1, 2005; 175(5): 2974 - 2981.
[Abstract] [Full Text] [PDF]

Home page
 Stem CellsHome page
V. Vas, R. Fajka-Boja, G. Ion, V. Dudics, E. Monostori, and F. Uher
Biphasic Effect of Recombinant Galectin-1 on the Growth and Death of Early Hematopoietic Cells
Stem Cells, February 1, 2005; 23(2): 279 - 287.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abedin, M. J.
Right arrow Articles by Hirashima, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abedin, M. J.
Right arrow Articles by Hirashima, M.