Journal of Leukocyte Biology BioLegend: Treg, Th17, Stem Cell
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klegeris, A.
Right arrow Articles by McGeer, P. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klegeris, A.
Right arrow Articles by McGeer, P. L.
(Journal of Leukocyte Biology. 2003;73:369-378.)
© 2003 by Society for Leukocyte Biology

Toxicity of human monocytic THP-1 cells and microglia toward SH-SY5Y neuroblastoma cells is reduced by inhibitors of 5-lipoxygenase and its activating protein FLAP

Andis Klegeris and Patrick L. McGeer

Kinsmen Laboratory of Neurological Research, University of British Columbia, Vancouver, Canada

Correspondence: Andis Klegeris, Kinsmen Laboratory of Neurological Research, University of British Columbia, 2255 Wesbrook Mall, Vancouver, British Columbia, V6T 1Z3, Canada. E-mail: aklegeri{at}interchange.ubc.ca


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To explore whether the proinflammatory products of the 5-lipoxygenase (5-LOX) pathway are involved in microglia-mediated toxicity toward neuronal cells, we evaluated the effects of 5-LOX inhibitors using an in vitro assay system where human neuronal SH-SY5Y cells are exposed to toxic secretions from THP-1 monocytic cells or human microglia. The specific 5-LOX inhibitors, REV 5901, zileuton, and 5-hydroxyeicosatetraenoic acid lactone; the nonselective LOX inhibitors, phenidone and dapsone; the dual 5-LOX/cyclooxygenase inhibitor, tepoxalin; and the selective inhibitor of the 5-LOX-activating protein (FLAP), MK-886, inhibited such toxicity. The toxicity was enhanced by the 5-LOX product leukotriene (LT)D4 and reduced by the selective cysteinyl LT receptor (CysLT1) antagonist MK-571. The mRNAs for 5-LOX and FLAP were detected in THP-1 cells and human microglia but not in SH-SY5Y cells. The data suggest that inhibition of proinflammatory LT production by 5-LOX inhibition could selectively reduce toxicity of microglial cells and thus be beneficial in neuroinflammatory diseases.

Key Words: Alzheimer’s disease • cytokines • leukotrienes • neurodegeneration • neuroinflammation • neurotoxicity


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Lipoxygenases (LOX) are a complex family of enzymes that peroxidize lipid membranes and are involved in the generation of a number of biologically active mediators. The enzyme 5-LOX (EC 1.13.11.34) is responsible for leukotriene (LT) synthesis. It converts arachidonic into 5-hydroxyeicosatetraenoic acid (5-HETE) and LTA4. The latter is further converted into LTB4 or cysteinyl-containing LTC4, LTD4, and LTE4. The cellular effects of LTB4 are mediated by two types of surface receptors (BLT1 and BLT2), and cysteinyl LTs are recognized by at least two different receptors (CysLT1 and CysLT2) [1 , 2 ]. LTs are the active principles in the slow-reacting substance of anaphylaxis. They also have other proinflammatory properties (for reviews, see refs. [3 4 5 6 ]) as well as possible roles in intracellular and intranuclear signaling [7 ]. 5-LOX is primarily localized in leukocytes. Studies on leukocytes have also identified a small nuclear membrane-associated protein, 5-LOX-activating protein (FLAP), which regulates 5-LOX activity [8 , 9 ]. 5-LOX products play an important role in inflammation. They may also be involved in neurodegenerative processes associated with aging [10 ], ischemia [11 12 13 ], stroke [14 ], and Alzheimer’s disease [15 , 16 ]. The prevalence of Alzheimer’s disease is reduced in leprosy patients treated with dapsone or drugs closely related to dapsone [17 ]. This observation, taken together with the fact that dapsone inhibits the generation of 5-LOX products [18 ], also indicates that the 5-LOX pathway could be involved in neurodegenerative processes.

Microglial cells represent the mononuclear phagocyte system in the brain [19 ]. These cells become chronically activated in a variety of neurodegenerative disorders. They are believed to play a crucial role in the evolution of Alzheimer’s disease (for reviews, see refs. [20 , 21 ]). Recent in vivo experiments show that LOX inhibitors (nordihydroguaiaretic acid and CI987) can prevent microglial activation induced by administration of lipopolysaccharide (LPS) or by spreading depression [22 , 23 ]. We showed that nordihydroguaiaretic acid, a nonspecific inhibitor of LOX and phospholipases, reduced toxicity of secretions from THP-1 cells toward neuronal SH-SY5Y cells [24 ]. This model was developed to simulate the effects of in vitro human microglial activation, which may reflect in vivo damage observed during disease processes. Our previous studies have shown that nonsteroidal, anti-inflammatory drugs and R-(-)-deprenyl, drugs that have been reported to be beneficial in Alzheimer’s disease, are also effective in this model [25 , 26 ]. To explore further involvement of the 5-LOX pathway in microglial toxicity, we studied the effects of two nonspecific LOX inhibitors, three specific 5-LOX inhibitors, and the FLAP inhibitor MK-886, using our standard toxicity assay and THP-1 cells as representatives of human microglial cells. THP-1 cells are transformed human mononuclear cells that have a range of properties similar to microglia and other mononuclear phagocytes, including release of such products as superoxide anion, tumor necrosis factor {alpha}, interleukin-1ß (IL-1ß), prostaglandin E2, and as yet unidentified neurotoxins [24 , 27 28 29 30 31 ]. Another important advantage in using this human cell line instead of the rodent primary microglial cells is the fact that these cells, like most of the human mononuclear phagocytes including microglia, do not readily express inducible nitric oxide (NO) synthase [32 , 33 ]. High NO concentrations are known to be toxic to neurons and are secreted by rodent macrophages/microglia in response to a variety of standard macrophage stimulants such as LPS, interferon-{gamma} (IFN-{gamma}), and Alzheimer ß-amyloid peptide. Therefore, NO dominates among rodent microglial neurotoxic secretions in in vitro [34 , 35 ] and in vivo [36 , 37 ] models, but in human tissues, neurotoxicity is likely a result of other actors.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents
The 5-LOX inhibitors and their sources were as follows: REV 5901 and 5-HETE lactone were from Cayman Chemical (Ann Arbor, MI); zileuton (N-{1-[benzo-(b)-thien-2-yl]ethyl}-N-hydroxyurea) [38 ] and the mixed 5-LOX/cyclooxygenase inhibitor tepoxalin [39 ] were a kind gift from Dr. John L. Wallace (Department of Pharmacology and Therapeutics, University of Calgary, AB, Canada); phenidone (1-phenyl-3-pyrazolidinone) was from Aldrich (Milwaukee, WI); dapsone (4,4'-diaminodiphenyl sulfone) was from Sigma Chemical Co. (St. Louis, MO); and the selective FLAP inhibitor MK-886 was from Biomol (Plymouth Meeting, PA). LTD4 was purchased from Cayman Chemical, and the selective CysLT1 antagonist MK-571 [1 , 40 ] was from Biomol. The following substances used in various assays were obtained from Sigma Chemical Co.: bacterial LPS (from Escherichia coli 055:B5), diaphorase (EC 1.8.1.4, from Clostridium kluyveri, 5.8 Units mg-1 solid), dimethyl sulfoxide, p-iodonitrotetrazolium violet, nicotinamide adenine dinucleotide (NAD)+, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), and phosphatase substrate Sigma 104. Human recombinant (hr)IFN-{gamma} was purchased from Bachem California (Torrance). Antibodies used for Western blotting were from Cayman Chemical (rabbit polyclonal anti-5-LOX, 1:1000 dilution) and from Merck Frosst Canada (Kirkland, PQ; rabbit polyclonal anti-FLAP, H4 TB4, 1:300) [9 ], and peroxidase-labeled anti-rabbit antibodies (1:5000) were purchased from Sigma Chemical Co. Antibodies used for immunocytochemistry included rabbit polyclonal antiglial fibrillary acidic protein (GFAP), used at 1:20,000 dilution, mouse monoclonal anti-CD68, used at 1:400 (both from Dako, Carpinteria, CA), and rabbit polyclonal anti-5-LOX antibodies (from Cayman Chemical), used at 1:400. Antibodies used in enzyme-linked immunosorbent assay (ELISA) were as follows: for IL-1ß capture, a rabbit polyclonal (1:1000, a gift from Dr. Hermann Ziltener, The Biomedical Research Centre, Vancouver, BC, Canada); for IL-1ß detection, mouse monoclonal (1:50, obtained from Dr. Ann E. Berger, The Upjohn Co., Kalamazoo, MI); for IL-6 capture, a rat monoclonal (1:500 dilution, PharMingen, San Diego, CA); for IL-6 detection, a rabbit polyclonal (1:2000, ICN Biomedicals, Costa Mesa, CA). The alkaline phosphatase-labeled anti-mouse and anti-rabbit antibodies (1:3000) were supplied by Gibco-BRL, Life Technologies (Burlington, ON, Canada). hrIL-1ß and hrIL-6 used for ELISA calibrations were from Bachem California.

Cell culture
The human monocytic THP-1 cell line was obtained from the American Type Culture Collection (Manassas, VA). The human neuroblastoma SH-SY5Y cell line was a gift from Dr. Robert Ross (Department of Biological Sciences, Fordham University, Bronx, NY). These cells were grown in Dulbecco’s modified Eagle’s medium–nutrient mixture F12 ham (DMEM-F12) supplemented with 10% fetal bovine serum (FBS; from Gibco-BRL, Life Technologies). Both cell lines were used without initial differentiation.

Human microglial cells were isolated from surgically resected temporal lobe tissue. We thank Dr. John Maguire (Department of Pathology and Laboratory Medicine, Vancouver General Hospital, BC, Canada) for providing the surgical specimens. Protocols described by De Groot et al. [41 , 42 ] were used with minor modifications. Tissues were placed in a sterile Petri dish and rinsed with Hanks’ balanced salt solution (HBSS), and visible blood vessels were removed. After washing tissues two more times with HBSS, tissues were chopped into small (<2 mm3) pieces by using a sterile scalpel. The fragments were transferred into a 50-ml centrifuge tube containing 10 ml 0.25% trypsin solution and were incubated at 37°C for 20 min. Subsequently, DNase I (from bovine pancreas, Pharmacia Biotech, Baie d’Urfé, PQ, Canada) was added to reach a final concentration of 50 µg ml-1. Tissues were incubated for an additional 10 min at 37°C. The cell suspension was diluted with 10 ml DMEM-F12 with 10% FBS and was gently triturated by using a 10-ml pipette with a wide mouth. After centrifugation at 275 g for 10 min, the cell pellet was resuspended in the serum-containing medium, triturated several times, and passed through a 100-µm nylon cell strainer (Becton Dickinson, Franklin Lakes, NJ). The cell suspension was then centrifuged once more (275 g for 10 min), resuspended into 10 ml DMEM-F12 with 10% FBS containing gentamicin (50 µg ml-1), and plated onto uncoated 10 cm tissue-culture plates (Becton Dickinson). Plates were placed in a humidified 5% CO2, 95% air atmosphere at 37°C for 2 h to achieve adherence of microglial cells. Nonadherent cells with myelin debris were discarded by replacing the cell medium in the plates. Microglial cells were cultured for 5–7 days and were then detached from the plates by trypsinization (0.25% trypsin EDTA solution from Gibco-BRL, Life Technologies), resuspended into DMEM-F12 medium containing 5% FBS, and used for cytotoxicity experiments. Immunostaining (see below) with antibodies against CD68, which stains microglia as well as macrophages, and GFAP, which is a marker of astrocytes, showed that the isolated cultures contained 96.6 ± 0.5% (N=5) microglial cells. The viability of monocytic cells and microglia in the presence of various inhibitors was monitored visually with a phase-contrast microscope, by release of lactate dehydrogenase (LDH), and by the MTT assay that detects live cells (see below). The latter two assays were performed after 24 h incubation with the drug.

Reverse transcriptase-polymerase chain reaction (RT-PCR)
Total RNA from THP-1, human microglial, and SH-SY5Y neuronal cell cultures was isolated by using the Trizol reagent (Gibco-BRL, Life Technologies), according to the manufacturer’s instructions. RT-PCR analyses were performed essentially as described before [26 ]. The PCR primers used to detect 5-LOX (GenBank accession NM_000698) were: forward, 5' CTGTGGACGAGGAACTGGGCGAGAT 3'; reverse, 5' GATGCTCAAGGGGAAGCCAGGGTTC 3'. The PCR primers used to detect FLAP (GenBank accession X52195) were: forward, 5' ACTTGCCTTTGAGCGGGTCTACACT 3'; reverse, 5' GGAGATGGTGGTGGAGATCGTCTTT 3'. They were designed to produce specific fragments of 299 base pairs (bp; 5-LOX) and 325 bp (FLAP) spanning two and three introns, respectively. PCR amplification was performed using AmpliTaq Gold DNA polymerase (Perkin Elmer, Foster City, CA). The amplification program consisted of an initial denaturation step at 94°C, which was extended to 9 min to activate AmpliTaq Gold enzyme. This was followed by an annealing step at 55°C for 30 s and an initial synthesis step at 72°C for 3 min. The remaining cycles were 1 min at 94°C, 30 s at 55°C, and 1 min at 72°C. The number of cycles performed was 30 for FLAP and 33 for 5-LOX. It was extended to 42 cycles for those samples where no product could be observed after the initial amplification. After amplification, PCR products were separated in a 6% polyacrylamide gel and visualized by ethidium bromide staining. Polaroid photographs of the gels were taken.

Immunoblot analyses
Immunoblot analysis for 5-LOX and FLAP was performed according to standard protocols. Equivalent amounts of protein (40 µg per lane) were separated through 7.5% (5-LOX) or 15% (FLAP) polyacrylamide gels and transferred to Immobilon-P membranes (Millipore, Bedford, MA). Membranes were dried, and immunostaining was performed after 2 h pretreatment with 5% skimmed milk in tris-buffered saline. Membranes were incubated with the primary antibodies overnight at +4°C, followed by the secondary peroxidase-labeled antibodies for 1.5 h at room temperature. After an extensive (2 h) wash with tris-buffered saline containing 0.05% Tween-20, the specific bands were visualized by a chemiluminescence assay (Pierce Chemical Co., Rockford, IL). Up to 1 h exposure time was required.

Immunocytochemistry
Human microglial cell cultures were plated on glass coverslips and fixed by air-drying, followed by incubation for 10 min in 4% paraformaldehyde in phosphate-buffered saline (PBS). Subsequently, cell membranes were permeabilized with an 0.2% solution of Triton X-100 in PBS (5 min). Endogenous peroxidase was inactivated by incubation for 30 min with 0.5% hydrogen peroxide in PBS. Nonspecific binding sites were blocked by incubation for 1.5 h with 5% skim milk powder in PBS containing 1% of normal serum from the animal in which the secondary antibody was raised. Staining was performed by incubating cells overnight at room temperature with a primary antibody (see Reagents above), diluted in 2% skim milk powder in PBS. After several washes with PBS, the corresponding secondary biotinylated antibody was added at 1:1000, and cells were incubated for 1 h at room temperature. This was followed by PBS washes and 30 min incubation with the avidin-biotinylated horseradish peroxidase complex (1:1000, ABC Elite from Vector Laboratories, Burlingame, CA). After several PBS washes, peroxidase labeling was visualized by incubation in 0.3% 3,3-diaminobenzidine containing 1% nickel ammonium sulfate, 50 mM imidazole, and 0.001% hydrogen peroxide in 0.05 M tris-HCl buffer, pH 7.6. When a dark-blue color developed, sections were washed, mounted on glass slides, and coverslipped with Entellan (BDH, Toronto, ON, Canada). Controls without the primary antibody showed no significant staining.

Cytotoxicity of THP-1 cells and microglia toward SH-SY5Y neuroblastoma cells
The cytotoxicity experiments were performed as described previously [24 , 26 ]. Briefly, human monocytic THP-1 cells were seeded into 24-well plates at a concentration of 4 x 105 cells per well in 0.8 ml DMEM-F12 medium containing 5% FBS, and human microglial cells were used at a 5x lower concentration. The cells were incubated in the presence or absence of various drugs for 30 min before the addition of an activating stimulus (0.5 µg ml-1 LPS with 150 Units ml-1 IFN-{gamma}). After 24 h incubation, 0.4 ml cell-free supernatant was transferred to each well containing SH-SY5Y cells. The cells had been plated 24 h earlier at a concentration of 2 x 105 ml-1 in 0.5 ml DMEM-F12 medium containing 5% FBS. After 72 h of incubation, the neuronal culture media were sampled for LDH to determine release from dead cells, and evaluation of surviving cells was performed by the MTT assay. Various drugs were added to THP-1 cell cultures 30 min before their stimulation or directly to SH-SY5Y cells at the time when THP-1 cell supernates were transferred to wells with neuronal cells.

Cell viability assays: LDH release
Cell death was evaluated by LDH release. LDH activity in cell-culture supernatants was measured by an enzymatic test as described by Decker and Lohmann-Matthes [43 ], in which formation of the formazan product of iodonitrotetrazolium dye was followed colorimetrically. Briefly, 100 µl cell culture supernatants were pipetted into the wells of 96-well plates, followed by addition of 15 µl lactate solution (36 mg ml-1 in PBS) and 15 µl p-iodonitrotetrazolium violet solution (2 mg ml-1 in PBS). The enzymatic reaction was started by addition of 15 µl NAD+/diaphorase solution (3 mg ml-1 NAD+; 2.3 mg solid ml-1 diaphorase). After 15 min incubation, the reaction was terminated by addition of 15 µl oxamate (16.6 mg ml-1). Optical densities (OD) were measured by a microplate reader with a 490 nm filter, and the amount of LDH that had been released was expressed as a fraction of the value obtained in comparative wells, where the remaining cells were totally lysed by 1% Triton X-100. Values obtained in the presence of various inhibitors were normalized against values obtained with comparably stimulated THP-1 cells in the absence of inhibitors.

Cell viability assays: reduction of formazan dye (MTT)
The MTT assay was performed as described by Mosmann [44 ] and by Hansen et al. [45 ]. This method is based on the ability of viable but not dead cells to convert the tetrazolium salt (MTT) to colored formazan. The viability of SH-SY5Y cells was determined by adding MTT to the SH-SY5Y cell cultures to reach a final concentration of 1 mg ml-1. Following a 1-h incubation at 37°C, the dark crystals formed were dissolved by adding to the wells an equal volume of sodium dodecyl sulfate/dimethylformamide (SDS/DMF) extraction buffer (20% SDS, 50% N,N-DMF, pH 4.7). Subsequently, plates were placed overnight at 37°C, and OD at 570 nm were measured by transferring 100 µl aliquots to 96-well plates and using the platereader with a corresponding filter to record values. The viable cell value was calculated as a fraction of the value obtained from cells incubated with fresh medium only. Values obtained in the presence of various inhibitors were normalized against values obtained with comparably stimulated THP-1 cells in the absence of inhibitors.

Measurement of IL-1ß and IL-6
The concentrations of IL-1ß and IL-6 in cell-free supernates were measured after 48 h incubation by an ELISA as described previously for IL-1ß [46 ]. Briefly, cells were seeded into 24-well culture plates (0.6 ml, 5x105 cells ml-1). They were exposed to a combination of 0.5 µg ml-1 LPS and 150 Units ml-1 IFN-{gamma}, and after 48 h incubation, the concentration of cytokines in cell-free supernatants was measured as follows. Capture antibodies were diluted in 0.1 M bicarbonate-coating buffer, pH 8.2. Aliquots (50 µl) were added to each well of 96-well plates (Easy Wash, Corning, Corning, NY) and were incubated overnight at 4°C. Nonspecific binding sites were blocked by incubation of the wells with 200 µl 3% bovine serum albumin (BSA) in PBS for 2 h at room temperature. Samples and recombinant cytokine standards diluted in PBS/3% BSA were added at 100 µl per well, and plates were incubated overnight at 4°C. Detection antibodies were diluted in PBS/3% BSA and added at 100 µl to each well. Plates were incubated for 1 h at room temperature. The alkaline phosphatase-labeled antibody was added (1:3000 dilution) in PBS/3% BSA at 100 µl per well, followed by 45 min incubation at room temperature. After each of the above experimental steps, plates were washed two to eight times with 0.5% Tween in PBS, pH 7.0. OD at 405 nm was read by a microplate reader after 120 min incubation of wells with substrate buffer containing 1 mg ml-1 Sigma 104 phosphate substrate in 0.1 M diethanolamine buffer, pH 9.8. Concentrations of cytokines in the experimental samples were calculated according to the OD obtained from wells containing standards of recombinant cytokine. For each set of experiments, standard curves were run, where concentrations of cytokines were reduced to levels that were indistinguishable from readings obtained with media alone. These blank values were subtracted from readings of experimental samples. The detection limits, which correspond to media alone + 2 SD were 10.4 ± 3.4 mU ml-1 for IL-1ß and 2.4 ± 0.4 U ml-1 for IL-6.

Statistical analysis
Data are presented as means ± SEM. The concentration-dependent effects of various drugs were evaluated statistically by the randomized blocks design ANOVA. Statistical analyses were performed before transformation of data to percent values.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of 5-LOX and FLAP in the various cell types was studied first. RT-PCR experiments (Fig. 1 ) and immunoblotting (Fig. 2 ) indicated that the mRNA for 5-LOX and its activating protein FLAP are expressed at high levels in THP-1 cells but not in SH-SY5Y cells. PCR products yielded single bands of the predicted sizes of 299 bp for 5-LOX and 325 bp for FLAP. Immunoblots from THP-1 cells but not SH-SY5Y cells showed the presence of single bands, which corresponded well with the previously reported molecular sizes for 5-LOX (75–80 kDa) and FLAP (18 kDa) [4 , 9 ]. The mRNAs for 5-LOX and FLAP were detected in each of four postmortem microglial cell cultures that had been prepared according to our previously published procedure [25 ], but insufficient protein was available to permit immunoblotting analysis of these cells. As an alternative, immunocytochemistry was performed on microglial cell cultures obtained from surgical specimens. Staining of such cultures with antibodies against CD68 showed that the majority of cells (96.6±0.5%, N=5) were of microglial lineage (Fig. 3A ). When cell cultures were stained by antibodies recognizing 5-LOX (Fig. 3B) , cells with the same morphology were positive. The few remaining cells were astrocytes, as evidenced by their astrocytic morphology and positive staining for GFAP (Fig. 3C) .



View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. Polaroid photographs of a typical ethidium bromide-stained gel demonstrating PCR products for 5-LOX and FLAP mRNAs after 33 and 30 amplification cycles, respectively. The following amplification products are shown: Lane 1, human THP-1 monocytic cells (representative of five independent cultures); lane 2, SH-SY5Y neuroblastoma cells (representative of seven independent cultures); and lane 3, human postmortem microglia (representative of four independent cultures). Location of molecular size markers in base pairs is shown in the left lane. Notice that 5-LOX and FLAP mRNA bands are observed in human monocytic THP-1 and microglial cell extracts but not in the extracts of SH-SY5Y neuronal cells.

 


View larger version (10K):
[in this window]
[in a new window]
 
Figure 2. An example of immunoblot showing 5-LOX- and FLAP-specific bands in extracts of monocytic THP-1 and neuronal SH-SY5Y cells. Equivalent amounts of protein (40 µg per lane) were separated through 7.5% (5-LOX) or 15% (FLAP) polyacrylamide gels and visualized by a chemiluminescence assay. One-hour exposure time was required. Lane 1, Human THP-1 monocytic cells; lane 2, SH-SY5Y neuroblastoma cells. Location of molecular size markers (kDa) is shown in the left lane.

 


View larger version (60K):
[in this window]
[in a new window]
 
Figure 3. Immunostaining of cultures from surgically resected human temporal lobe tissue. (A) Microglial cell stained with an antibody to CD68; (B) staining of microglia with an antibody to 5-LOX; (C) staining of one of a small number of astrocytes that appeared in the cultures with an antisera to GFAP. Original calibration bar (50 µm) is for all three panels.

 
We tested the following 5-LOX and FLAP inhibitors for their ability to reduce the THP-1 cell toxicity toward SH-SY5Y neuroblastoma cells: the specific 5-LOX inhibitors, REV 5901, zileuton, and 5-HETE lactone; the nonselective LOX inhibitors, phenidone and dapsone; the selective FLAP inhibitor, MK-886; as well as the dual inhibitor of 5-LOX and cyclooxygenases, tepoxalin. When added to THP-1 cells 30 min before their stimulation, all of the above inhibitors reduced the toxicity of these cells toward neuronal SH-SY5Y cells (Fig. 4 ). Reduction of toxicity was assessed in two ways: through measurement of LDH released into the medium by cells dying after being exposed to the toxic medium (Fig. 4A) and through formazan reduction by cells surviving in culture, i.e., the MTT assay (Fig. 4B) . There was good agreement between the two independent methods.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4. Decreased toxicity of THP-1 monocytic cell secretions toward SH-SY5Y cells by inhibitors of 5-LOX and its activating protein FLAP. THP-1 cells were pretreated with various concentrations (µM) of inhibitors (shown on the ordinate) for 30 min before stimulation with LPS (0.5 µg ml-1) and IFN-{gamma} (150 Units ml-1). After 24 h incubation, the cell-free supernatants of THP-1 cells were transferred to the wells containing SH-SY5Y cells. Viability of SH-SY5Y cells was assessed after 72 h by measuring the LDH activity in the supernatants (A) and by the MTT assay (B). Data (means±SEM) are expressed as % control, where 100% (shown as a dashed line) is the value obtained from supernatants of stimulated THP-1 cells in the absence of drugs. The dash-dotted line represents the mean value obtained from supernatants of unstimulated THP-1 cells, and the dotted lines represent SEM intervals. The number of independent experiments for each set of data is also shown. The concentration-dependent effects of various drugs were assessed by randomized blocks design ANOVA; P values obtained for each of the drug treatments are presented in the figure.

 
Figure 4 shows the relative values of LDH released into the medium during 72 h of SH-SY5Y cultures in the presence or absence of inhibitors. The scale is in percent, where 100% represents zero concentration of the inhibitor (i.e., medium from stimulated THP-1 cells only). The reduction of LDH released in the presence of inhibitors therefore represents the degree of sparing achieved by each agent. In these experiments, each set of data was normalized to the zero drug concentration value. The fraction of cells surviving at the termination of the experiment was established by measuring LDH. In this way, it was determined that at zero inhibitor concentration, 48.4 ± 3.5% (N=40) of total cells were dead after 72 h. Culture with unstimulated THP-1 cell supernatants resulted in death of 6.1 ± 1% (N=12) at 72 h, similar to the death occurring in SH-SY5Y cells cultured in media alone. The order of potency on a molar basis for protecting SH-SY5Y cells (see Fig. 4A ) was 5-HETE lactone > MK-886 >= REV 5901 > tepoxalin > zileuton > phenidone > dapsone. The reductions varied between 26% and 68% according to the agent.

The MTT values (Fig. 4B) were also normalized to zero inhibitor concentration, which was again set at a base of 100%. The mean absolute value of live cells at zero inhibitor concentration was 49.7 ± 2.5 (N=40) of total cells after 72 h. In this case, the agents enhanced survival so that the effects were measured as a percent increase over the base value. The increases ranged up to 225%, with the order of potency roughly paralleling the LDH results. It is important to note that none of the drugs had any effect on viability of THP-1 cells as measured by LDH and MTT assays after the 24-h incubation period (data not shown). Preliminary results of the protective effects of MK-886 and REV 5901 have been published previously [47 ].

Viability was also examined after the drugs were administered to SH-SY5Y cells concomitantly with stimulated THP-1 cell supernates. Under these conditions, the MTT assay showed that no drug caused any significant increase in cell viability with one exception. Table 1 shows data obtained with three out of seven inhibitors including MK-886, which at a 2-µM concentration, increased SH-SY5Y survival by 31% (P<0.05, Fisher’s least significant differences test). The values of live cells in this series of experiments were similar to those obtained in the experiments shown in Figure 4 (57.0±2.8 percent, N=31).


View this table:
[in this window]
[in a new window]
 
Table 1. Various Inhibitors Are Not Neuroprotective Against Supernates from Stimulated THP-1 Cells When Added Directly to SH-SY5Y Neuroblastoma Cells (A) and Do Not Inhibit IL-1ß (B) and IL-6 (C) Secretion by THP-1 Cells

 
Figure 5 shows that the inhibitory effects of the FLAP inhibitor MK-886 on THP-1 cells were not confined to this particular cell line. MK-886 effectively inhibited cytotoxic activity of human microglial cells that were isolated from tissues of five cases that had undergone surgical temporal lobe resection. These cells, similar to THP-1 and human postmortem microglial cells [24 ], became toxic toward neuronal SH-SY5Y cells after LPS and IFN-{gamma} stimulation. The inhibitory effects of MK-886 on microglia were similar to those on THP-1 cells according to both assays used. Measurements of the viability of microglia after the 24-h incubation with the drug showed no decrease in microglial viability by MK-886 treatment.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. The specific FLAP inhibitor MK-886 in a concentration-dependent manner inhibits toxicity of human microglia derived from surgical specimens. Human microglial cells were pretreated with various concentrations of MK-886 (µM, shown on the abscissa) for 30 min before stimulation with LPS (0.5 µg ml-1) and IFN-{gamma} (150 Units ml-1). After 24 h incubation, the cell-free supernatants of microglial cells were transferred to the wells containing SH-SY5Y cells. The viability of SH-SY5Y cells was assessed after 72 h by measuring the LDH activity in the supernatants (A) and by the MTT assay (B). Data (means±SEM) are expressed as % dead (A) or live (B) cells. The concentration-dependent effect of MK-886 was assessed by randomized blocks design ANOVA. Data were obtained from five independent experiments; F and P values obtained for both assays are presented in the figure. Note that human microglial cells were used at a 5x lower concentration than THP-1 cells.

 
Three of the specific 5-LOX and FLAP inhibitors were also studied for their effect on cytokine secretion by THP-1 cells (Table 1) . Measurement of IL-1ß and IL-6 in cell-free supernates of THP-1 cells that had been stimulated with LPS (0.5 µg ml-1) and IFN-{gamma} (150 Units ml-1) 48 h earlier showed no significant effects of the drugs on these mononuclear cell functions (P>0.05, randomized blocks ANOVA).

Figure 6 shows data obtained by using the MTT assay, which demonstrates that the toxic action of THP-1 cells could be enhanced by LTD4, which is one of the products of the 5-LOX pathway. Conversely, the selective CysLT1 receptor antagonist MK-571 was able to reduce the toxicity of THP-1 cells (Fig. 6A) . Addition of these agents at the time of transfer of supernatants from stimulated THP-1 cells (Fig. 6B) had no effect on SH-SY5Y cell viability, indicating that these agents were acting only on the THP-1 cells after their activation. They had no effect on unstimulated THP-1 cells.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 6. THP-1 cell toxicity toward SH-SY5Y neuronal cells is enhanced by LTD4 and inhibited by the selective CysLT1 antagonist MK-571 only when they are added to THP-1 cells at the time of their stimulation. (A) THP-1 cells were treated with various concentrations (µM) of drugs (shown on the abscissa) concomitantly with their stimulation by a combination of LPS (0.5 µg ml-1) and IFN-{gamma} (150 Units ml-1). (B) Drugs were added to SH-SY5Y cells at the time of transfer of the supernatants from THP-1 cells that had been stimulated 24 h earlier with LPS (0.5 µg ml-1) and IFN-{gamma} (150 Units ml-1). Viability of SH-SY5Y cells was assessed after 72 h by the MTT assay. Data (means±SEM) are expressed as % control, where 100% is the value obtained from supernatants of stimulated THP-1 cells in the absence of drugs. The number of independent experiments for each set of data is also shown. The concentration-dependent effects of various drugs were assessed by randomized blocks design ANOVA; F and P values obtained for each of the drug treatments are presented in the figure.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The data obtained in this study show that inhibition of the 5-LOX pathway results in reduced toxicity of human mononuclear phagocytes toward human SH-SY5Y neuroblastoma cells. Three different inhibitors of 5-LOX, as well as MK-886, the inhibitor of FLAP, effectively reduced neuronal cell death induced by secretions from human monocytic THP-1 cells. The inhibitory effect of one of the inhibitors was also confirmed on human microglial cells isolated from surgical specimens. These observations fit well with the concept that the 5-LOX pathway leads to generation of substances that are proinflammatory and potentially harmful [48 , 49 ]. The data obtained are also consistent with observations made by using macrophages from 5-LOX gene knockout mice that show an impairment of bacterial phagocytosis [50 ]. As addition of exogenous LTB4 restored this function, Bailie et al. [50 ] concluded that in macrophages, LTB4 acts as an intracellular signaling molecule. Similarly, in our experimental model, inhibitors of 5-LOX were effective at reducing the toxicity of secretions from stimulated microglia or THP-1 cells but not at protecting neuronal cells when added directly to such secretions. Moreover, LTD4 enhanced the toxicity of THP-1 cell secretions when added to THP-1 cells at the time of their stimulation by LPS and IFN-{gamma} and failed to increase such toxicity when combined with the toxic supernatants after they had been transferred from THP-1 to SH-SY5Y cells. Consistent with these observations, the selective antagonist of CysLT1, the receptor that recognizes CysLTs [2 , 40 ], reduced the toxicity of THP-1 secretions when added to THP-1 cells but was also ineffective when applied to SH-SY5Y cells directly. This enhancing effect of LTD4 only occurred on stimulated THP-1 cells, indicating that these agents are acting synergistically with intracellular pathways engaged by the LPS and IFN-{gamma} stimulation.

The 5-LOX inhibitors were ineffective as direct, neuroprotective agents. Addition of various inhibitors to SH-SY5Y cells at the time of exposure to stimulated THP-1 cell supernates did not reduce neuronal cell death. As an exception, MK-886 had a small, protective effect when added at 2 µM, which may indicate that this drug exerts other effects not related to 5-LOX inhibition. The observed inability of 5-LOX inhibitors to protect neuronal cells directly is consistent with the data showing no effect of 5-LOX inhibition on neuronal death induced by such neurotoxic agents as NO [51 ] and Alzheimer ß-amyloid peptide [52 ].

The molecules that contribute to the neurotoxicity of secretions from stimulated microglia or mononuclear phagocytes are as yet unidentified (for a review, see ref. [53 ]). However, it appears that several intracellular signaling cascades, in addition to the 5-LOX pathway, are involved in inducing this effect [24 , 27 , 54 ]. Therefore it is likely that a combination of products is responsible for the overall activity. Our data support previous reports showing that 5-LOX and FLAP are present in the THP-1 cell preparations and that THP-1 cells have the capacity to synthesize 5-LOX products, such as 5-HETE and LTB4, thus providing direct evidence for the functionality of this pathway in THP-1 cells [55 56 57 ]. However our data point to the fact that LT products of this pathway may not be the substances responsible for the mononuclear cell toxicity but rather serve as intracellular stimulants that are used by these cells to up-regulate their secretion of neurotoxins. Our data suggest that inhibition of the 5-LOX pathway may allow selective control of monocytic cell toxicity without affecting other inflammatory functions such as the secretion of IL-1ß and IL-6 (see Table 1 ).

With respect to neuronal expression of 5-LOX and FLAP, we were unable to detect these mRNAs or proteins in neuroblastoma SH-SY5Y cells, which correlated well with the lack of any direct effect of the specific inhibitors. This may be a special property of the SH-SY5Y cell line, as 5-LOX and FLAP have been detected in human CHP100 neuroblastoma cells [58 ]. Nevertheless, this particular quality of SH-SY5Y cells provided us with an experimental advantage in that the effects on microglia-like cells can be distinguished from those on neuron-like cells. To the best of our knowledge, there are no other data available on the expression of these proteins by various cell types in human brain. RT-PCR analysis and immunocytochemistry of human microglial cells as described in this study indicate that human microglia contain these proteins. Nevertheless, this observation needs to be confirmed by in situ studies, especially as neurons have been reported to be the predominant cell type expressing 5-LOX in rats [10 ].

The concentrations of the specific inhibitors of 5-LOX and FLAP required to inhibit monocytic and microglial toxicity were above their reported inhibitory concentration (IC50) values as inhibitors of 5-LOX enzymatic activity. These values have been reported to be 0.7 µM for zilueton [3 ], 0.12 µM for REV 5901 [59 ], and 0.1 µM for MK-886 [60 ]. However, concentrations in the range of 1–10 µM of these inhibitors have been required to achieve biological effects in various in vitro assays (e.g., refs. [58 59 60 61 ]). This may reflect the need for 100% inhibition of LT synthesis before certain biological effects can be observed [60 ] or poor access by these inhibitors of their protein targets in intact cells and isolated tissues [59 , 61 ]. Kusner et al. [61 ] demonstrated that the IC50 for REV 5901 in isolated human lung tissue is 10 µM and that this inhibitor remains specific toward 5-LOX at concentrations as high as 50 µM. Nevertheless, the possibility that the various inhibitors used in this study may affect other cellular targets cannot be ruled out entirely.

The specific 5-LOX inhibitor zileuton and the dual 5-LOX/cyclooxygenase inhibitor tepoxalin have been used clinically. Plasma concentration of zileuton has been shown to peak at 15–20 µM with ~93% being bound to proteins [62 , 63 ], and concentration of tepoxalin reaches 1.3 µM and is sufficient to inhibit prostaglandin and LT production by human blood cells [64 ]. These concentrations are within the range sufficient to inhibit monocytic cell toxicity, and therefore, providing that these drugs penetrate the blood-brain barrier, it may be possible to use them to inhibit neuroinflammation.

In summary, our data suggest that inhibition of proinflammatory LT production could selectively reduce neurotoxicity of microglial cells and thus be beneficial in diseases where overactivation of microglia may contribute to the pathogenesis. The use of 5-LOX inhibitors in aging-associated brain pathology has been proposed on the basis of observations that neuronal 5-LOX is up-regulated in aging brain [10 ]. Therefore, this class of inhibitors may offer a double protection, acting directly on neurons as well as reducing microglial toxicity [15 ]. Selective 5-LOX inhibitors and CysLT1 antagonists are already available for clinical use and are prescribed for asthma treatment (see refs. [1 , 3 , 15 , 38 ]). The data from this study suggest that there may be a role for 5-LOX inhibitors in neuroinflammatory disorders possibly as a part of multitarget therapy. For example, simultaneous inhibition of 5-LOX and cyclooxygenases by different drugs or by dual inhibitors, such as tepoxalin, may provide increased benefits or permit decreased doses of individual drugs with toxic side-effects (see refs. [47 48 49 ]).


    ACKNOWLEDGEMENTS
 
This work was supported by a grant from the Jack Brown and Family Alzheimer’s Disease Research Fund and by a grant from the Alzheimer Society of Canada/CIHR/Astra Zeneca Canada.

Received October 9, 2002; revised December 10, 2002; accepted December 17, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Heise, C. E., O’Dowd, B. F., Figueroa, D. J., Sawyer, N., Nguyen, T., Im, D. S., Stocco, R., Bellefeuille, J. N., Abramovitz, M., Cheng, R., Williams, D. L., Jr, Zeng, Z., Liu, Q., Ma, L., Clements, M. K., Coulombe, N., Liu, Y., Austin, C. P., George, S. R., O’Neill, G. P., Metters, K. M., Lynch, K. R., Evans, J. F. (2000) Characterization of the human cysteinyl leukotriene 2 receptor J. Biol. Chem. 275,30531-30536[Abstract/Free Full Text]
  2. Sarau, H. M., Ames, R. S., Chambers, J., Ellis, C., Elshourbagy, N., Foley, J. J., Schmidt, D. B., Muccitelli, R. M., Jenkins, O., Murdock, P. R., Herrity, N. C., Halsey, W., Sathe, G., Muir, A. I., Nuthulaganti, P., Dytko, G. M., Buckley, P. T., Wilson, S., Bergsma, D. J., Hay, D. W. (1999) Identification, molecular cloning, expression, and characterization of a cysteinyl leukotriene receptor Mol. Pharmacol. 56,657-663[Abstract/Free Full Text]
  3. Bell, R. L., Harris, R. R. (1999) The enzymology and pharmacology of 5-lipoxygenase and 5-lipoxygenase activating protein Clin. Rev. Allergy Immunol. 17,91-109[Medline]
  4. Brash, A. R. (1999) Lipoxygenases: occurrence, functions, catalysis, and acquisition of substrate J. Biol. Chem. 274,23679-23682[Free Full Text]
  5. Kuhn, H., Thiele, B. J. (1999) The diversity of the lipoxygenase family FEBS Lett. 449,7-11[CrossRef][Medline]
  6. Samuelsson, B. (1983) Leukotrienes: mediators of immediate hypersensitivity reactions and inflammation Science 220,568-575[Abstract/Free Full Text]
  7. Haeggstrom, J. Z., Wetterholm, A. (2002) Enzymes and receptors in the leukotriene cascade Cell. Mol. Life Sci. 59,742-753[CrossRef][Medline]
  8. Miller, D. K., Gillard, J. W., Vickers, P. J., Sadowski, S., Leveille, C., Mancini, J. A., Charleson, P., Dixon, R. A., Ford-Hutchinson, A. W., Fortin, R. (1990) Identification and isolation of a membrane protein necessary for leukotriene production Nature 343,278-281[CrossRef][Medline]
  9. Woods, J. W., Evans, J. F., Ethier, D., Scott, S., Vickers, P. J., Hearn, L., Heibein, J. A., Charleson, S., Singer, I. I. (1993) 5-Lipoxygenase and 5-lipoxygenase-activating protein are localized in the nuclear envelope of activated human leukocytes J. Exp. Med. 178,1935-1946[Abstract/Free Full Text]
  10. Uz, T., Pesold, C., Longone, P., Manev, H. (1998) Aging-associated up-regulation of neuronal 5-lipoxygenase expression: putative role in neuronal vulnerability FASEB J. 12,439-449[Abstract/Free Full Text]
  11. Arai, K., Nishiyama, N., Matsuki, N., Ikegaya, Y. (2001) Neuroprotective effects of lipoxygenase inhibitors against ischemic injury in rat hippocampal slice cultures Brain Res. 904,167-172[CrossRef][Medline]
  12. Baskaya, M. K., Hu, Y., Donaldson, D., Maley, M., Rao, A. M., Prasad, M. R., Dempsey, R. J. (1996) Protective effect of the 5-lipoxygenase inhibitor AA-861 on cerebral edema after transient ischemia J. Neurosurg. 85,112-116[Medline]
  13. Ohtsuki, T., Matsumoto, M., Hayashi, Y., Yamamoto, K., Kitagawa, K., Ogawa, S., Yamamoto, S., Kamada, T. (1995) Reperfusion induces 5-lipoxygenase translocation and leukotriene C4 production in ischemic brain Am. J. Physiol. 268,H1249-H1257[Abstract/Free Full Text]
  14. Munsiff, A. V., Chander, P. N., Levine, S., Stier, C. T., Jr (1992) The lipoxygenase inhibitor phenidone protects against proteinuria and stroke in stroke-prone spontaneously hypertensive rats Am. J. Hypertens. 5,56-63[Medline]
  15. Manev, H., Uz, T., Sugaya, K., Qu, T. (2000) Putative role of neuronal 5-lipoxygenase in an aging brain FASEB J. 14,1464-1469[Abstract/Free Full Text]
  16. Manev, H. (2000) 5-Lipoxygenase gene polymorphism and onset of Alzheimer’s disease Med. Hypotheses 54,75-76[CrossRef][Medline]
  17. McGeer, P. L., Harada, N., Kimura, H., McGeer, E. G., Schulzer, M. (1992) Prevalence of dementia amongst elderly Japanese with leprosy: apparent effect of chronic drug therapy Dementia 3,146-149
  18. Wozel, G., Lehmann, B. (1995) Dapsone inhibits the generation of 5-lipoxygenase products in human polymorphonuclear leukocytes Skin Pharmacol. 8,196-202[Medline]
  19. Van Furth, R. (1989) Origin and turnover of monocytes and macrophages Curr. Top. Pathol. 79,125-150[Medline]
  20. . Neuroinflammation Working Group (2000) Inflammation and Alzheimer’s disease Neurobiol. Aging 21,383-421[CrossRef][Medline]
  21. McGeer, P. L., McGeer, E. G. (1999) Inflammation of the brain in Alzheimer’s disease: implications for therapy J. Leukoc. Biol. 65,409-415[Abstract]
  22. Caggiano, A. O., Kraig, R. P. (1996) Eicosanoids and nitric oxide influence induction of reactive gliosis from spreading depression in microglia but not astrocytes J. Comp. Neurol. 369,93-108[CrossRef][Medline]
  23. Willard, L. B., Hauss-Wegrzyniak, B., Danysz, W., Wenk, G. L. (2000) The cytotoxicity of chronic neuroinflammation upon basal forebrain cholinergic neurons of rats can be attenuated by glutamatergic antagonism or cyclooxygenase-2 inhibition Exp. Brain Res. 134,58-65[CrossRef][Medline]
  24. Klegeris, A., McGeer, P. L. (2000) Interaction of various intracellular signaling mechanisms involved in mononuclear phagocyte toxicity toward neuronal cells J. Leukoc. Biol. 67,127-133[Abstract]
  25. Klegeris, A., Walker, D. G., McGeer, P. L. (1999) Toxicity of human THP-1 monocytic cells towards neuron-like cells is reduced by non-steroidal anti-inflammatory drugs (NSAIDs) Neuropharmacology 38,1017-1025[CrossRef][Medline]
  26. Klegeris, A., McGeer, P. L. (2000) R-(-)-Deprenyl inhibits monocytic THP-1 cell neurotoxicity independently of monoamine oxidase inhibition Exp. Neurol. 166,458-464[CrossRef][Medline]
  27. Combs, C. K., Johnson, D. E., Cannady, S. B., Lehman, T. M., Landreth, G. E. (1999) Identification of microglial signal transduction pathways mediating a neurotoxic response to amyloidogenic fragments of ß-amyloid and prion proteins J. Neurosci. 19,928-939[Abstract/Free Full Text]
  28. Giulian, D., Vaca, K., Noonan, C. A. (1990) Secretion of neurotoxins by mononuclear phagocytes infected with HIV-1 Science 250,1593-1596[Abstract/Free Full Text]
  29. Lorton, D., Kocsis, J-M., King, L., Madden, K., Brunden, K. R. (1996) ß-Amyloid induces increased release of interleukin-1ß from lipopolysaccharide-activated human monocytes J. Neuroimmunol. 67,21-29[Medline]
  30. Schwende, H., Fitzke, E., Ambs, P., Dieter, P. (1996) Differences in the state of differentiation of THP-1 cells induced by phorbol ester and 1,25-dihydroxyvitamin D3 J. Leukoc. Biol. 59,555-561[Abstract]
  31. Yates, S. L., Burgess, L. H., Kocsis-Angle, J., Antal, J. M., Dority, M. D., Embury, P. B., Piotrkowski, A. M., Brunden, K. R. (2000) Amyloid ß and amylin fibrils induce increases in proinflammatory cytokine and chemokine production by THP-1 cells and murine microglia J. Neurochem. 74,1017-1025[CrossRef][Medline]
  32. Colton, C. A., Chernyshev, O. N., Gilbert, D. L., Vitek, M. P. (2000) Microglial contribution to oxidative stress in Alzheimer’s disease Ann. N. Y. Acad. Sci. 899,292-307[Abstract/Free Full Text]
  33. Denis, M. (1994) Human monocytes/macrophages: NO or no NO? J. Leukoc. Biol. 55,682-684[Abstract]
  34. Ii, M., Sunamoto, M., Ohnishi, K., Ichimori, Y. (1996) ß-Amyloid protein-dependent nitric oxide production from microglial cells and neurotoxicity Brain Res. 720,93-100[CrossRef][Medline]
  35. McMillian, M., Kong, L-Y., Mullis-Savin, S., Wilson, B., Das, K., Hudson, P., Hong, J-S., Bing, G. (1995) Selective killing of cholinergic neurons by microglial activation in basal forebrain mixed neuronal/glial cultures Biochem. Biophys. Res. Commun. 215,572-577[CrossRef][Medline]
  36. Liberatore, G. T., Jackson-Lewis, V., Vukosavic, S., Mandir, A. S., Vila, M., McAuliffe, W. G., Dawson, V. L., Dawson, T. M., Przedborski, S. (1999) Inducible nitric oxide synthase stimulates dopaminergic neurodegeneration in the MPTP model of Parkinson disease Nat. Med. 5,1403-1409[CrossRef][Medline]
  37. Weldon, D. T., Rogers, S. D., Ghilardi, J. R., Finke, M. P., Cleary, J. P., O’Hare, E., Esler, W. P., Maggio, J. E., Mantyh, P. W. (1998) Fibrillar ß-amyloid induces microglial phagocytosis, expression of inducible nitric oxide synthase, and loss of a select population of neurons in the rat CNS in vivo J. Neurosci. 18,2161-2173[Abstract/Free Full Text]
  38. McGill, K. A., Busse, W. W. (1996) Zileuton Lancet 348,519-524[CrossRef][Medline]
  39. Argentieri, D. C., Ritchie, D. M., Ferro, M. P., Kirchner, T., Wachter, M. P., Anderson, D. W., Rosenthale, M. E., Capetola, R. J. (1994) Tepoxalin: a dual cyclooxygenase/5-lipoxygenase inhibitor of arachidonic acid metabolism with potent anti-inflammatory activity and a favorable gastrointestinal profile J. Pharmacol. Exp. Ther. 271,1399-1408[Abstract/Free Full Text]
  40. Dahlen, S. E. (2000) Pharmacological characterization of leukotriene receptors Am. J. Respir. Crit. Care Med. 161,S41-S45[Free Full Text]
  41. De Groot, C. J. A., Langeveld, C. H., Jongenelen, C. A. M., Montagne, L., Van Der Valk, P., Dijkstra, C. (1997) Establishment of human adult astrocyte cultures derived from postmortem multiple sclerosis and control brain and spinal cord regions: immunophenotypical and functional characterization J. Neurosci. Res. 49,342-354[CrossRef][Medline]
  42. De Groot, C. J. A., Montagne, L., Janssen, I., Ravid, R., Van Der Valk, P., Veerhuis, R. (2000) Isolation and characterization of adult microglial cells and oligodendrocytes derived from postmortem human brain tissue Brain Res. Brain Res. Protoc. 5,85-94[CrossRef][Medline]
  43. Decker, T., Lohmann-Matthes, M. L. (1988) A quick and simple method for the quantitation of lactate dehydrogenase release in measurements of cellular cytotoxicity and tumor necrosis factor (TNF) activity J. Immunol. Methods 115,61-69[CrossRef][Medline]
  44. Mosmann, T. (1983) Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays J. Immunol. Methods 65,55-63[CrossRef][Medline]
  45. Hansen, M. B., Nielsen, S. E., Berg, K. (1989) Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill J. Immunol. Methods 119,203-210[CrossRef][Medline]
  46. Klegeris, A., McGeer, E. G., McGeer, P. L. (2000) Inhibitory action of 1-(2-chlorophenyl)-N-methyl-N-(1 methylpropyl)-3-isoquinolinecarboxamide (PK 11195) on some mononuclear phagocyte functions Biochem. Pharmacol. 59,1305-1314[CrossRef][Medline]
  47. Klegeris, A., McGeer, P. L. (2002) Cyclooxygenase and 5-lipoxygenase inhibitors protect against mononuclear phagocyte neurotoxicity Neurobiol. Aging 23,787[CrossRef][Medline]
  48. Bertolini, A., Ottani, A., Sandrini, M. (2001) Dual acting anti-inflammatory drugs: a reappraisal Pharmacol. Res. 44,437-450[CrossRef][Medline]
  49. Celotti, F., Laufer, S. (2001) Anti-inflammatory drugs: new multitarget compounds to face an old problem. The dual inhibition concept Pharmacol. Res. 43,429-436[CrossRef][Medline]
  50. Bailie, M. B., Standiford, T. J., Laichalk, L. L., Coffey, M. J., Strieter, R., Peters-Golden, M. (1996) Leukotriene-deficient mice manifest enhanced lethality from Klebsiella pneumonia in association with decreased alveolar macrophage phagocytic and bactericidal activities J. Immunol. 157,5221-5224[Abstract]
  51. Bastianetto, S., Zheng, W. H., Quirion, R. (2000) Neuroprotective abilities of resveratrol and other red wine constituents against nitric oxide-related toxicity in cultured hippocampal neurons Br. J. Pharmacol. 131,711-720[CrossRef][Medline]
  52. Lebeau, A., Esclaire, F., Rostene, W., Pelaprat, D. (2001) Baicalein protects cortical neurons from ß-amyloid (25-35) induced toxicity Neuroreport 12,2199-2202[CrossRef][Medline]
  53. Giulian, D. (1999) Microglia and the immune pathology of Alzheimer disease Am. J. Hum. Genet. 65,13-18[CrossRef][Medline]
  54. McMillian, M. K., Vainio, P. J., Tuominen, R. K. (1997) Role of protein kinase C in microglia-induced neurotoxicity in mesencephalic cultures J. Neuropathol. Exp. Neurol. 56,301-307[Medline]
  55. Goppelt-Struebe, M., Schaefer, D., Habenicht, A. J. (1997) Differential regulation of cyclo-oxygenase-2 and 5-lipoxygenase-activating protein (FLAP) expression by glucocorticoids in monocytic cells Br. J. Pharmacol. 122,619-624[CrossRef][Medline]
  56. Riddick, C. A., Ring, W. L., Baker, J. R., Hodulik, C. R., Bigby, T. D. (1997) Dexamethasone increases expression of 5-lipoxygenase and its activating protein in human monocytes and LOX-1 cells Eur. J. Biochem. 246,112-118[Medline]
  57. Ring, W. L., Riddick, C. A., Baker, J. R., Glass, C. K., Bigby, T. D. (1997) Activated lymphocytes increase expression of 5-lipoxygenase and its activating protein in THP-1 cells Am. J. Physiol. 273,C2057-C2064[Abstract/Free Full Text]
  58. Maccarrone, M., Navarra, M., Corasaniti, M. T., Nistico, G., Finazzi-Agro, A. (1998) Cytotoxic effect of HIV-1 coat glycoprotein gp120 on human neuroblastoma CHP100 cells involves activation of the arachidonate cascade Biochem. J. 333,45-49
  59. Musser, J. H., Chakraborty, U. R., Sciortino, S., Gordon, R. J., Khandwala, A., Neiss, E. S., Pruss, T. P., Van Inwegen, R., Weinryb, I., Coutts, S. M. (1987) Substituted arylmethyl phenyl ethers. 1. A novel series of 5-lipoxygenase inhibitors and leukotriene antagonists J. Med. Chem. 30,96-104[CrossRef][Medline]
  60. Rouzer, C. A., Ford-Hutchinson, A. W., Morton, H. E., Gillard, J. W. (1990) MK886, a potent and specific leukotriene biosynthesis inhibitor, blocks and reverses the membrane association of 5-lipoxygenase in ionophore-challenged leukocytes J. Biol. Chem. 265,1436-1442[Abstract/Free Full Text]
  61. Kusner, E. J., Marks, R. L., Aharony, D., Krell, R. D. (1989) Inhibition by REV-5901 of leukotriene release from guinea-pig and human lung tissue in vitro Biochem. Pharmacol. 38,4183-4189[CrossRef][Medline]
  62. Braeckman, R. A., Granneman, G. R., Locke, C. S., Machinist, J. M., Cavannaugh, J. H., Awni, W. M. (1995) The pharmacokinetics of zileuton in healthy young and elderly volunteers Clin. Pharmacokinet. 29(Suppl. 2),42-48
  63. Wong, S. L., Awni, W. M., Cavanaugh, J. H., el-Shourbagy, T., Locke, C. S., Dube, L. M. (1995) The pharmacokinetics of single oral doses of zileuton 200 to 800 mg, its enantiomers, and its metabolites, in normal healthy volunteers Clin. Pharmacokinet. 29(Suppl. 2),9-21
  64. Waldman, S. A., Vitow, C., Osborne, B., Gillen, L., Argentieri, D. C., Wong, F. A., Smith, I. L., Chow, A. T., Misiti, J., Bjornsson, T. D. (1996) Pharmacokinetics and pharmacodynamics of tepoxalin after single oral dose administration to healthy volunteers J. Clin. Pharmacol. 36,462-468[Abstract]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klegeris, A.
Right arrow Articles by McGeer, P. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klegeris, A.
Right arrow Articles by McGeer, P. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS