PeproTech Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guyot, B.
Right arrow Articles by Mouchiroud, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guyot, B.
Right arrow Articles by Mouchiroud, G.
(Journal of Leukocyte Biology. 2003;73:263-272.)
© 2003 by Society for Leukocyte Biology

Characterization of promoter elements directing Mona/Gads molecular adapter expression in T and myelomonocytic cells: involvement of the AML-1 transcription factor

B. Guyot and G. Mouchiroud

Centre de Génétique Moléculaire et Cellulaire, UMR CNRS 5534, Université Claude Bernard Lyon-1, Villeurbanne Cedex, France

Correspondence: G. Mouchiroud, Centre de Génétique Moléculaire et Cellulaire, UMR CNRS 5534, Université Claude Bernard Lyon-1, Bâtiment Gregor Mendel, 16 rue Raphael Dubois, 69622 Villeurbanne Cedex, France. E-mail: gmouchir{at}biomserv.univ-lyon1.fr


arrow
ABSTRACT
 
Monocytic adaptor (Mona, also called Gads) is a molecular adaptor implicated in T cell activation and macrophage differentiation. The objective of this study was to identify elements regulating specific expression of Mona/Gads in human T cell and myelomonocytic cell lines. We first confirmed that the -2000 to +150 genomic region relative to the Mona gene transcription start site is sufficient to direct specific reporter gene expression in T cell lines, Jurkat, and MOLT-4 and in the immature myeloid cell lines, KG1a and RC2A. Deletion analysis and electrophoresis mobility shift assay identified several cis regulatory elements: overlapping initiator sequences, one interferon response factor-2 (IRF-2)-binding site at position -154, one GC box recognized by Sp1 and Sp3 at position -52, and two acute myeloid leukemia (AML)-1 binding sites at positions -70 and -13. Site-directed mutagenesis experiments indicated a key role of AML-1 for driving Mona expression in T cells and myeloid cells, and involvement of Sp1/Sp3 and IRF-2 transcription factors to modulate Mona expression in a cell-specific manner.

Key Words: hematopoiesis • signaling molecule • transcriptional regulation


arrow
INTRODUCTION
 
Leukocyte production and function are under the tight control of extrinsic factors including cytokines, growth factors, chemokines, integrins, and antigens. Stimulation of corresponding receptors allows accurate cellular response through recruitment and activation of signaling molecules organized in highly conserved modules [1 2 3 ]. However, a growing body of data suggest that signaling specificity may be achieved through lineage-restricted expression of signaling molecules, including molecular adapters, a class of molecules devoid of any enzymatic activity but possessing modular protein domains implicated in specific protein–protein interactions [4 ]. For example, the leukocyte-specific adaptor Slp76 is expressed in T cells, myeloid cells, and platelets [5 ]. Similarly, the Slp76 family member Slp65 is expressed only in B cells [6 ]. Furthermore, Slp76 or Slp65 gene disruption results in impaired development of corresponding lineages [6 7 8 ]. Thus, lineage-restricted expression of molecular adapters may contribute to signaling specificity, and studying the regulation of such molecules may consequently help to better understand the underlying mechanisms.

Monocytic adaptor (Mona, also called Gads) is a hematopoietic-specific adaptor that contains one Src homology (SH)2 and two SH3 domains, closely related to the corresponding domains of Grb2, and a unique proline/glutamate-rich region [9 ]. Mona is expressed in monocytic cells, T cells, and platelets [10 11 12 ], and mice deficient for Mona/Gads exhibit impaired T cell development as a result of a block in proliferation of CD4-CD8- thymocytes [13 ]. In addition to its function in T cell development, Mona may play an important role in platelet activation [13 ], monocytic differentiation [10 ], and macrophage colony-stimulating factor (M-CSF) signaling [14 ]. Thus, the specific function of Mona/Gads in cell signaling may primarily result from its expression pattern, raising the question of what mechanisms are controlling Mona/Gads expression in such different hematopoietic cell types as T lymphocytes, monocytic cells, and platelets.

We have previously shown that human Mona transcripts are specifically found in T cells, monocytic cells, and platelets [15 ]. Mona transcripts found in T cells and immature myelomonocytic cell lines differ from those found in platelets by their 5' untranslated region (UTR). The former cells express transcripts containing the so-called 1A 5' UTR, whereas Mona mRNA found in platelets and megakaryocytic cell lines contains 1B 5' UTR. Different promoters are likely responsible for expression of each Mona transcript [15 ]. Here, we have characterized the promoter, allowing specific expression of 1A transcripts using human T and myeloid cell lines.


arrow
MATERIALS AND METHODS
 
Cell culture
Cell lines were cultivated in RPMI containing Glutamax (Invitrogen, Carlsbad, CA), 10% heat-inactivated fetal calf serum (Sigma Chemical Co., St. Louis, MO), and antibiotics. All cultures were performed at 37°C in a humidified atmosphere containing 5% CO2.

Plasmids
Cloning 1A +150/Luc reporter construct, formerly pGL3 1A(-2000/+150), has been described previously [15 ]. For 5' deletion analysis of 1A promoter, 1A +150/Luc was digested with EcoRI/StuI and EcoRI/AflII, resulting in -2000 to -637 and -2000 to -235 deletions. Fragments were then blunt-ended with Klenow DNA polymerase and ligated following standard procedures. For -2000 to -148, -2000 to -100, -2000 to -74, and -2000 to -27 deletions, 1A +150/Luc was digested with exonuclease III digestion following standard procedures. All constructs were then deleted from +6 to +150 fragment by Spe 1/Pst 1 digestion, blunt-ending with Klenow DNA polymerase, and ligated, resulting in {Delta}-637/Luc, {Delta}-236/Luc, {Delta}-148/Luc, {Delta}-100/Luc, {Delta} -74/Luc, and {Delta} -27/Luc, respectively.

Transfection and reporter gene analysis
Transfection was performed by electroporation. Briefly, 5 x 106 cells in exponential growth phase were resuspended in 200 µl culture medium containing 20 µg DNA. For each experiment, 17 µg of the tested vector, based on pGL3, and 3 µg cytomegalovirus (CMV)-driven ß-galactosidase expression vector (CMV/Gal), used as transfection control, were cotransfected unless specified. After incubating cell suspension for 10 min on ice, electroporation was performed at 960 µFarads and 250 V for MOLT-4, and RC2A, 230 V for Jurkat, KG1a and U937, and 270 V for K562 cells. At 48 h post-transfection, luciferase and ß-galactosidase activities were measured using the luciferase reporter gene assay, high sensitivity, and the ß-galactosidase reporter gene assay (Roche Molecular Biochemicals, Indianapolis, IN), respectively, according to the manufacturer’s instructions. Luciferase activity was normalized to ß-galactosidase activity.

Primer extension analysis
Total RNA was purified from Jurkat cells with the RNeasy Maxikit (Qiagen, Valencia, CA), and Poly(A)+ RNAs were isolated using oligo(dT)-cellulose columns (Pharmacia Biotech, Uppsala, Sweden) following standard procedures. For primer extension, antisense primer (5'AGAGGGTGCAAGTTTACAGAT3') was labeled using [{gamma}-32P] adenosine 5'-triphosphate (ATP) and T4 polynucleotide kinase, and 2 x 105 counts were coprecipitated with 2 µg Jurkat poly(A)+ RNA. Hybridization was performed overnight at 30°C in 40 mM PIPES, pH 6.4, 400 mM NaCl, 1 mM EDTA, and 80% deionized formamide. Following precipitation and washing in ethanol, primers were extended using Omniscript reverse transcriptase (RT; Qiagen) for 90 min at 40°C. After digestion with 20 ng RNase A at 37°C for 30 min, reaction product was phenol/chloroform-extracted, precipitated, and resolved on a 7% polyacrylamide, 7.5 M urea, sequencing gel. In parallel, plasmid containing 400 pb genomic sequence surrounding the 5' end of 1A cDNA was subjected to Sanger sequencing reaction using the same primer, and reaction products were run on the same gel.

Nuclear extracts
Cells (1x108) were washed twice in ice-cold phosphate-buffered saline and were resuspended in buffer A [10 mM Hepes, pH 7.4, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol (DTT), and 1% Triton X-100], supplemented with cocktails of protease inhibitors, tyrosine phosphatase inhibitors, and serine/threonine phosphatase inhibitors (Sigma Chemical Co.). Cells were lysed in ice during 10 min, and nuclei were recovered by centrifugation at 4°C, 3500 g, for 5 min. Nuclei were then washed twice in buffer A, resuspended in buffer B (10 mM Hepes, pH 7.4, 420 mM NaCl, 0.2 mM EDTA, 0.5 mM DTT, and 25% glycerol), and supplemented with the same inhibitors as buffer A. After a 1-h incubation in ice, insoluble material was pelleted by centrifugation at 4°C, 16,000 g, for 5 min. Supernatants were used as the source of nuclear extracts and stored frozen in liquid nitrogen after measuring protein concentration with a Bio-Rad (Hercules, CA) protein assay.

Electrophoresis mobility shift assay (EMSA)
Complementary, single-strand oligonucleotides (Invitrogen) were annealed in 10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, by heating to 94°C for 2 min, 65°C for 5 min, and slow cooling at room temperature. Double-strand oligonucleotides were end-labeled using T4 polynucleotide kinase and [{gamma}-32P] ATP. Labeled oligonucleotides were purified by gel chromatography using Bio-Rad P6 mini-columns. Labeled oligonucleotides (1 ng) and nuclear extract (4 µg) were incubated for 30 min at 4°C in 20 µl binding buffer containing 10 mM Hepes, pH 7.4, 50 mM KCl, 5 mM MgCl2, 0.1 mM EDTA, 0.5 mM DTT, 0.1 mM phenylmethylsulfonyl fluoride, 100 µg/mL poly(dI-dC), and 7.5% glycerol. For supershift analysis and competition assays, 2 µl antibody or an excess of unlabeled, double-stranded oligonucleotides was incubated with nuclear extract in reaction buffer for 20 min at 4°C before addition of labeled probe. Samples were electrophoresed in a 4% nondenaturing polyacrylamide gel in 0.5 x tris-borate-EDTA (TBE) at 160 V and 4°C. Gels were fixed in 7% acetic acid, dried, and autoradiographied.

Sequences of one-strand of competitor oligonucleotides were as follows, with consensus sequences underlined and mutated bases in bold: Comp Sp1 wild type (WT), 5'-TTCGATCGGGGCGGGGCGAG-3'; Comp Sp1 Mut, 5'-TTCGATCGGTTCGTGTCGAG-3'; Comp acute myeloid leukemia (AML)-1 WT, 5'-CGAGTATTGTGGTTAATACG-3'; Comp AML-1 Mut, 5'-CGAGTATTGTTAGTAATACG-3'; Comp interferon (IFN) regulatory factor (IRF) WT, 5'-GTGATCTCGAAACTGAAACTGTCTAG-3'; Comp IRF Mut, 5'-GTGATCTC-GGGACTGAGGCTGTCTAG-3'.

Anti-AML-1 antibody was a kind gift of Dr. Noel Lenny (St. Jude Children’s Hospital, Memphis, TN). Anti-Sp1 and anti-Sp3 antibodies were generously provided by Dr. Steve Jackson (Wellcome/CRC Institute, Cambridge, UK) and Prof. Guntram Suske (Institut für Molekularbiologie und Tumorforschung, Marburg, Germany), respectively.

Site-directed mutagenesis
Mutants were generated using the QuickChange site-directed mutagenesis kit (Stratagene, San Diego, CA), according to the manufacturer’s instructions. Sequences of sense mutagenesis primers were as follows, with mutated bases underlined (antisense primer is strictly complementary): {Delta}AML-1-70, 5'-GGGCGTGAGCCTTAGATTATGTTAGTTTGTTTTCTTGCTGCC-3'; {Delta}AML-1-13, 5'-GTGCTAGTTCCTGTGTTAGTTGCCTACAGACTGCAG-3'; {Delta}initiator (Inr), 5'CTGTGTGGTTTGGGAAGAGAAGGCAGGGCTGACTAGG3'; {Delta}IRF-154, 5'-CAGGGGGGATATTGTTAGGACTGAGGCCAAGCATAAAGAAGC-3'; and {Delta}GC-52, 5'-CATAATCTAACGTCACTTGCAACTCTCCGAAGCCCC-3'.


arrow
RESULTS
 
The 5' flanking region of 5' UTR-1A shows specific promoter activity in 1A mRNA-expressing cells
To analyze the promoter region allowing 1A transcript expression, we previously amplified a 2-kbp genomic fragment upstream of the 5' UTR-1A of the human Mona gene. This genomic fragment, spanning -2000 to +150, relative to the first base of Mona 1A cDNA (GenBank accession number AY069959), showed promoter activity in Jurkat T cells, which express 1A mRNA, but not in K562 cells, which express 1B mRNA [15 ]. To better locate the 1A core promoter, we performed transcriptional start site (TSS) mapping by primer extension. Using poly(A)+ RNA from Jurkat cells, six major extension products were detected in two clusters (Fig. 1 ). TSS were found to be located at -263, -261, -260, -238, -237, and -233, relative to the first base of the translation start codon. It is interesting that TSS at -263 corresponds to the 5' end of the AY069959 sequence, which is the longest reported Mona 1A cDNA sequence, and was therefore considered as +1 position in the following experiments.



View larger version (89K):
[in this window]
[in a new window]
 
Figure 1. Mapping TSS by primer extension. Antisense oligonucleotide complementary to 1A cDNA was end-labeled with 32P and hybridized to poly-(A)+ RNA from Jurkat cells. After primer extension by RT, purified cDNA (lane J) were resolved alongside a set of dideoxy sequencing reactions (lanes G, A, T, and C) performed on a genomic fragment encompassing 1A 5' UTR using the same oligonucleotide as primer. Arrows indicate extended product positions relative to the first base of the translation initiation codon of Mona cDNA.

To confirm and extend previous data [15 ], representative human hematopoietic cell lines were transfected with the 1A+150/Luc construct, which contains the (-2000/+150) 1A fragment cloned upstream of the luc gene. As shown in Figure 2 , 1A+150/Luc showed promoter activity in cell lines expressing 1A mRNA but not in cell lines expressing 1B or no Mona mRNA. Thus, 1A+150/Luc was allowed to reproduce a specific pattern of 1A Mona gene expression in transfected cell lines, suggesting that the (-2000/+150) 1A sequence contains elements driving specific expression of the human Mona gene in T cells and myeloid cells.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. The (-2000/+150) genomic region flanking 5' UTR-1A promotes luciferase gene expression in 1A mRNA-expressing cells. The following cell lines were transfected with 1A+150/Luc vector: Jurkat and MOLT-4 (mature T-cells), KG1a and RC2A (immature myeloid cells), K562 (erythromegakaryocytic cells), and U937 (monocytic cells). To monitor transfection efficiencies, 1A+150/Luc (17 µg) was cotransfected with CMV/Gal (3 µg), and luciferase activity was normalized to ß-galactosidase activity. Results are given as normalized luciferase activity relative to the promoterless construct (pGL3 basic) baseline for each cell line. The data are expressed as mean ± SEM of triplicate cultures in an experiment representative of two (MOLT-4, RC2A, K562, and U937) or at least three (Jurkat and KG1a) independent experiments. Statistical significance was determined by Student’s t-test and is indicated by *, P< 0.05; **, P< 0.01; and ***, P< 0.001.

Role of Inr sequences in 1A promoter transcriptional activity
No TATA box or downstream promoter element (DPE) was detected in the putative promoter sequence cloned into 1A+150/Luc. It is interesting that TSS -263, -261, and -238 are in a good nucleotide context regarding the consensus Inr sequence (Fig. 3A ). As Inr sequences can interact with components of the basal transcription machinery [16 ], we asked whether TSS are involved in transcription initiation on the 1A promoter. Deleting the region encompassing TSS -238, -237, and -233 in 1A+150/Luc, subsequently resulting in 1A+6/Luc, had very little effect on promoter activity (Fig. 4A ; compare 1A+6/Luc and 1A+150/Luc). Then, TSS -263 and -261 were mutated by replacing all pyrimidines matching the consensus Inr sequence by purines, resulting in {Delta}Inr-1A+150/Luc. Figure 3B shows that mutation strongly reduced promoter activity to 15–20% of the WT promoter activity in Jurkat and KG1a cells. These results suggest that 1A core promoter is composed of two Inr sequences defining the major TSS.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 3. Inr elements are important for 1A promoter activity. (A, Upper) Genomic sequence surrounding TSS. Asterisks point to TSS, and putative Inr sequences are underlined. (Lower) Consensus sequences for mammalian Inr and nucleotide sequences surrounding TSS -263, -261, and -238 are aligned, and matching bases are underlined. (B) Mutation of Inr sequence at the 5' TSS cluster affects 1A promoter activity. Transfection of mutated ({Delta}Inr-1A+150/Luc) or WT (1A+150/Luc) constructs and data normalization were performed as specified in Figure 2 . The mean relative activity of 1A+150/Luc was taken as 100% for each cell line. Each point consists of triplicate cultures from an experiment representative of three independent experiments (mean±SEM). Statistical significance was determined by Student’s t-test on normalized luciferase activity data: **, Significance level at P< 0.01.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 4. Deletion analysis of regions involved in 1A promoter activity. (A) Jurkat and KG1a cells were cotransfected with constructs as specified, and luciferase activity was normalized and reported as in Figure 2 (mean±SEM). Data were derived from triplicate cultures in an experiment representative of at least two independent experiments, except for KG1a {Delta}-637/Luc and {Delta}-236/Luc (one experiment). Statistical significance was determined by Student’s t-test and is specified in the text. (B) Sequence of -236 to +6 genomic region. Position +1 corresponds to TSS -261. Putative transcription factor-binding sites are underlined. MZF-1, Myeloid zinc finger-1.

5' Deletion analysis of 1A promoter
To identify regions containing cis elements required for Mona 1A promoter activity, we performed a series of 5' deletions in 1A+6/Luc. Resulting constructs were transfected in the Jurkat T cell line and KG1a myelomonocytic cell line, representative of the two hematopoietic lineages expressing Mona 1A mRNA. Results are shown in Figure 4A . In both cell lines, deletion from -2000 to -637 ({Delta}-637/Luc) caused a significant loss (P<0.02) in promoter activity, and additional -637 to -236 deletion ({Delta}-236/Luc) did not result in further decrease (P>0.2). It is interesting that subsequent deletions had different effects on promoter activity in Jurkat and KG1a cells. Compared with {Delta}-236/Luc, promoter activity of {Delta}-148/Luc was significantly decreased in KG1a cells (P<0.001) but not in Jurkat cells (P>0.05), suggesting that region spanning of -236 to -148 differently contributes to 1A promoter activity dependent on cellular context. Subsequent deletions from -148 to -100 ({Delta}-100/Luc) and from -100 to -74 ({Delta}-74/Luc) did not affect the remaining promoter activity in both cell lines (P>0.1 and P>0.05, respectively). Finally, deletion from -74 to -27 ({Delta}-27/Luc) almost completely abolished promoter activity in Jurkat cells and KG1a cells (P<0.01).

Figure 4B shows putative high-affinity transcription factor-binding sites found in the -236 to +6 region using TFSEARCH (<http://molsun1.cbrc.aist.go.jp/research/db/TFSEARCH.html>) and MATINSPECTOR softwares (<http://www.genomatix.de/cgi-bin/matinspector.pl>). From this analysis, we inferred that the loss of MZF-1 and IRF sites in {Delta}-148/Luc might be the cause of decreased promoter activity in KG1a cells. Furthermore, two AML-1-binding sites and one GC box were found in the -74 to +6 region. Therefore, the contribution of each site to 1A promoter activity was investigated by combining EMSA and mutagenesis experiments.

Differential role of Sp1/Sp3 on 1A promoter activity
Nuclear factor binding on the GC box (-52) was investigated by EMSA using a 32P-labeled -69/-37 probe. Nuclear extracts from Jurkat cells formed two close complexes with this probe (Fig. 5A ). Both complexes could not form in the presence of an excess competitor-bearing consensus GC box, unless the competitor was mutated on the GC box, indicating specific nuclear factor binding to the GC box (Fig. 5A) . As the GC box is frequently bound by Sp1 family members [17 ], we investigated whether Sp1 or Sp3 could interact with the GC box (-52) by using specific antibodies in supershift experiments. Upper and lower complexes were shifted by anti-Sp1 and anti-Sp3 antibody, respectively, demonstrating specific binding of Sp1 and Sp3 proteins to the 32P-labeled -69/-37 probe (Fig. 5A) .



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5. Regulatory role of GC box (-52). (A) Sp1 and Sp3 transcription factors can interact with GC box (-52). Labeled (-69/-37) probe was incubated without (lane 1) or with (lanes 2–7) 4 µg nuclear extracts from Jurkat cells. Unlabeled, double-stranded competitors were added in 20-fold (lanes 2 and 4) or 50-fold (lanes 3 and 5) excess. Comp Sp1 WT (lanes 2 and 3) bore a consensus-binding site for Sp1 family transcription factors, and Comp Sp1 Mut (lanes 4 and 5) was a mutant of Comp Sp1 WT incapable of Sp1 binding. For supershift experiments, 1 µl rabbit polyclonal antiserum against Sp1 or Sp3 was added to the binding mixture in lanes 6 and 7, respectively. (B) Mutation of GC box (-52) differentially affects 1A promoter activity. In these experiments, 1A+150/Luc (17 µg), WT or mutated on a GC box (-52), was cotransfected with CMV/Gal (3 µg). Luciferase activity was normalized to ß-galactosidase activity, and the mean relative activity of 1A+150/Luc was taken as 100% for each cell line. Each point consists of triplicate cultures from an experiment representative of two independent experiments (mean±SEM). Statistical significance was determined by Student’s t-test and is indicated by *, P< 0.05; **, P< 0.01; and ***, P< 0.001.

Involvement of GC box (-52) binding in 1A promoter activity was further investigated by the mutagenesis approach. As shown in Figure 5B , Sp1/Sp3-binding site mutation in {Delta}GC-52-1A+150/Luc had various effects in tested cell lines. Mutation had no effect on reporter gene activity in Jurkat cells and a modest but significant effect in KG1a cells, but it markedly increased 1A promoter activity in MOLT-4 and RC2A cells. Sp1 is often involved in activity of TATA-less promoters, presumably via interaction with the general transcription machinery. In contrast, Sp3 often antagonizes Sp1-mediated transactivation, allowing tight control of promoter activity through the Sp1/Sp3 ratio [17 ]. This might be the case for the 1A promoter. However, we could not establish any relationship between GC box (-52) mutation effects and relative amounts of Sp1 and Sp3 proteins in Jurkat, KG1a, MOLT-4, and RC2A cells (not shown).

Functional binding of IRF-2 on 1A promoter at position -154
High-affinity binding sites for MZF-1, IRF, and Sox-5 are present in the -236 to -147 region (Fig. 4B) . As Sox-5 is specifically expressed in testis [18 ], we focused on binding of MZF-1 and IRF sites by nuclear factors in EMSA. Using a 32P-labeled -175/-152 probe, we could not detect specific nuclear factor binding on the MZF-1 site (not shown). Then, we used a 32P-labeled -160/-137 probe to investigate nuclear factor binding on the IRF site (-154). Figure 6A shows formation of a complex with KG1a nuclear extract, which was abolished by competing with the consensus-binding sequence for the IRF factor family but not with a mutated competitor incapable of IRF binding. Moreover, this complex could be supershifted in the presence of specific antibody to IRF-2 but not with IRF-1 antibody (Fig. 6A) . The same results were obtained using nuclear extracts from RC2A or Jurkat cells (not shown). Altogether, results suggest that IRF-2 is the major IRF family member bound on the IRF site (-154) in 1A mRNA-expressing cell lines.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 6. Functional IRF-2-binding site is located at position -154. (A) Binding nuclear factors to the -160/-137 probe. Labeled probe was incubated in the absence (lane 1) or the presence (lanes 2–9) of nuclear extracts from KG1a cells. Unlabeled, double-stranded competitors were added as follows: Lane 3, 50-fold excess of -160/-137 probe; lanes 4 and 5, 20- and 50-fold excess of Comp IRF WT, representing a consensus-binding site for the IRF family; lanes 6 and 7, 20- and 50-fold excess of Comp IRF Mut, a mutant of Comp IRF WT sequence incapable of IRF binding. For the supershift experiment, 2 µl polyclonal antibody against IRF-1 or IRF-2 was added to binding mixtures (lanes 8 and 9, respectively). (B) Effects of IRF-2-binding site mutation on 1A promoter activity. In these experiments, 1A+150/Luc (17 µg), WT or mutated on the IRF-2 (-154) site, was cotransfected with CMV/Gal (3 µg). Luciferase activity was normalized to ß-galactosidase activity, and the mean relative activity of 1A+150/Luc was taken as 100% for each cell line. Each point consists of triplicate cultures from an experiment representative of two (MOLT-4 and RC2A) or at least three (Jurkat and KG1a) independent experiments (mean±SEM). Statistical significance was determined by Student’s t-test on normalized luciferase activity data and is indicated by *, P< 0.05; **, P< 0.01; and ***, P< 0.001.

To assess implication of IRF-2 binding on 1A promoter activity, 1A+150/Luc was mutated on the IRF-2-binding site (-154). The resulting construct ({Delta}IRF-154-1A+150/Luc) showed slightly affected promoter activity in RC2A and MOLT-4 cells, whereas reporter gene expression was reduced by twofold in KG1a cells (Fig. 6B) . It is interesting that mutation effects on 1A promoter activity were reminiscent of those resulting from -236 to -147 deletion in Jurkat and KG1a cells (Fig. 4A ; {Delta}-148/Luc), strongly suggesting that the loss of the IRF-binding site (-154) was responsible for differential effects of the deletion.

AML-1 binding is required for (-2000/+150) region promoter activity
In addition to the Sp1/Sp3-binding site at -52, AML-1-binding sites at -70 and -13 were the only candidates accounting for promoter activity found in the -74 to +6 region (Fig. 3) . Nuclear factor binding on AML-1 (-70) was investigated by EMSA using the 32P-labeled -74/-30 probe. Four major complexes were detected after incubating the probe with Jurkat nuclear extracts (Fig. 7A , left panel): two nonspecific complexes (indicated by asterisks), a complex resulting from Sp1/Sp3 binding through the GC box (-52) (data not shown), and a complex whose formation was inhibited by a competitor containing an AML-1-binding site not by a mutant competitor incapable of AML-1 binding (Fig. 7A , left panel). In supershift experiments, AML-1-specific antibody but not preimmune serum could displace the latter complex, demonstrating that AML-1 transcription factor can bind to AML-1 (-70) in vitro. In a similar approach using the 32P-labeled -24/+5 probe, we could demonstrate that AML-1 (-13) was also bound by the AML-1 transcription factor in vitro (Fig. 7A , right panel).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 7. AML-1 binding on AML-1 -70 and -13 sites is required for 1A promoter activity. (A) Labeled probes were incubated in the absence (lane 1) or the presence (lanes 2–6) of nuclear extracts (4 µg) from Jurkat cells. Unlabeled, double-stranded competitors were added as follows: lane 3, 50-fold excess of Comp AML-1 WT, a consensus-binding site for AML-1 family transcription factors; lane 4, Comp AML-1 Mut, a mutant of Comp AML-1 WT incapable of AML-1 binding. For supershift experiments, 1 µl anti-AML-1 rabbit antiserum was added to the reaction mixture (lane 5). (B). Mutation of AML-1 (-70) and AML-1 (-13) sites abolishes 1A promoter activity. Jurkat or KG1a cells were transfected with 1A+150/Luc (17 µg), WT or mutated on a single AML-1 site or both sites, and CMV-Gal (3 µg). Luciferase activity was normalized to ß-galactosidase activity, and the mean relative activity of 1A+150/Luc was taken as 100% for each cell line. Each point consists of triplicate cultures from an experiment representative of three independent experiments (mean±SEM). Statistical significance was determined by Student’s t-test on normalized luciferase activity data and is indicated in the text.

The AML-1 transcription factor has been implicated in transcriptional regulation of T cell and monocytic cell promoters [19 ]. To assess involvement of AML-1 (-70) and AML-1 (-13) in 1A promoter activity, sites were mutated, single or both, resulting in {Delta}AML-1-70-1A+150/Luc, {Delta}AML-1-13-1A+150/Luc, and {Delta}AML-1-70/-13-1A+150/Luc constructs. Mutated constructs were expressed in the Jurkat and KG1a cell lines, which are representative of the two hematopoietic lineages showing 1A promoter activity. It is shown in Figure 7B that single AML-1 site mutations reduced promoter activity to 40% compared with the WT promoter (P<0.01). Moreover, combining both mutations totally abolished promoter activity (Fig. 7B) , resulting in activity similar to that of the pGL3 basic vector (P>0.05; data not shown). Altogether, data suggested that AML-1 binding on AML-1 (-70) and AML-1 (-13) is necessary for 1A promoter activity, simultaneous binding having additive rather than synergistic effects.

Expression of AML-1/ETO fusion protein impairs 1A promoter activity
The AML-1/ETO fusion protein results from t(8;21)(q21;q22) translocation, which is the most frequent abnormality found in AML. The resulting fusion transcript encodes the first 177 amino acids of AML-1, including the DNA-binding domain, fused to almost full-length ETO protein, thereby removing the AML-1 transactivation domain [19 ]. The AML-1/ETO protein is a strong repressor of AML-1-mediated transactivation, as it competes for binding on the same sites [20 ] and recruits several histone deacetylases (HDAC) through interaction with N-CoR and mSin3 corepressors [21 , 22 ]. Thus, we used AML-1/ETO overexpression in a dominant-negative approach to confirm the importance of AML-1 binding for 1A promoter activity. Myelomonocytic cell lines, KG1a and RC2A, were cotransfected with 1A+150/Luc or {Delta}AML-1-70/-13-1A+150/Luc and increasing amounts of the AML-1/ETO expression vector. In both cell lines, 1A+150/Luc promoter activity was inhibited by AML-1/ETO in a dose-dependent manner (P<0.01; Fig. 8 ). Inhibition required functional AML-1-binding sites, as AML-1/ETO did not affect residual promoter activity of {Delta}AML-1-70/-13-1A+150/Luc (P>0.1; Fig. 8 ).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 8. Inhibitory effect of AML-1/ETO fusion protein on 1A promoter activity. (A) KG1a and (B) RC2A cells were transfected with 10 µg 1A+150/Luc, WT or mutated on both AML-1 sites, increasing amounts of pCMV5/AML-1/ETO expression vector, and 3 µg CMV/Gal. Total DNA amount was adjusted to 20 µg using an empty pCMV5 vector. Luciferase activity was normalized to ß-galactosidase activity, and the mean relative activity of 1A+150/Luc in the absence of AML-1/ETO was taken as 100% for each cell line. Each point consists of triplicate cultures from an experiment representative of three independent experiments for KG1a cells and from a single experiment for RC2A cells (mean±SEM). Statistical significance was determined by Student’s t-test on normalized luciferase activity data and is indicated in the text.


arrow
DISCUSSION
 
We report here characterization of the promoter of the human Mona gene that directs Mona expression in 1A mRNA-expressing cells, including T cell and immature myeloid cell lines. Six TSS arranged in two clusters could be detected on the putative 1A promoter. Whereas sequence examination around TSS did not show any TATA box or DPE, consensus Inr sequences were found on TSS -263, -261, and -238. Inr sequences encompass the transcription start site and are therefore able to direct accurate transcription initiation in the absence of the TATA box through interaction with components of the basal machinery of transcription. Four key proteins have been shown to recognize Inr elements: TFIID, TFII-I, YY1, and RNA polymerase II itself [16 ]. The YY1 transcription factor differs from other Inr-binding proteins in that it recognizes only a subset of functional Inr elements, rendering unclear its general involvement in Inr activity [23 ]. The consensus sequence for vertebrate Inr is YYANWYY, and the core YANW is the most critical for Inr strength, yet pyrimidines surrounding this core sequence also play an important role. This seems to be the case for Inr sequences at TSS -263 and -261, as both exhibit the core YANW with at least one adjacent pyrimidine for TSS -263. Accordingly, mutation of these Inr sequences greatly decreased 1A promoter activity, indicating that Inr sequences at -263 and -261 are essential core elements for the 1A promoter activity. The -238 TSS is also surrounded by a perfect Inr sequence and was found to be the major transcription start site as detected by primer extension. Unexpectedly, removing this sequence had only a limited effect on 1A promoter, suggesting that Inr -263 and -261 are able to compensate for the loss of Inr -238, but not reciprocally. TSS -263 was referred to as position +1 in the rest of the study.

Using 1A+150/Luc construct, we have shown that the -2000 to +150 genomic region upstream of 1A 5' UTR of the human Mona gene specifically directs reporter gene expression in T cell and monocytic cell lines. This shared specificity was especially interesting, as T and monocytic-specific genes are usually regulated by distinct sets of lineage-specific transcription factors [24 , 25 ]. Therefore, we sought the cis element and corresponding binding transcription factors involved in 1A promoter activity.

Deletion analysis of the (-2000/+150) fragment identified two regions implicated in 1A promoter activity: the -2000 to -637 region, whose deletion modestly affects promoter activity, and the -236 to +6 region, which contains the major regulatory sites studied here. After completion of this study, the release of newly sequenced mouse genome fragments in the Ensemble Mouse Genome Server (<http://www.ensembl.org/Mus_musculus>) allowed localization of the murine Mona gene on chromosome 15. Alignment of the human -2000/+150 1A sequence with its murine counterpart showed significant homology blocks within the -1800/-1420, -1080/-920, and -154/+1 sequences (data not shown). Thus, compared sequence analysis of human and mouse Mona genes has emphasized the functional role of the -154/+1 region of the 1A promoter as shown here and has provided a strong basis for investigating the putative role of distal sites in 1A promoter activity.

The IRF site located at position -154 is bound in vitro by the IRF-2 transcription factor, suggesting that the Mona 1A promoter might be a target for signaling pathways induced by IFNs. IRF-1 and IRF-2 mRNA are expressed in a variety of cell types, and their expression levels, particularly IRF-1 mRNA, are up-regulated upon viral infection or IFN stimulation [26 ]. IRF-1 is mainly described as the activator of the various genes involved in host defense, whereas IRF-2 is often associated with down-regulation of IFN signaling as a result of its capability to suppress IRF-1-mediated transactivation [26 ]. However, IRF-2 may be converted from a repressor to an activator [27 ] after proteolytic processing induced by viral infection [28 ] and was thus involved in transactivation of histone H4 and vascular cell adhesion molecule 1 genes [29 , 30 ]. Accordingly, IRF-2 may act as an activator of the 1A promoter, as a mutation of the IRF site (-154) induced a significant decrease in 1A promoter activity, especially in KG1a cells. Alternatively, in vitro IRF-2 binding on the IRF site (-154) might be favored by a high IRF-2/IRF-1 basal ratio in cells used to prepare nuclear extract, as cells were not stimulated by IFN, and IRF-2 has a markedly longer half-life than IRF-1 [31 ]. It would be of great interest to investigate what IRF factors bind on the IRF site (-154) during IFN stimulation, and what is the resulting effect on 1A promoter activity. In preliminary experiments, we found that IFN induced a nonspecific decrease in 1A+150/Luc activity, hampering further investigation on the effects of IFN treatment on the 1A promoter (unpublished results). Further experiments are thus needed to clarify involvement of IRF factors in 1A promoter activity.

Sp1/Sp3 binding was clearly shown to exert negative regulatory control on 1A promoter activity, especially in MOLT-4 and RC2A cell lines. Sp1 interacts with the general transcription factor TFIID via association with TATA-box binding factor (TBP), transcription associated factor (TAF)(II)130, and TAF(II)55 and is thought to favor preinitiation complex formation on TATA-less promoters by providing an additional anchor site for TFIID on core promoter [17 ]. Furthermore, it was shown for numerous genes that Sp1-mediated transcription could be suppressed through Sp3, raising the possibility that the Sp1/Sp3 ratio may modulate gene activity [17 ]. However, post-translational modifications of Sp1 [32 , 33 ] and existence of three Sp3 isoforms with unclear function [34 , 35 ] prevent direct assessment of functional Sp1/Sp3 ratio by immunoblotting or EMSA. For instance, Sp3 participates in activation of some genes [17 ], and Sp1 has been shown to repress transcription by binding to HDAC1 [36 ]. Studying effects of Sp1 or Sp3 overexpression and determining the relative amounts of Sp1 and Sp3 bound on an endogenous site (-52) by chromatin immunoprecipitation will be necessary to confirm regulation of 1A promoter activity by a Sp1/Sp3 ratio.

In this study, we demonstrated that AML-1-binding sites at positions -70 and -13 interact with the AML-1 transcription factor in vitro. Mutation of both AML-1 sites totally suppressed 1A promoter activity, establishing a requirement on AML-1 for Mona expression in T cells and immature myeloid cells. This was further confirmed by our finding that the AML-1/ETO fusion protein could repress 1A+150/Luc activity. AML-1 is mainly expressed in T and monocytic cells, regulating a number of specific genes, including those encoding the T cell receptor {alpha} and ß chains or the M-CSF receptor [19 , 37 38 39 ]. However, the 1A promoter looks different from typical monocytic promoters, lacking functional binding sites for the ETS transcription factor family frequently found in monocytic-specific promoters [24 ]. Such discrepancy may reflect 1A promoter activity in T and monocytic cells, as the ETS factor PU.1 is not expressed in T lymphocytes [40 ]. In addition, Mona gene regulation in the monocytic lineage differs from that of other monocyte-specific genes. Indeed, Mona expression is restricted to a narrow window of monocytic differentiation. In humans, Mona is expressed only in immature myelomonocytic cell lines [15 ], whereas in mice, Mona was detected in monocytes but not in their precusors or macrophages [10 , 41 ]. This tight regulation may be independent from ETS factors, as PU.1 expression is maintained throughout the monocyte/macrophage lineage [42 ].

Studies of AML-1 target genes have indicated that AML-1 is a weak transactivator in the absence of cooperating factors bound to adjacent promoter sites [19 ]. However, in vitro footprinting analysis of the -70 to +6 region did not allow detection of sites other than those occupied by AML-1 and Sp1 (unpublished results), arguing against the possibility that other transcription factor binding sites act in synergy with AML-1 sites. The presence of two close AML-1-binding sites in the 1A promoter is by itself an unusual feature and may allow particular transactivation mechanisms. For example, ubiquitously expressed nuclear protein ALY interacts with the AML-1 activation domain, enabling AML-1 to associate with other transcription factors on the TcR{alpha} enhancer [43 ]. Concerning the 1A promoter, binding of AML-1 on sites -70 and -13 might be stabilized by ALY multimers, allowing more efficient recruitment of AML-1 partners, such as p300/Creb binding protein histone acetyltransferase [44 ] or the yes-associated protein-1 coactivator, which contains a strong, intrinsic activation domain [45 ].

In conclusion, a crucial role of the AML-1 transcription factor in 1A promoter activity provides a basis for lineage-restricted Mona expression, as AML-1 has been implicated in promoter regulation in T and monocytic lineages. However, dependent on the cell lineage or differentiation step, Mona 1A promoter activity might be tuned by Sp1/Sp3 and IRF family transcription factors. Future experiments investigating 1A promoter occupancy in native cells should confirm these findings and provide a more general basis for studying specific gene expression during early steps of hematopoiesis.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by Centre National de la Recherche Scientifique and Ligue Nationale contre le Cancer. B. G. was supported by grants from Fondation Mérieux and Association pour la Recherche contre le Cancer. We are indebted to Dr. François Morlé for helpful and stimulating discussions.

Received May 21, 2002; revised September 27, 2002; accepted November 9, 2002.


arrow
REFERENCES
 
    1
  1. Bourette, R. P., Rohrschneider, L. R. (2000) Early events in M-CSF receptor signalling Growth Factors 17,155-166[Medline]
  2. 2
  3. McCubrey, J. A., May, W. S., Duronio, V., Mufson, A. (2000) Serine/threonine phosphorylation in cytokine signal transduction Leukemia 14,9-21[CrossRef][Medline]
  4. 3
  5. Moutoussamy, S., Kelly, P. A., Finidori, J. (1998) Growth-hormone-receptor and cytokine-receptor-family signalling Eur. J. Biochem. 255,1-11[Medline]
  6. 4
  7. Pawson, T., Nash, P. (2000) Protein-protein interactions define specificity in signal transduction Genes Dev 14,1027-1047[Free Full Text]
  8. 5
  9. Clements, J. L., Ross-Barta, S. E., Tygrett, L. T., Waldschmidt, T. J., Koretzky, G. A. (1998) SLP-76 expression is restricted to hemopoietic cells of monocyte, granulocyte, and T lymphocyte lineage and is regulated during T cell maturation and activation J. Immunol. 161,3880-3889[Abstract/Free Full Text]
  10. 6
  11. Jumaa, H., Wollscheid, B., Mitterer, M., Wienands, J., Reth, M., Nielsen, P. J. (1999) Abnormal development and function of B lymphocytes in mice deficient for the signalling adaptor protein SLP-65 Immunity 11,547-554[CrossRef][Medline]
  12. 7
  13. Clements, J. L., Lee, J. R., Gross, B., Yang, B., Olson, J. D., Sandra, A., Watson, S. P., Lentz, S. R., Koretzky, G. A. (1999) Fetal hemorrhage and platelet dysfunction in SLP-76-deficient mice J. Clin. Invest. 103,19-25[Medline]
  14. 8
  15. Clements, J. L., Yang, B., Ross-Barta, S. E., Eliason, S. L., Hrstka, R. F., Williamson, R. A., Koretzky, G. A. (1998) Requirement for the leukocyte-specific adapter protein SLP-76 for normal T cell development Science 281,416-419[Abstract/Free Full Text]
  16. 9
  17. Liu, S. K., Berry, D. M., McGlade, C. J. (2001) The role of Gads in hematopoietic cell signalling Oncogene 20,6284-6290[CrossRef][Medline]
  18. 10
  19. Bourette, R. P., Arnaud, S., Myles, G. M., Blanchet, J. P., Rohrschneider, L. R., Mouchiroud, G. (1998) Mona, a novel hematopoietic-specific adaptor interacting with the macrophage colony-stimulating factor receptor, is implicated in monocyte/macrophage development EMBO J 17,7273-7281[CrossRef][Medline]
  20. 11
  21. Liu, S. K., Fang, N., Koretzky, G. A., McGlade, C. J. (1999) The hematopoietic-specific adaptor protein Gads functions in T-cell signalling via interactions with the SLP-76 and LAT adaptors Curr. Biol. 9,67-75[CrossRef][Medline]
  22. 12
  23. Asazuma, N., Wilde, J. I., Berlanga, O., Leduc, M., Leo, A., Schweighoffer, E., Tybulewicz, V., Bon, C., Liu, S. K., McGlade, C. J., Schraven, B., Watson, S. P. (2000) Interaction of linker for activation of T cells with multiple adapter proteins in platelets activated by the glycoprotein VI-selective ligand, convulxin J. Biol. Chem. 275,33427-33434[Abstract/Free Full Text]
  24. 13
  25. Yoder, J., Pham, C., Iizuka, Y. M., Kanagawa, O., Liu, S. K., McGlade, J., Cheng, A. M. (2001) Requirement for the SLP-76 adaptor GADS in T cell development Science 291,1987-1991[Abstract/Free Full Text]
  26. 14
  27. Bourgin, C., Bourette, R., Mouchiroud, G., Arnaud, S. (2000) Expression of Mona (monocytic adapter) in myeloid progenitor cells results in increased and prolonged MAP kinase activation upon macrophage colony-stimulating factor stimulation FEBS Lett 480,113-117[CrossRef][Medline]
  28. 15
  29. Guyot, B., Arnaud, S., Phothirath, P., Bourette, R. P., Grasset, M. F., Rigal, D., Mouchiroud, G. (2002) Genomic organization and restricted expression of the human Mona/Gads gene suggests regulation by two specific promoters Gene 290,173-179[CrossRef][Medline]
  30. 16
  31. Smale, S. T. (1997) Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes Biochim. Biophys. Acta 1351,73-88[Medline]
  32. 17
  33. Suske, G. (1999) The Sp-family of transcription factors Gene 238,291-300[CrossRef][Medline]
  34. 18
  35. Denny, P., Swift, S., Connor, F., Ashworth, A. (1992) An SRY-related gene expressed during spermatogenesis in the mouse encodes a sequence-specific DNA-binding protein EMBO J 11,3705-3712[Medline]
  36. 19
  37. Licht, J. D. (2001) AML1 and the AML1-ETO fusion protein in the pathogenesis of t(8;21) AML Oncogene 20,5660-5679[CrossRef][Medline]
  38. 20
  39. Meyers, S., Downing, J. R., Hiebert, S. W. (1993) Identification of AML-1 and the (8;21) translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins: the runt homology domain is required for DNA binding and protein-protein interactions Mol. Cell. Biol. 13,6336-6345[Abstract/Free Full Text]
  40. 21
  41. Gelmetti, V., Zhang, J., Fanelli, M., Minucci, S., Pelicci, P. G., Lazar, M. A. (1998) Aberrant recruitment of the nuclear receptor corepressor-histone deacetylase complex by the acute myeloid leukemia fusion partner ETO Mol. Cell. Biol. 18,7185-7191[Abstract/Free Full Text]
  42. 22
  43. Wang, J., Hoshino, T., Redner, R. L., Kajigaya, S., Liu, J. M. (1998) ETO, fusion partner in t(8;21) acute myeloid leukemia, represses transcription by interaction with the human N-CoR/mSin3/HDAC1 complex Proc. Natl. Acad. Sci. USA 95,10860-10865[Abstract/Free Full Text]
  44. 23
  45. Javahery, R., Khachi, A., Lo, K., Zenzie-Gregory, B., Smale, S. T. (1994) DNA sequence requirements for transcriptional initiator activity in mammalian cells Mol. Cell. Biol. 14,116-127[Abstract/Free Full Text]
  46. 24
  47. Tenen, D. G., Hromas, R., Licht, J. D., Zhang, D. E. (1997) Transcription factors, normal myeloid development, and leukemia Blood 90,489-519[Free Full Text]
  48. 25
  49. Shivdasani, R. A., Orkin, S. H. (1996) The transcriptional control of hematopoiesis Blood 87,4025-4039[Free Full Text]
  50. 26
  51. Taniguchi, T., Ogasawara, K., Takaoka, A., Tanaka, N. (2001) IRF family of transcription factors as regulators of host defense Annu. Rev. Immunol. 19,623-655[CrossRef][Medline]
  52. 27
  53. Yamamoto, H., Lamphier, M. S., Fujita, T., Taniguchi, T., Harada, H. (1994) The oncogenic transcription factor IRF-2 possesses a transcriptional repression and a latent activation domain Oncogene 9,1423-1428[Medline]
  54. 28
  55. Palombella, V. J., Maniatis, T. (1992) Inducible processing of interferon regulatory factor-2 Mol. Cell. Biol. 12,3325-3336[Abstract/Free Full Text]
  56. 29
  57. Vaughan, P. S., Aziz, F., van Wijnen, A. J., Wu, S., Harada, H., Taniguchi, T., Soprano, K. J., Stein, J. L., Stein, G. S. (1995) Activation of a cell-cycle-regulated histone gene by the oncogenic transcription factor IRF-2 Nature 377,362-365[CrossRef][Medline]
  58. 30
  59. Jesse, T. L., LaChance, R., Iademarco, M. F., Dean, D. C. (1998) Interferon regulatory factor-2 is a transcriptional activator in muscle where It regulates expression of vascular cell adhesion molecule-1 J. Cell Biol. 140,1265-1276[Abstract/Free Full Text]
  60. 31
  61. Watanabe, N., Sakakibara, J., Hovanessian, A. G., Taniguchi, T., Fujita, T. (1991) Activation of IFN-beta element by IRF-1 requires a posttranslational event in addition to IRF-1 synthesis Nucleic Acids Res 19,4421-4428[Abstract/Free Full Text]
  62. 32
  63. Jackson, S. P., Tjian, R. (1988) O-glycosylation of eukaryotic transcription factors: implications for mechanisms of transcriptional regulation Cell 55,125-133[CrossRef][Medline]
  64. 33
  65. Jackson, S. P., MacDonald, J. J., Lees-Miller, S., Tjian, R. (1990) GC box binding induces phosphorylation of Sp1 by a DNA-dependent protein kinase Cell 63,155-165[CrossRef][Medline]
  66. 34
  67. Dennig, J., Beato, M., Suske, G. (1996) An inhibitor domain in Sp3 regulates its glutamine-rich activation domains EMBO J 15,5659-5667[Medline]
  68. 35
  69. Kennett, S. B., Udvadia, A. J., Horowitz, J. M. (1997) Sp3 encodes multiple proteins that differ in their capacity to stimulate or repress transcription Nucleic Acids Res 25,3110-3117[Abstract/Free Full Text]
  70. 36
  71. Doetzlhofer, A., Rotheneder, H., Lagger, G., Koranda, M., Kurtev, V., Brosch, G., Wintersberger, E., Seiser, C. (1999) Histone deacetylase 1 can repress transcription by binding to Sp1 Mol. Cell. Biol. 19,5504-5511[Abstract/Free Full Text]
  72. 37
  73. Giese, K., Kingsley, C., Kirshner, J. R., Grosschedl, R. (1995) Assembly and function of a TCR alpha enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions Genes Dev 9,995-1008[Abstract/Free Full Text]
  74. 38
  75. Kim, W. Y., Sieweke, M., Ogawa, E., Wee, H. J., Englmeier, U., Graf, T., Ito, Y. (1999) Mutual activation of Ets-1 and AML1 DNA binding by direct interaction of their autoinhibitory domains EMBO J 18,1609-1620[CrossRef][Medline]
  76. 39
  77. Petrovick, M. S., Hiebert, S. W., Friedman, A. D., Hetherington, C. J., Tenen, D. G., Zhang, D. E. (1998) Multiple functional domains of AML1: PU.1 and C/EBPalpha synergize with different regions of AML1 Mol. Cell. Biol. 18,3915-3925[Abstract/Free Full Text]
  78. 40
  79. Klemsz, M. J., McKercher, S. R., Celada, A., Van Beveren, C., Maki, R. A. (1990) The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene Cell 61,113-124[CrossRef][Medline]
  80. 41
  81. Bourgin, C., Bourette, R. P., Arnaud, S., Liu, Y., Rohrschneider, L. R., Mouchiroud, G. (2002) Induced expression and association of the Mona/Gads adapter and Gab3 scaffolding protein during monocyte/macrophage differentiation Mol. Cell. Biol. 22,3744-3756[Abstract/Free Full Text]
  82. 42
  83. Cheng, T., Shen, H., Giokas, D., Gere, J., Tenen, D. G., Scadden, D. T. (1996) Temporal mapping of gene expression levels during the differentiation of individual primary hematopoietic cells Proc. Natl. Acad. Sci. USA 93,13158-13163[Abstract/Free Full Text]
  84. 43
  85. Bruhn, L., Munnerlyn, A., Grosschedl, R. (1997) ALY, a context-dependent coactivator of LEF-1 and AML-1, is required for TCRalpha enhancer function Genes Dev 11,640-653[Abstract/Free Full Text]
  86. 44
  87. Kitabayashi, I., Yokoyama, A., Shimizu, K., Ohki, M. (1998) Interaction and functional cooperation of the leukemia-associated factors AML1 and p300 in myeloid cell differentiation EMBO J 17,2994-3004[CrossRef][Medline]
  88. 45
  89. Yagi, R., Chen, L. F., Shigesada, K., Murakami, Y., Ito, Y. (1999) A WW domain-containing yes-associated protein (YAP) is a novel transcriptional co-activator EMBO J 18,2551-2562[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
W. Huang, E. Horvath, and E. A. Eklund
PU.1, Interferon Regulatory Factor (IRF) 2, and the Interferon Consensus Sequence-binding Protein (ICSBP/IRF8) Cooperate to Activate NF1 Transcription in Differentiating Myeloid Cells
J. Biol. Chem., March 2, 2007; 282(9): 6629 - 6643.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guyot, B.
Right arrow Articles by Mouchiroud, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guyot, B.
Right arrow Articles by Mouchiroud, G.