
* Department of Microbiology and Immunology, Institute for Lung Health, University of Leicester, United Kingdom; and
School of Pharmaceutical Sciences, School of Pharmacy, University of Nottingham, University Park, United Kingdom
Correspondence: Dr. Colin R. A. Hewitt, Department of Microbiology and Immunology, Institute for Lung Health, University of Leicester, P.O. Box 138, University Road, Leicester LE1 9HN, UK. E-mail: crah1{at}le.ac.uk
|
|
|---|
mRNA in KU812 basophils. Enzyme-linked immunosorbent assay confirmed that IL-4 and IL-13 were secreted. A nonproteolytic antigen failed to induce cytokine expression, and preincubation of Der p1 or N. americanus secretions with protease inhibitors inhibited cytokine expression. Data were confirmed using basophils purified from human peripheral blood. We speculate that this innate mechanism may contribute to the development of a cytokine milieu that could promote immunoglobulin E synthesis, eosinophil recruitment, and the development of type 2 T cells.
Key Words: hookworm allergy Dermatophagoides pteronyssinus
|
|
|---|
subunit of the interleukin (IL)-2 receptor from T cells [7
]. Others have shown that proteases present in house dust mite faecal pellets cause changes in the permeability of epithelial cells [8
, 9
], Der p1 in particular, degrading key molecules in tight junctions and desmosomes of epithelial cells at very low concentrations [10
]. We have also shown that the excretory-secretory (ES) products of an intestinal parasite of humans, the hookworm Necator americanus, are also rich in proteases [11 ] and may also be causally associated with typically allergic-immune responses to the parasite.
The development and polarization of type 2 T cells and the development of IgE-secreting B cells are strongly driven by IL-4 and IL-13, respectively [12 , 13 ]. The finding that human basophils produced IL-4 and IL-13 after IgE-dependent stimulation [14 15 16 17 18 ] suggested that these cells may be able to maintain the T helper cell type 2 dominance of established allergic-immune responses. Even in the absence of IgE, a rat basophil line was activated by enzymatically active components of bee venom, house dust mite spent growth medium, and the secretions of Schistosoma mansoni [19 ]. Thus, via the enzymatic activity of these allergens, basophils may influence new and developing T cell responses in individuals without allergen-specific, cytophilic IgE. In this study, we have investigated the hypothesis that human basophils release T cell polarizing cytokines in the presence of proteolytically active allergens from house dust mites and helminths.
|
|
|---|
Human peripheral blood basophils
Basophils were immunomagnetically purified using a magnetic cell sorter basophil isolation kit from 100 ml samples of heparinized peripheral blood. Blood was obtained from normal, healthy donors with no history or evidence of allergy to house dust mites. This kit yields "untouched" basophils by depletion of B cells, monocytes, natural killer cells, dendritic cells, early erythroid cells, platelets, neutrophils, eosinophils, and T cells (Miltenyi Biotech, Bergisch Gladbach, Germany). In our hands, this kit routinely isolated 8 x 105 +/- 1.9 x 105 basophils from 100 ml peripheral blood with a purity of 80.5% +/- 3.88%, as assessed by staining cytospin preparations of the cells with haemotoxylin and eosin. Purified basophils were activated by cross-linking their cytophilic IgE with 1 µgml-1 mouse anti-human IgE.
Der p1
Der p1 was purified as described from the culture medium of D. pteronyssinus (donated by Dr. Barbara Hart, Royal Agricultural College, Cirencester, UK) by immunoaffinity chromatography using the anti-group I mite allergen monoclonal antibody 4C1 (Indoor Biotechnologies, Cardiff, UK) [4
, 5
].
N. americanus
N. americanus were maintained in syngeneic DSN hamsters [20
]. Neonatal hamsters were infected percutaneously with 100 L3 larvae. Adult worms were recovered from the intestine 35 days after infection and were washed for 2 h in sterile RPMI 1640 containing 100 i.u./ml penicillin and 100 µg/ml streptomycin. Following a 1-h incubation in RPMI 1640, the medium was changed, and after 24 h of culture, the supernatant containing the worm ES products was collected and 0.2 µm-filtered. Adult worms remained viable, as assessed by motility, throughout the washing and culture period.
Cell stimulation
KU812 cells (1x106/ml) were incubated in RPMI 1640 and stimulated with 10 ng/ml phorbol 12-myristate 13-acetate (PMA; Sigma Chemical Co.) and 1 µm ionomycin (Sigma Chemical Co.); 10 ng/ml1 µg/ml Der p1 (full dose response and time course; data not shown); and 100 ng/ml100 µg/ml N. americanus ES or 1 µg/ml tetanus toxoid (Evans Medical, Liverpool, UK). Cells were incubated in 24-well plates for 14 h at 37°C in a 5% CO2, 100% humidity atmosphere at 37°C. In experiments that included the protease inhibitors L-trans-epoxysuccinyl-leucylamide-[4-guanidino]-butane (E64; Novabiochem, Nottingham, UK); 4-[amidinophenyl]-methanesulfonyl fluoride (APMSF; Novabiochem); pepstatin-A (Novabiochem); and 1,10 phenanthroline (Novabiochem), proteases were preincubated with the inhibitors at 37°C for 30 min before adding to the cell cultures.
Reverse transcriptase-polymerase chain reaction (RT-PCR)
KU812 cells were harvested at various time points before and after stimulation. Supernatants were collected and stored at -20°C for enzyme-linked immunosorbent assay (ELISA). RNA was extracted from cells using RNAzol B (Biogenesis, Bournemouth, UK) and was reverse-transcribed by a standard protocol using Superscript RT (Life Technologies). To avoid amplification of any genomic DNA, the PCR primers bridged intron splice sites. PCR reactions were performed using the first-strand cDNA from the equivalent of 5 x 104 cells in a standard protocol with Taq polymerase (Life Technologies) with a negative control in which first-strand cDNA was substituted with water and a positive control of standard cytokine cDNA. Sequences were amplified for 35 cycles [except interferon-
(IFN-
), which was amplified for 45 cycles] as follows: 95°C for 45 s; 53.5°C (IL-8), 55°C (ß-actin, IL-3, IL-4, IFN-
), 60°C (IL-5, IL-6), or 66°C (IL-13) for 45 s; and 72°C for 1 min. PCR products (10 µl) were examined by agarose gel electrophoresis and photographed under UV transillumination.
The sequences of the primers used were as follows: human ß-actin sense primer, 5'-TTCAACTCCATCATGAAGTGTGACGTG-3', antisense primer, 5'-TAAGTCATAGTCCGCCTAGAAGCATT-3'; human IL-3 sense primer, 5'-ATGAGCCGCCTGCCCGTCCTG-3', antisense primer, 5'-GCGAGGCTCAAAGTCGTCTGTTG-3'; human IL-4 sense primer, 5'-ATGGGTCTCACCTCCCAACTGCT-3', antisense primer, 5'-CGAACACTTTGAATATTTCTCTCTCAT-3'; human IL-5 sense primer, 5'-GCTTCTGCATTTGAGTTTGCTAGCT-3', antisense primer, 5'-TGGCCGTCAATGTATTTCTTTATTAAG-3'; human IL-6 sense primer, 5'-ATGAACTCCTTCTCCACAAGCGC-3', antisense primer, 5'-GAAGAGCCCTCAGGCTGGACTG-3'; human IL-8 sense primer, 5'-CTAGTCTAGAATGACTTCCAAGCTGGCGG-3', antisense primer, 5'-CCGCTCGAGTTATGAATTCTCAGCCCTC-3; human IL-13 sense primer, 5'-CCACGGTCATTGCTCTCACTTGCC-3', antisense primer, 5'-CCTTGTGCGGGCAGAATCCGCTCA-3'; human IFN-
sense primer, 5'TGTTACTGCCAGGACCCATATGTAAAA-3', antisense primer, 5'CATCACTTGGATGAGTTCAT GTATTGC-3'.
Cytokine ELISA
IL-4 and IL-13 were measured in supernatants using a human IL-13 ELISA kit (Endogen, Bradsure Biologicals Ltd., Loughborough, UK) and a human IL-4 ELISA kit (Cytoscreen, Lifescreen Ltd., Hertfordshire, UK). Assays were performed according to the manufacturers instructions. The assay sensitivities were <7 pg/ml and <3 pg/ml for IL-13 and IL-4, respectively.
|
|
|---|
KU812 was found to express almost no constitutive mRNA for IL-3, IL-4, IL-5, IL-6, and IL-13 and only low levels of mRNA for IL-8 and IFN-
(Fig. 1
, upper panel). After stimulation for 2 h with 10 ng/ml PMA and 1 µM ionomycin, the steady-state expression of IL-3, IL-4, IL-5, IL-6, IL-8, IL-13, and IFN-
mRNA by KU812 was substantially increased (Fig. 1
, lower panel). The levels of ß-actin mRNA expression were similar before and after activation. Thus, IgE-independent activation of KU812 with powerful stimuli shows the capacity of these cells to make a wide range of type 1 and type 2 cytokines.
![]() View larger version (77K): [in a new window] |
Figure 1. Analysis of constitutive and induced cytokine mRNA expression by KU812 basophils. RT-PCR analysis of cytokine mRNA expression by unstimulated KU812 cells (upper panel) and after 2 h incubation with 10 ng/ml PMA and 1 µM ionomycin stimulation (lower panel). Total RNA was extracted from equal numbers of cells before and after stimulation, and the expression of ß-actin, IL-3, IL-4, IL-5, IL-6, IL-8, IL-13, and IFN- was analyzed by RT-PCR. A representative example of three independent, replicate experiments is shown.
|
mRNA (Fig. 2a
). Induction of cytokine mRNA was also observed at other time points (14 h) and other concentrations of Der p1 (100 ng/ml1 µg/ml; data not shown). When the protease activity of Der p1 was inhibited with E64 and APMSF, the level of IL-4, IL-5, and IL-13 mRNA expression was similar to the constitutive levels produced by KU812 (Fig. 2a)
. Cells treated with protease inhibitors but no Der p1 also expressed only constitutive levels of mRNA (Fig. 2a) .
![]() View larger version (44K): [in a new window] |
Figure 2. (a) Der p1 induces the expression of IL-4, IL-5, and IL-13 mRNA but not IFN- mRNA in KU812 cells. Lane 1, Unstimulated KU812 cells; lane 2, KU812 incubated with 1 µg/ml Der p1 for 2 h; lane 3, KU812 incubated for 2 h with 1 µg/ml Der p1 that had been inhibited with 5 µM E64 and 50 µM APMSF; lane 4, KU812 incubated for 2 h with 5 µM E64 and 50 µM APMSF and no Der p1; lane 5, negative PCR control in which the template cDNA was substituted with water; lane 6, positive PCR control in which a template cDNA from PMA and ionomycin-stimulated KU812 was used. A representative example of three independent, replicate experiments is shown. (b) Protease inhibitors do not compromise the ability of KU812 to express IL-13 mRNA. KU812 cells were incubated for 1 h in the presence or absence of 10 ng/ml PMA and 1 µM ionomycin and no inhibitors or a cocktail of protease inhibitors containing 1 µM E64, 100 µM PMSF, 1 µM pepstatin A, and 1 mM 1,10 phenanthroline. (c) A nonproteolytic protein antigen, tetanus toxoid, does not induce IL-13 expression by KU812 basophils. KU812 cells were incubated in the presence or absence of 1 µg/ml tetanus toxoid for 1 and 4 h. A negative PCR control (-ve) in which template cDNA was substituted with water was included alongside a positive PCR control consisting of cDNA from PMA and ionomycin-stimulated KU812 cells.
|
To further confirm that cytokine mRNA expression by KU812 was induced by proteolytic activity, cells were incubated with a nonproteolytic protein, tetanus toxoid. After 1 and 4 h of culture, tetanus toxoid did not induce the expression of IL-13 mRNA in KU812 (Fig. 2c) .
Proteases in N. americanus ES products induce expression of type 2 cytokine mRNA in KU812 cells
In a similar manner to Der p1, ES products induced dose-dependent expression of IL-4, IL-5, and IL-13 mRNA in KU812 cells but no detectable IL-6, IL-8 (data not shown), or IFN-
mRNA (Fig. 3
). To determine whether proteases in the ES products of N. americanus were responsible for induction of the type 2 cytokine mRNAs, class-specific protease inhibitors were preincubated with the ES products before adding to KU812. ES products treated with E64, pepstatin A, PMSF, and 1,10 phenanthroline failed to induce expression of IL-4, IL-5, and IL-13 mRNAs but had no effect on the expression of ß-actin mRNA (Fig. 3) . These results suggest that as with Der p1, proteolytic activities associated with N. americanus ES are responsible for the induction of cytokine mRNA by KU812.
![]() View larger version (70K): [in a new window] |
Figure 3. Proteases in the ES products of N. americanus induce the expression of IL-4, IL-5, and IL-13 mRNA but not IFN- mRNA in KU812 cells. Lane 1, Unstimulated KU812 cells; lane 2, KU812 cells incubated for 1 h with N. americanus ES products at 100 ng/ml; lanes 3 and 4, 200 ng/ml and 1 µg/ml, respectively; lane 5, unstimulated KU812 cells incubated with 1 µM E64, 1 µM pepstatin A, 0.1 mM PMSF, and 1 mM 1,10 phenanthroline; lane 6, KU812 cells incubated for 1 h with N. americanus ES products at 100 ng/ml in which proteases had been inhibited with 1 µM E64, 1 µM pepstatin A, 0.1 mM PMSF, and 1 mM 1,10 phenanthroline; lane 7, KU812 cells incubated for 1 h with N. americanus ES products at 500 ng/ml in which proteases had been inhibited as for lane 6; lane 8, KU812 cells incubated for 1 h with N. americanus ES products at 1 µg/ml in which proteases had been inhibited as for lane 6; lane 9, negative PCR control (-ve) in which template cDNA was substituted with water; lane 10, positive PCR control (+ve) in which a template cDNA from PMA and ionomycin-stimulated KU812 cells was used. A representative example of three independent, replicate experiments is shown.
|
![]() View larger version (19K): [in a new window] |
Figure 4. KU812 basophils release IL-4 and IL-13 in response to Der p1 and proteases in the ES products of N. americanus. IL-4 and IL-13 were measured in cell-free supernatants of KU812 cells incubated for 24 h as follows: Unstimulated cells (No treatment); 10 ng/ml PMA and 1 µM ionomycin (PMA Iono); 1 µg/ml Der p1 (Der p1); 1 µg/ml Der p1 inhibited with 5 µM E64 and 50 µM APMSF (E64 APMSF+Der p1); 5 µM E64 and 50 µM APMSF alone (E64 APMSF); 100 µg/ml ES products of N. americanus (Necator ES); 100 µg/ml ES products of N. americanus in which proteases were inhibited with 1 µM E64, 1 µM pepstatin A, 0.1 mM PMSF, and 1 mM 1,10 phenanthroline (E64 PepA PMSF 1,10 phen+Necator ES); or 1 µM E64, 1 µM pepstatin A, 0.1 mM PMSF, and 1 mM 1,10 phenanthroline alone (E64 PepA PMSF 1,10 phen). A representative example of three independent, replicate experiments is shown.
|
Der p1 induces the release and intracellular accumulation of IL-4 in purified human basophils
To support our findings with KU812, it was important to show that that purified peripheral blood basophils responded in a similar manner to the cell line, as well as to demonstrate that the mechanistic class-specific protease inhibitors did not compromise the ability of purified basophils to respond to the physiological stimulus of cross-linked, cytophilic IgE.
Like others, we have found high inter-donor variability in the patterns and levels of IL-4 released into the supernatant of human purified basophil cultures. However, when intracellular and extracellular IL-4 were measured, we found that donors producing high levels of intracellular IL-4 tended to release low levels of extracellular IL-4 and vice versa. Thus, when the levels of total IL-4 (i.e., intracellular+extracellular IL-4) were considered, the pattern of IL-4 responses to challenge with several stimuli was similar between donors (data not shown).
In the presence of anti-human IgE, purified basophils released higher than constitutive levels of total IL-4 that were not reduced by preincubation of the anti-IgE with protease inhibitors (Fig. 5 ). This confirmed the results reported in Figure 2a , with KU812 showing that the protease inhibitors used have no effect on the activation of cytokine gene expression.
![]() View larger version (20K): [in a new window] |
Figure 5. The proteolytic activity of Der p1 causes purified basophils to produce IL-4. IL-4, in the cell-free supernatant, was measured by ELISA from purified basophils incubated for 24 h as follows: Untreated (Constitutive); treated with 1 µgml-1 mouse anti-human IgE (Anti-IgE); 5 µM E64 and 50 µM APMSF (inhibitors); 1 µgml-1 mouse anti-human IgE, 5 µM E64, and 50 µM APMSF (Anti-IgE+Inhibitors); 1 µgml-1 Der p1 (Der p1); or 1 µgml-1 Der p1, 5 µM E64, and 50 µM APMSF (Der p1+Inhibitors). Representative results from two independent, basophil donors are shown.
|
|
|
|---|
In human and animal models, there is evidence that basophils produce substantial amounts of IL-4 and IL-13. This has been recorded when basophils are challenged with antigens to which the basophil donor is sensitized or to substances, such as dietary lectins that interact with basophil cell-surface receptors [23 24 25 26 27 28 ].
When challenged with Der p1 or N. americanus ES products, KU182 basophils produced IL-13 at a substantially higher level than IL-4. Whether this reflects the consumption of IL-4 by KU812 cells [29 ] or is an innate characteristic of this cell line is not known. It is known, however, that the relative levels of IL-4 and IL-13 produced by basophils differ substantially depending on the stimulus used [30 , 31 ]. There are also data showing that the regulation of IL-4 and IL-13 production in basophils differs in kinetics and diagnostic sensitivity to immunosuppressive drugs, suggesting that different cell signaling pathways are involved in IL-4 and IL-13 gene expression [30 , 31 ]. This, in many instances, leads to rapid production of IL-4, sometimes within minutes of stimulation, and IL-13 is induced more slowly, peaking at 24 h [23 24 25 26 27 28 ].
The finding that proteases induced an increase in the expression of proallergic cytokines by KU812 and purified peripheral basophils was shown by use of mechanistic, class-specific protease inhibitors to be specifically a result of the proteolytic activity of the material used to challenge the basophils. This raises the important question of which of many potential target cell-surface substrates is cleaved to cause activation of basophils to produce cytokines.
There are several reports showing that proteolytic allergens cleave immunoregulatory receptors such as CD23 and CD25 [4 , 7 ]. These studies and those of others speculate that disturbance of immune regulation caused by receptor cleavage or changes in intercellular adhesion may be important factors in the maintenance of allergic immunity [32 ]. However, the regulatory activities of proteases are not confined to the immune system, and physiologically important protease targets are found on a wide range of nonimmune cell types. In particular, it has become recognized that many regulatory activities of proteases arise from their ability to directly activate cells via protease-activated receptors (PAR; reviewed in refs. [33 , 34 ]), and we suspect from preliminary experiments using agonist peptides of PAR on KU812 basophils (S. Foster and C. R. A. Hewitt, unpublished) that PAR may provide a link between proteolytic activity and the activation of cytokine release by basophils.
The purity of immunochemically isolated, proteolytically active Der p1 is a contentious subject, and it is arguable that we should have validated our results with recombinant Der p1. Although this viewpoint has its merits, there is no evidence to suggest that the available yeast-derived Der p1 is of higher purity than purified, native material (even commercial sources of recombinant Der p1 contain up to 5% impurities and
4% of dimeric molecules).
Furthermore, at a time when the effects of carbohydrate on the proteolytic function of native (
24 kDa) Der p1 are unknown, it is known that recombinant Der p1 is hyperglycosylated with up to 16 kDa of N-glycans [35
]. This contrasts with native Der p1, which has no detectable N-glycans but appears to have O-glycans that are not present on yeast-derived Der p1. Although these differences in glycosylation may account for the lower antigenicity of recombinant Der p1 compared with native Der p1 [35
], nothing is known about the effect of heterologous carbohydrates on the proteolytic activity or specificity of the protease.
Perhaps more importantly in the context of cytokine release by basophils, it is also not known whether any microbial carbohydrate recognition molecules on basophils interact with yeast-derived Der p1 in a different manner than that with the native material. Thus, without undertaking extensive steps to modify carbohydrate on recombinant Der p1, the effect of a recombinant protease on cytokine release by basophils will be unpredictable.
Our finding that proteolytic activities associated with substances that provoke allergic type 2 cytokine-dominated immune responses may be significant in explaining why only certain antigens provoke allergies.
In other systems, the innate and early release of IL-4 and IL-13 polarizes subsequent T cell responses toward type 2 cytokine production and thus, influences the development of IgE and eosinophilia [36 37 38 ]. Our findings show that the proteolytic activities of substances derived from allergenic organisms also cause an IgE-independent, innate, and early release of IL-4 and IL-13, which we speculate may be involved in the establishment of a type 2 T cell-promoting cytokine milieu that drives the characteristic allergic-immune response to helminth pathogens and house dust mites.
The implications of these findings for host defense or evasion of the immune system by pathogens are unknown; certainly as a noninvasive, noninfectious organism, the mechanism described can have no influence on the pathogenic effects of house dust mites. Nevertheless, it remains to be seen what controls and influences the balance between protease-induced innate immunity and protease-based evasion of immunity by parasites such as N. americanus [39 ].
Received July 11, 2002; revised October 10, 2002; accepted October 13, 2002.
|
|
|---|
-subunit of the human T cell interleukin-2 receptor, by Der p1, a major mite allergen with cysteine protease activity J. Exp. Med. 187,271-275
and IL-4 on the in vitro development of Th1 and Th2 clones J. Immunol. 148,2142-2147[Abstract]This article has been cited by other articles:
![]() |
T. Shen, S. Kim, J.-s. Do, L. Wang, C. Lantz, J. F. Urban, G. Le Gros, and B. Min T cell-derived IL-3 plays key role in parasite infection-induced basophil production but is dispensable for in vivo basophil survival Int. Immunol., September 1, 2008; 20(9): 1201 - 1209. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. D. Griffiths, A. P. Brown, D. S. W. Hooi, P. C. Pearce, R. J. Hornby, L. Scott, and D. I. Pritchard Development of a Model of Hookworm Infection Exhibiting Salient Characteristics of Human Infection Am J Trop Med Hyg, June 1, 2008; 78(6): 936 - 945. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Audicana and M. W. Kennedy Anisakis simplex: from Obscure Infectious Worm to Inducer of Immune Hypersensitivity Clin. Microbiol. Rev., April 1, 2008; 21(2): 360 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. I. Pritchard, D. S. W. Hooi, A. Brown, M. J. Bockarie, R. Caddick, and R. J. Quinnell Basophil Competence during Hookworm (Necator americanus) Infection Am J Trop Med Hyg, November 1, 2007; 77(5): 860 - 865. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. G. Shreffler, R. R. Castro, Z. Y. Kucuk, Z. Charlop-Powers, G. Grishina, S. Yoo, A. W. Burks, and H. A. Sampson The Major Glycoprotein Allergen from Arachis hypogaea, Ara h 1, Is a Ligand of Dendritic Cell-Specific ICAM-Grabbing Nonintegrin and Acts as a Th2 Adjuvant In Vitro J. Immunol., September 15, 2006; 177(6): 3677 - 3685. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Riedl, E. M. Landaw, A. Saxon, and D. Diaz-Sanchez Initial High-Dose Nasal Allergen Exposure Prevents Allergic Sensitization to a Neoantigen J. Immunol., June 1, 2005; 174(11): 7440 - 7445. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Min, M. Prout, J. Hu-Li, J. Zhu, D. Jankovic, E. S. Morgan, J. F. Urban Jr., A. M. Dvorak, F. D. Finkelman, G. LeGros, et al. Basophils Produce IL-4 and Accumulate in Tissues after Infection with a Th2-inducing Parasite J. Exp. Med., August 16, 2004; 200(4): 507 - 517. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||