,





* Department of Biochemistry and Immunology, Institute of Biological Sciences, Federal University of Minas Gerais, Brazil;
Centro de Pesquisas René Rachou, Oswaldo Cruz Foundation, Belo Horizonte, MG, Brazil; and
Ludwig Institute for Cancer Research, São Paulo, SP, Brazil
Correspondence: Dr. Ricardo T. Gazzinelli, Laboratory of Immunopathology, Centro de Pesquisas René Rachou, FIOCRUZ, Av. Augusto de Lima 1715, 30190-002 Belo Horizonte, MG, Brazil. E-mail: ritoga{at}dedalus.lcc.ufmg.br
|
|
|---|
4. Some of these genes were also shown to have enhanced expression in the cardiac tissue (DAP-12, A1, and GPI
4) from infected animals. The expression of GPI
4 was also enhanced in human monocytes stimulated with GPI-mucins or bacterial lipopolysaccharides. The complete sequence of the GPI
4 transcript and its gene including the 5' upstream region was defined. GPI
4 was encoded by a novel, single copy gene present in mouse as well as human genomes and showed conserved homology to different members of the guanine nucleotide exchange factor family.
Key Words: GPI-mucins NF-
B Ras-GEF Toll-like receptors
|
|
|---|
The pathology observed in chronic chagasic patients was initially attributed to autoimmune responses [5 ]. However, it is now believed that persistence of parasite is necessary for disease development [6 ]. Further, increased tissue parasitism has been observed in cardiac and digestive tissue from symptomatic chagasic patients [7 8 9 ]. Thus, it is assumed that immune response against parasite antigens or parasite molecules that promote leukocyte recruitment and inflammation are important components in the pathogenesis of Chagas disease. In fact, our previous studies show that molecules derived from T. cruzi trypomastigotes, named glicosylphosphatidyinositol-anchored mucin-like glycoproteins (GPI-mucins) possess potent activity in inducing the synthesis of proinflammatory cytokines [10 ], chemoattractant [11 12 13 ] molecules, as well as reactive nitrogen intermediates [14 ] by macrophages. More precisely, we showed that GPI-anchors, highly purified from GPI-mucins, contain a glycan core with four to eight hexosis in a 4.0 mannose:2.5 galactose ratio and unsaturated fatty acids in the sn-2 position of the alkyl-acylglycerolipid [15 ] and trigger the Toll-like receptor-2 (TLR-2) at subnanomolar concentrations [13 , 16 , 17 ].
As determined by the high level expression of interferon-
(IFN-
)-inducible chemokines (e.g., IFN-inducible protein-10; monokine induced by IFN-
; regulated on activation, normal T expressed and secreted) and adhesion molecules (vascular cell adhesion molecule-1 and fibronectin), the former cytokine also appears to play an important role in promoting the inflammatory environment in the heart of animals infected with T. cruzi [12
, 13
, 18
]. In fact, mice lacking the functional IFN-
gene display major changes in the CD4+ T and CD8+ T lymphocytes composition of inflammatory infiltrates, as well as enhanced tissue parasitism in the heart [19
, 20
].
As GPI-mucins and IFN-
are potent stimulators of macrophages, and these cells are a principal component in the inflammatory process in the chagasic heart [12
, 18
19
20
], we decided to investigate the pattern of gene expression in macrophages activated by GPI-mucins and/or IFN-
. We also intended to determine whether the genes induced in macrophages are also modulated in the heart tissue of mice experimentally infected with T. cruzi. mRNA populations of inflammatory macrophages cultured in the absence or presence of GPI-mucins and/or IFN-
were compared by the differential display reverse transcriptase-polymerase chain reaction (DDRT-PCR) [21
, 22
]. By using the reverse Northern blot technique [23
], we could confirm the differential expression of some genes in macrophages stimulated with GPI-mucins and IFN-
and in the heart tissue from mice experimentally infected with T. cruzi. Among the differentially expressed transcripts, we found a novel, single-copy gene, which is highly conserved in mouse and human genomes and encodes a putative protein with homology to genes from a family of the guanine nucleotide-releasing factors [24
25
26
].
|
|
|---|
Parasites
The CL strain [27
] of T. cruzi was continuously maintained in Swiss Webster outbred mice and was used in all in vivo experiments. T. cruzi trypomastigote blood forms were isolated by differential centrifugation of blood from acutely infected mice, counted, and used to infect new mice and obtain total RNA from different organs including the heart after infection with T. cruzi. The Y strain [28
] of T. cruzi was maintained in fibroblast cultures and was used as parasite source for purification of GPI-mucins. For the trypomastigote culture, L-929 fibroblasts were initially infected with blood trypomastigotes in a ratio of one parasite per cell. The tissue culture trypomastigotes were continuously passed in L-929 fibroblast cultures. The infected cultures were maintained in Dulbeccos modified Eagles medium (DMEM) containing 5% fetal calf serum (FCS) at 33°C in 5% CO2. After 4 or 5 days of culture, the parasites were collected daily and centrifuged at 40 g at 4°C for 10 min for cellular debris separation, followed by another centrifugation at 700 g at 4°C for 10 min. The resulting pellet containing live trypomastigotes was used to purify GPI-mucins.
Experimental infections
C3H/HeJ mice (males; weight, 2025 g) were infected intraperitoneally with 5000 blood trypomastigotes of the CL strain. The level of parasitemia was assessed daily using 5 µl fresh blood drained from the animal tail and using an optic microscope. Organs were removed at 20 days post-infection from animals displaying positive parasitemia and were used for RNA extraction.
Purification of T. cruzi-derived glycoconjugates
The GPI-mucins were isolated from T. cruzi trypomastigotes as described previously [10
, 15
] using sequential organic extraction followed by hydrophobic-interaction chromatography in an octyl-Sepharose column (Amersham Pharmacia Biotech, Uppsala, Sweden) and elution with a propan-1-ol gradient (560%).
Inflammatory murine macrophages
C3H/HeJ, C57BL/6, and CD1 mice were used as a source of inflammatory macrophages. The animals were injected with 1.5 ml 3% thioglycolate medium, and the elicited peritoneal exudate cells were harvested in cold, serum-free RPMI by peritoneal lavage 4 days later. The medium used in the macrophage (MacMed) cultures consisted of RPMI 1640 (Life Technologies, Grand Island, NY) supplemented with 2 mM L-glutamine, 80 µg/ml gentamicin, and 10% heat-inactivated FCS. Macrophages were resuspended in MacMed at 2 x 106/ml, and 10 ml was dispensed into 75 cm3 bottles. After 4 h incubation at 37°C in 5% CO2, the cells were washed with phosphate-buffered saline (PBS) to remove nonadherent cells, and 10 ml MacMed was added to each tissue-culture flask. The macrophages were then cultured for 6 h with medium alone, 20 ng/ml GPI-mucins, or 100 ng/ml lipopolysaccharide (LPS) in the presence or absence of 100 units/ml IFN-
as indicated.
Primary human macrophages
Human peripheral blood mononuclear cells were isolated from freshly collected buffy coats obtained from healthy, voluntary blood donors by Ficoll-Hypaque (Amersham Pharmacia Biotech) density gradient centrifugation. Isolated cells were resuspended at a concentration of 1 x 107 cells/ml in RPMI-1640 medium (Life Technologies), and 1 ml was added in 24-well plates and incubated for 1 h at 37°C. Nonadherent cells were removed by gentle pipetting, and the plastic adherent cells were rinsed with 1 ml RPMI [29
]. The remaining adherent cells were cultured in complete media supplemented with 10% human AB plasma and 1% HEPES and were cultured for 7 days at 37°C. On day 7, the cells were stimulated with IFN-
(400 units/ml), GPI-mucins (20 ng/ml), and/or LPS (400 ng /ml) for 6 h, rinsed with PBS, and used to isolate total RNA. The FIOCRUZ Ethical Committee approved the experiments using primary human macrophages.
Murine T cell lines
Murine T cell clones, specific for the interphotoreceptor retinoid-binding protein and characterized as T helper cell type 1 (Th1) and Th2 clones, were obtained as described previously [30
] and kindly provided by Dr. Luiz Vicente Rizzo (Department of Immunology, University of São Paulo, Brazil). Briefly, 5 x 106 cells were cultured in DMEM supplemented with 10% FCS, 10-5 nM 2-mercaptoethanol (Sigma Chemical Co., St. Louis, MO), 2 mM L-glutamine, 0.1 mM nonessential amino acids, and vitamins (Life Technologies) in the absence (control) or presence (activated) of 2.0 µg/ml phytohemagglutinin (PHA) and were harvested 24 h later for total RNA extraction and Northern blot analysis.
Total RNA isolation
For RNA isolation, macrophages or T cell lines were washed with cold PBS once at 6 h or 24 h post-stimulation, and RNA was extracted as described by Chomczynski and Sacchi [31
]. For extraction of total RNA from organs from uninfected or infected mice, tissue fragments were homogenized in Trizol (Life Technologies), and RNA was extracted as recommended. When necessary, genomic DNA was removed from total RNA by treatment with DNase I.
DDRT-PCR
Inflammatory macrophages were cultured in medium alone or in the presence of GPI-mucins and/or IFN-
, and total RNA was extracted at 6 h post-stimulation. The total RNA was then treated with DNase I to eliminate contamination with genomic DNA. DNA-free, total RNA (200 ng) extracted from macrophage cultures was reverse-transcribed using 200 units Super-Script II RT (Gibco-BRL, Gaithersburg, MD) in a 20-µl reaction in DEPCH2O containing 25 pmoles dT11VC (V=A, C, or G)-anchored primer. The reaction mixture was incubated for 60 min at 42°C. One-tenth of the cDNA first-strand reaction was added to 18 µl PCR-labeling mix containing 0.2 µCi/µl [
32P]dCTP, 2.5 µM dT11VC, and 0.5 µM of one of three short arbitrary primers (p13: 5'-CTGATCCATG-3'; p14: 5'-CTGCTCTCAA-3'; p15: 5'-CTTGATTGCC-3'). PCR was performed at 95°C for 1 min and 40 cycles at 94°C for 30 s, 40°C for 2 min, and 72°C for 30 s, followed by 72°C for 5 min. The PCR products (4 µl) were fractionated through a 6% denaturing polyacrylamide-sequencing gel [21
, 22
]. After electrophoresis, the gel was exposed to Kodak film for 28 h. As control, we amplified RNA samples after DNase treatment and before reverse transcription. No DNA fragments were generated from this reaction.
A total of 30 differentially represented bands was recovered from the sequencing gel, eluted in water, and reamplified using the same primers and PCR conditions as described above, except that no radioactive nucleotide was included. Reamplified products were cloned into pUC18 using the Kit Sure clone (Amersham Pharmacia Biotech). Cloned fragments were sequenced by automated DNA sequencing (ABI 377; Applied Biosystems, Foster City, CA).
Sequencing and sequence analysis
Plasmids derived from at least two different colonies were sequenced on automated DNA sequencers (ABI Prism, Applied Biosystems). Sequence homology of the cloned cDNA fragments with known cDNAs was determined using the BLAST program at the National Center for Biotechnology Information (Bethesda, MD).
Reverse Northern dot-blot
The cDNA inserts recovered from DDRT-PCR gels were amplified by PCR using M13 Rev and forward primers and were immobilized on nylon membranes (Hybond N, Amersham Pharmacia Biotech) in duplicates in two different dilutions. We also immobilized a fragment corresponding to the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene and amplified product of an empty plasmid as positive and negative controls, respectively. Complex cDNA probes labeled with [
-32P]dCTP were made with 30 µg total RNA using the Superscript preamplification system (Superscript transcriptase, Gibco-BRL) and oligo (dT) 1218 (Gibco-BRL). The reaction was performed in a 30-µl final volume, and the RNA was then hydrolyzed by a 30-min incubation at 65°C in the presence of 3 µl 3 M NaOH. The mixture was neutralized by adding 10 µl 1 M Tris-HCl (pH 7.4), 3 µl 2N HCl, and 9 µl H2O. Unincorporated nucleotides were removed by passage through a G25 Sephadex column (Boehringer Mannheim, Mannheim, Germany). Prehybridization, hybridization, and washes were performed as described by Church and Gilbert [32
]. Blots were placed onto a phosphor screen for 1 day, and results were analyzed in a Phosphor Image (Molecular Dynamics, Sunnyvale, CA) and ImageQuant software (Amersham Pharmacia Biotech).
Northern blot analysis
Total RNA samples (15 µg/lane) were fractionated through a 1% denaturing agarose/formaldehyde gel and blotted onto nylon membranes (Amersham Life Sciences, Little Chalfont, UK). The blots were prehybridized and hybridized as described by Church and Gilbert [32
] with [
-32P]dCTP-labeled cDNA probes for GPI
4 (376 bp), interleukin (IL)-18 (210 bp), DAP-12 (220 bp), and A1 (405 bp) obtained from fragments cloned from DDRT-PCR. The expression of GPI
4 was also assessed with a probe obtained from a plasmid from the MAM6 library IMAGE Consortium #2631273, containing 1169 bp cDNA fragment that included the 376-bp GPI
4 fragment. A probe for mouse GAPDH [33
] was used to ensure equal RNA loading.
Southern blot analysis
Genomic DNA was obtained from the tail of the C56BL/6 mouse or from the human fibroblast cell line GM637. DNA (20 µg) was digested with the indicated restriction enzymes (New England Biolabs, Beverly, MA), fractionated through a 0.8% agarose gel, and blotted onto a nylon membrane (Hybond N, Amersham Pharmacia Biotech) as described [34
]. Filters were prehybridized and hybridized as described by Church and Gilbert [32
] using the [
-32P]dCTP GPI
4 cDNA probes.
RT-PCR
Detection of GPI
4 as well as the housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (HPRT) mRNAs were performed by RT-PCR under nonsaturated conditions. Total RNA was isolated from the organs of uninfected or infected mice (20 days post-infection): heart, brain, lymph node, and muscle. Total RNA from monocyte cultures was isolated 6 h post-stimulation with IFN-
(400 units/ml), GPI-mucins (20 ng/ml), and/or LPS (400 ng /ml). Total RNA (1 µg) from each organ or cell preparation was reverse-transcribed, and 2 µl from a 20-µl final reaction was used as template in a 23-cycle PCR reaction using the following primers for the mouse GPI
4N: 5'-GCACCTGGATGGACTTTTGT, 3'-GCCAAGCCTGTTGAGATGACGC; human GPI
4N: 5'-GCACCTGGATGGACTTTTGT, 3'- TTTCCTACCACAGTGTTGCG; mouse HPRT: 5'-GTTGGATACAGGCCAAGACTTTGTTG, 3'-GATTCAACTTGCGCTCATCTTAGG; human HPRT: 5'-CGAGATGTGATGAAGGAGATG, 3'-GGAACCAGTCCGTCATATTAGG. The results were visualized in a silver-stained 6% acrylamide gel [35
].
Cloning of the full-length GPI
4 cDNA
The full-length sequence of the GPI
4 cDNA was deduced from blasting the available sequence against the mouse genome using the CELERA database as described in Results below. Based on the deduced sequence, primers were designed for the RT-PCR cloning and sequence confirmation of the entire GPI
4 cDNA. The 5' upstream sequence and intron sequences were deduced from the CELERA database. Exon-intron boundaries were confirmed by the cDNA sequence. Primers used in RT-PCR and for sequencing were as follows: 5'-TCGACCCTTCCCGGTCCTGA-3', 5'-CTCAGCAATGTTTGACAGCA-3', 5'-TGGAAGCCCTTATCCAACAC-3', 5'-TCCGGGACGAGAGAATGATG-3', and 5'-ACGGAAGAAAACACGGAACT-3' (forward primers) and 5'-CAGCAGCAGCATTTTCCAGA-3', 5'-AAGGGGATGTCTGCAGTAGA-3', 5'-CCCCAAGACCCTTAAAGTCA-3', and 5'-CAACTTGGAGACAGGCCAAG-3' (reverse primers).
|
|
|---|

, and total RNA was extracted at 6 h post-stimulation. DNA-free, total RNA was used as template for the synthesis of cDNA using the primer T11VC. The cDNA was then amplified by PCR using the T11VC and the arbitrary primers 13, 14, or 15 of 10 nucleotide-long and radioactive nucleotide. PCR products obtained from cDNA preparations derived from macrophage exposed to different stimuli were then compared in a sequencing gel (6% of acrylamide). Although many different bands could be visualized, we selected and excised 30 bands from the sequencing gel. As shown in Figure 1
and Table 1
, selected bands were from unstimulated macrophages (five bands), from macrophages stimulated with GPI-mucins (13 bands), with IFN-
(seven bands), or with IFN-
plus GPI-mucins (five bands). These cDNAs were eluted from the gel, reamplified, used to prepare the DDRT-PCR, cloned, and sequenced (Table 1)
.
![]() View larger version (100K): [in a new window] |
Figure 1. Differential display of mRNAs from macrophage control (not stimulated; a), stimulated with GPI-mucins (b), stimulated with IFN- (c), or stimulated with IFN- plus GPI-mucins (d). Inflammatory macrophages were isolated from C3H/HeJ mice after 4 days of thioglycolate injection, washed, and transferred to small tissue-culture flasks. After removal of nonadherent cells, a monolayer was incubated for 6 h with medium alone (control), GPI-mucins (2 nM), IFN- (100 units/mL), or GPI-mucins (2 nM) plus IFN- (100 units/mL). The purified RNA (0.2 µg), obtained from each macrophage population, was reverse-transcribed with T11VC primers, and an additional short arbitrary primer (p13: 5'-CTGATCCATG-3'; p14: 5'-CTGCTCTCAA-3'; p15: 5'-CTTGATTGCC-3') was used for the PCR reaction as described in Materials and Methods. Radiolabeled PCR products were then fractionated in a sequencing gel. DNA fragments that appear to be differentially expressed are marked by arrows and numbered.
|
|
View this table: [in a new window] |
Table 1. cDNA Fragments from DDRT-PCR, Their Sequence Deposited in Nonredundant and EST GenBank Data, and Assessment of Their Expression by Reverse Northern Blot Analysis
|
![]() View larger version (48K): [in a new window] |
Figure 2. Identification of genes that are differentially expressed in macrophages following GPI-mucin treatment and in the heart of mice after 20 days of T.cruzi infection. The products of PCR reactions using the plasmids containing the DDRT-PCR products as templates were blotted in two serial dilutions (1:1, 1:4) on duplicate filters as indicated and were probed with 32P-labeled first-strand cDNAs from (A) macrophages (control; top left blot); GPI-mucin-treated macrophages (top right blot); uninfected cardiac tissue (bottom left blot); and 20 days post-T.cruzi infection cardiac tissue (bottom right blot). The circles surround the clones that were selected for having higher signal intensity in one of the filters. The squares surround the fragments corresponding to the gene for GAPDH, used as a positive control. The identification of the circled clones used in this study was DAP-12 (B1/B2), IL-18 (B11/12), GPI 4 (F3/F4), and A1 (C7/8). The identification and scores of differential expression of different clones are shown in Table 1
. (B) Differential expression of GPI 4, IL-18, A1, DAP-12, and GAPDH in macrophages activated with GPI-mucins and heart from mice after 20 days of T. cruzi infection. Northern blot analysis was performed with 15 µg RNA obtained from inflammatory macrophages and from C3H/HeJ mice cultured with medium alone (lane a) and GPI-mucins (2 nM; lane b) for 6 h. Lanes c and d have 15 µg RNA from heart of C3H/Hej mice: control (uninfected) and 20 days post-T. cruzi infection, respectively. The filters were probed with GPI 4 (left) and IL-18, DAP-12, or A1 (right) probes, all labeled with 32P. The filters were then reprobed with 32P-labeled GAPDH probe to ensure that equal amounts of RNA were loaded. The RNA preparations from cardiac tissue were obtained from three uninfected and three infected mice. The Northern blot analyses were repeated at least twice, yielding identical results.
|
Radioactive-labeled DNA encoding fragments 28 (GPI
4) and 30 (A1) hybridized with RNA preparations obtained from GPI-mucin-stimulated macrophages and cardiac tissue from mice at 20 days post-infection with T. cruzi. Low hybridization levels were observed with RNAs obtained from unstimulated macrophages or cardiac tissue from noninfected animals. A1 is a previously reported gene from the bcl-2 gene family that encodes an antiapoptotic protein and is shown to be elicited during infection with the protozoan parasite Toxoplasma gondii [37
, 38
]. The DNA fragment 28 was found to encode a sequence present within an expressed sequence tag (EST) from the IMAGE Consortium (gb|AW413376.1|) but not related to any known gene. Therefore, we decided to investigate and characterize the putative gene encoded by the fragment 28, named GPI
4 here.
Differential expression of GPI
4 by activated murine macrophages
First, we confirmed that GPI
4 was expressed by macrophages cultured under different conditions. The differential expression of GPI
4 mRNA in macrophages exposed to GPI-mucins (or LPS) and/or IFN-
was confirmed by Northern blot analysis. As shown in Figure 3A
, low levels of GPI
4 mRNA were expressed by inflammatory macrophages C3H/HeJ (hyporesponsive to LPS) cultured in medium alone. A small increase in expression of GPI
4 mRNA was observed when macrophages from C3H/HeJ were cultured in the presence of IFN-
. In macrophages from C3H/HeJ mice stimulated with GPI-mucins, we observed a fivefold increase of GPI
4 mRNA expression. Similar results were obtained when inflammatory macrophages from C57BL/6 mice were stimulated with GPI-mucins (Fig. 3B
and 3C)
or macrophages from CD1 mice stimulated with LPS (Fig. 3D)
. The expression of GPI
4 mRNA by macrophages exposed to GPI-mucins was already noticeable at 2 h and persisted up to 24 h post-stimulation (Fig. 3C)
. In most experiments, IFN-
was shown to have a weak or no effect on GPI
4 mRNA expression. In contrast, the ability of IFN-
to enhance the GPI
4 mRNA expression elicited by GPI-mucins or LPS was always evident (Fig. , , 3A
3B
and 3D)
. As control, we hybridized these same filters with a probe containing a fragment of the murine GADPH gene. The hybridization with the GAPDH probe showed that different samples of RNA were quite homogeneous. Finally, we showed that expression of GPI
4 mRNA was not restricted to macrophages and that enhanced expression of this unknown gene was also enhanced in Th1 or Th2 murine cell clones activated with mitogen (Fig. 3E)
. Expression of GPI
4 mRNA was not observed in the same clones of Th lymphocytes that were not activated with mitogen. These results clearly link the expression of GPI
4 mRNA with the activation stage of macrophages and T lymphocytes.
![]() View larger version (46K): [in a new window] |
Figure 3. Northern blot analysis of differentially expressed GPI 4 mRNA in macrophages activated with GPI-mucins. Northern blot was performed with 15 µg RNA obtained from inflammatory macrophages. Experiments performed with inflammatory macrophages from C3H/HeJ mice (A) and C57BL/6 mice (B) show the results with unstimulated macrophages (lane 1) and macrophages stimulated for 6 h with GPI-mucins (lane 2; 2 nM), IFN- (100 units/mL; lane 3), or GPI-mucins (2 nM) plus IFN- (100 units/mL; lane 4). (C) The kinetics of GPI 4 expression in macrophages activated with GPI-mucins (2.5 2 nM) for 2, 6, and 24 h is also shown. (D) Experiments performed with inflammatory macrophages from CD1 mice show differential expression of GPI 4 in unstimulated macrophages (lane 1), macrophages activated with IFN- (100 units/mL; lane 2), LPS (40 ng/mL; lane 3), or LPS (40 ng/mL) plus IFN- (100 units/mL; lane 4) after 6 h of stimulation. (E) Differential expression of GPI 4 in Th1 and Th2 cells, control and activated with PHA (1 µg/mL). All the filters were probed with radiolabeled GPI 4 probe and reprobed with GAPDH cDNA to ensure that equal amounts of RNA were loaded. The Northern blot analyses were repeated at least twice, yielding identical results.
|
4 mRNA and detection of the GPI
4 gene in the mouse genome
4 mRNA in vivo. C3H/HeJ mice were infected with 5000 trypomastigotes from the CL strain of T. cruzi and parasitemia followed from day 1 to day 20 post-infection (data not shown). Different organs (i.e., brain, heart, intestine, kidney, liver, lung, lymph node, muscle, spleen, and thymus) were collected from mice at days 0 (uninfected controls) and 20 post-infection, and part of each organ was used for total RNA extraction for Northern blot or RT-PCR analysis. Our results showed no level or low levels of constitutive expression of GPI
4 mRNA in the heart, lung, lymph nodes, and thymus (Fig. 4A
and B
). High levels of constitutive expression of GPI
4 mRNA were observed in the brain, intestine (Fig. 4A)
, and testis (not shown) of noninfected mice and persisted in infected mice. Enhanced expression of GPI
4 mRNA was observed in the kidney, liver, spleen, and thymus from animals at day 20 post-infection (Fig. 4A)
. The RT-PCR confirmed some of these results, showing that heart and lymph nodes from three infected animals had enhanced GPI
4 expression when compared with the same organs from uninfected animals (Fig. 4B)
. We did not detect a GPI
4 expression in muscle tissue (Fig. 4A
and 4B)
. The presence of this sequence in the mouse genome was confirmed by Southern blot analysis. Figure 4C shows that the GPI
4 probe hybridizes with a genomic fragment in DNA digested with XbaI, HindIII, ApaI, or EcoRI, indicating that GPI
4 is encoded by a single copy gene.
![]() View larger version (58K): [in a new window] |
Figure 4. C3H/HeJ mice were infected with 5000 trypomastigotes CL strain of T. cruzi and organs harvested at days 0 (uninfected controls) and 20 post-infection. (A) Northern blot analysis was performed with 15 µg RNA obtained from each organ (thymus, brain, lung, intestine, spleen, muscle, kidney, and liver) from control (-) and 20 days post-T. cruzi infection mice (+) to analyze the GPI 4 expression. The blots were reprobed with radiolabeled GAPDH cDNA to ensure that equal amounts of RNA were loaded in each lane. These results are from one representative out of four experiments. (B) RT-PCR analysis of RNA from lymph nodes, brain, heart, and muscle of C3H/HeJ control mice (-) and 20 days post-infection mice (+). Each RNA sample (1 µg) was reverse-transcribed using an oligo d (T) and GPI 4, or HPRT-specific primers were used in a PCR reaction, as described in Materials and Methods. (C) Southern blot analysis of genomic DNA isolated from the tail of a C57BL/6 mouse. DNA (20 µg) was digested at 37°C for 18 h with the restriction enzymes XbaI, HindIII, ApaI, and EcoRI. DNA was then precipitated, fractionated on 0.8% agarose gel, and transferred to a nylon filter. The filter was hybridized with a 32P-labeled GPI 4 cDNA.
|
4 murine gene
. GPI
4 was cloned and sequenced, revealing identity to an already deposited EST (IMAGE Consortium MAM6, AC #gb|AW413376.1|). We obtained the corresponding plasmid and sequenced 1169 bp that contain the complete 376 bases of fragment 28. In silico analysis of the 1169-bp fragment revealed a potential open reading frame that was opened on its 5' end. A predictable human ortholog (AC #BAB71130) was identified against in the NCBI database, its encoding RNA (AC #AK056257) was mapped on the CELERA human genome database, and the predicted gene structure and exon-intron boundaries were defined. In parallel, we blasted the 1169 bp against the CELERA mouse genome database and identified the genome sequence in which this cDNA is encoded. The exon-intron structure deduced for the human gene was used to define the exon-intron structure of the mouse gene.
As the first exon of the human gene is a noncoding exon, there was no homology between its sequence and the mouse genome. Also, we identified a CpG island within the human genome upstream from exon 1, and based on this information, we also found a CpG island in the mouse genome upstream from what we believed was the mouse Exon 1. We next looked for a potential splicing donor site downstream from this CpG island and used this information as a potential indicator of Exon 1 sequence. Based on the sequence information of the mouse gene, primers were designed to amplify the entire GPI
4 cDNA. The overlapping, amplified DNAs were then sequenced to confirm the predictions obtained from the CELERA database. In Table 2
and Figure 5
, we present the structure of the GPI
4 gene, including its 5' upstream potential promoter region (Fig. 5A)
and 14 exons (Fig. 5B)
. In the cDNA sequence presented in Figure 5B
, we marked regions encoded by the 14 exons and the nucleotides separated by the intervening introns. A potential start codon (ATG, nucleotides 148150), a termination code (TAA, nucleotides 15671569), and a polyadenylation site (AATACA, nucleotides 28772882) are underlined. We have recently deposited in the NCBI database the complete sequence of the GPI
4 gene and cDNA, and they can be accessed by using the numbers AY129964 and AY129963, respectively.
|
View this table: [in a new window] |
Table 2. Size of Exons and Introns form Genes of the Murine and Human Encoding a Putative Guanine-Realizing Factor
|
![]() View larger version (81K): [in a new window] |
Figure 5. (A) 5' Upstream sequence of GPI 4 gene containing high CG content, three sites for SP-1 and for NF- B. DNA motifs for c/EBP and AP-2 transcription factors are also indicated. (B) Complete cDNA sequence derived from mRNA from activated macrophages is shown. Dotted line separate regions encoded by different exons identified in the cytogenetic band 5E2 from murine chromosome 5. Primers were designed based on the sequence information of the mouse gene, were used to amplify entire GPI 4 cDNA from activated macrophages, and were confirmed by DNA sequencing. A start codon (ATG, nucleotides 148150), a termination code (TAA, nucleotides 15671569), and a polyadenylation site (AATACA, nucleotides 28772882) are underlined.
|
4 gene shows a high CG content as well as three sites for the transcription factor Sp-1 [39
]. We also identified three sites for the transcription factor nuclear factor (NF)-
B (Fig. 5A)
that could be responsible for enhancement of the GPI
4 gene transcription observed in macrophages activated with LPS, GPI-mucins, T lymphocyte stimulated with PHA, as well as lymphoid organs from mice infected with T. cruzi.
Differential expression of GPI
4 by activated human macrophages and detection of the GPI
4 gene in the human genome
We next investigated the expression of GPI
4 in human monocytes. Figure 6A
shows a RT-PCR analysis of GPI
4 expression in human monocytes from two healthy donors stimulated with GPI-mucins, LPS, and/or IFN-
. We observed a differential expression in macrophages activated with GPI-mucin, IFN-
, or LPS. As observed in mouse cells, we verified that IFN-
up-regulates GPI
4 expression in LPS-treated macrophages. We also confirmed the presence of GPI
4 within the human genome (Fig. 6B)
by Southern blot analysis using a plasmid containing a segment of the murine GPI
4 gene. Figure 6B
shows that the GPI
4 cDNA probe hybridized with a single genomic fragment in DNA digested with ApaI, HindIII, or EcoRI is also a single-copy gene in the human genome. Our in silico analysis using NCBI and CELERA databases also evidenced a human gene, and the data presented in Table 2
show the conserved structure of mouse (located at chromosome 5, cytogenic band 5E2) and human (chromosome 4, cytogenic band 4q124q21) genes, including the exact size of the coding Exons 213.
![]() View larger version (30K): [in a new window] |
Figure 6. (A) RT-PCR analysis of the GPI 4 gene expression in primary human macrophages unstimulated or activated with IFN- (100 units/mL), GPI-mucins (2 nM), LPS (500 ng/mL), and LPS (500 ng/mL) plus IFN- (100 units/mL). RNA (1 µg) was reverse-transcribed using an oligo d (T), and GPI 4-specific primers were used in the PCR reaction. (B) Southern blot analysis of genomic human DNA. DNA (20 µg) was isolated and digested with the restriction enzymes ApaI, HindIII, and EcoRI at 37°C for 18 h. After digestion, DNA was precipitated, fractionated on 0.8% agarose gel, and transferred to a nylon filter. The filter was hybridized with a 32P-labeled GPI 4 cDNA.
|
4 gene as a Ras-associated guanine nucleotide exchange factor (Ras-GEF)
4 cDNA (Fig. 7
). The only differences are 12 conservative amino acid substitutions, and at protein level, they presented 97.6% of homology. Some structural features of mouse and human proteins were deduced from their amino acid sequences. The GPI
4 protein contains two domains, a Ras-GEFN domain and a Ras-GEF domain, encoded by amino acids 40138 and 201455, respectively. The Ras-GEFN domain was considered to be a CDC25-like domain, which is present in a cell division control (CDC) protein from Saccharomyces sp. The Ras-GEFN was also shown to contain a leucine zipper (LFMHPYELMAKVCHLCVEHQRL) encoded by amino acids 7293 with four leucines containing six intervening amino acids between each two leucines. The Ras-GEF domain contains three motifs of nuclear localization, PVKKKHR, PVSRLKK, and PFERDRK, encoded by amino acids 276282, 316322, and 421427, respectively.
![]() View larger version (72K): [in a new window] |
Figure 7. Comparative analysis of the mouse and human hypothetical homologous GPI 4 proteins. (A) Localization of Ras-GEFN (CDC25-like domain) and Ras-GEF domains present in mouse and human homologues. (B) Amino acid sequence alignment of mouse hypothetical GPI 4 protein shows 97.6% of homology to the human ortholog (AC #BAB71130). The Ras-GEFN (CDC25-like domain) and Ras-GEF domains are encoded by amino acids 40138 and 201455, respectively, and are in gray, italic, and underlined. The Ras-GEFN domain contains a leucine zipper encoded by the amino acids 7293 (LFMHPYELMAKVCHLCVEHQRL), which are underlined and highlighted in black. Within the Ras-GEF domain, there are three motifs of nuclear localization, PVKKKHR, PVSRLKK, and PFERDRK, encoded by amino acids 276282, 316322, and 421427, respectively, which are underlined and highlighted in black. The intervening sequence and + indicate identical and distinct amino acids, respectively, when comparing mouse and human orthologs.
|
4 protein. Although, we found a large number of proteins containing Ras-GEFN and Ras-GEF domains, in the analysis presented here, we were restricted only to the proteins that presented the highest index of homology with the hypothetical GPI
4 and displayed only the Ras-GEFN and Ras-GEF and not other domains. The known proteins that presented the highest homologies were the CDC protein from Caenorhabditis elegans (5e-65); aimless Ras-GEF from Dictyostelium discoideum (5e-21); cyclic adenosine monophosphate (cAMP)-regulated GEF-II from D. discoideum (9e-17); Ras-specific guanine nucleotide-releasing factor (Ras-GRF) from Homo sapiens (5e-16); SCD25 protein (version 2) from Saccharomyces cerevisiae (2e-15); and the chain S, complex of human h-Ras with human Sos-1 from H. sapiens (1e-13). The consensus sequences for Ras-GEFN and Ras-GEF domains are shown on the top of sequence alignment in Figure 8A
and 8B
, respectively.
![]() View larger version (80K): [in a new window] |
Figure 8. Sequence alignment of proteins presenting the highest levels of homology with the hypothetical protein encoded by the complete sequence of GPI 4 cDNA: cell division control protein from C. elegans (5e-65; AC #NP_501217.1); aimless Ras-GEF from D. discoideum (5e-21; AC #AAB09441.1); cAMP-regulated GEF-II from D. discoideum (9e-17; AC #AAL99297.1); Ras-GRF from H. sapiens (5e-16; AC #I58371); SCD25 protein (version 2) from S. cerevisiae (2e-15; AC #S64758); and the chain S, complex of human h-Ras with human Sos-1 from H. sapiens (1e-13; AC #1BKDS). (A and B) The consensus sequence for Ras-GEFN and Ras-GEF is also shown and illustrates the degree of homology of the above-mentioned proteins within these domains.
|
|
|
|---|
Although the role of the immune system as an important mediator of the above-mentioned pathological process is well-established, the molecular and cellular steps involved in the initiation of the inflammation elicited by T. cruzi parasites are largely unknown. Different studies show the ability of T. cruzi parasites to trigger different signaling pathways and the expression of innumerable genes and various cellular functions in macrophages, fibroblasts, endothelial cells, and cardiomyocytes [10 11 12 13 14 15 16 17 , 40 41 42 43 44 45 46 47 48 49 50 ]. These studies suggest that the activation of host cells and expression of various genes are directly induced by parasite molecules or by immunologically active molecules previously elicited by T. cruzi parasites [10 11 12 13 14 15 16 17 , 40 41 42 43 44 45 46 47 48 49 50 ]. Among the cellular functions elicited by T. cruzi infection is the production of proinflammatory, chemoattractant, and adhesion molecules as well as molecules that control the extravascular extravasations [42 , 45 46 47 48 49 50 ], all thought to be important in the process of leukocyte activation and recruitment to the site of inflammation.
The ability of trypomastigotes to induce the synthesis of proinflammatory cytokines and chemokine macrophages is mimicked by in vivo and in vitro stimulation with highly purified GPI-mucins [10
11
12
13
14
15
16
17
]. In the present study, we identified novel genes, where expression was induced in macrophages exposed to GPI-mucins and during myocarditis, elicited by infection with T. cruzi. For this purpose, we used the DDRT-PCR technique coupled with the RNB to screen a higher number of genes. The usefulness of this approach was validated with the identification of genes such A1, IL-18, and DAP-12, known to be highly expressed by activated and resting macrophages, respectively [36
37
38
]. As DAP-12 is constitutively expressed in myeloid cells, we assume that the differential expression of DAP-12 during chagasic myocarditis may reflect the influx of myeloid cells to the heart of infected mice. Conversely, A1 expression in the heart from infected mice may reflect the activated state of the infiltrating cells. The lack of expression of IL-18 mRNA in the heart from infected mice was attributed to the sensitivity of the Northern blot analysis, as other markers of macrophage activation, such as IL-1, tumor necrosis factor
, IL-12, and various chemokines, have been previously shown in cardiac tissue from infected mice [11
, 12
]. Among the various cDNA identified, we found the GPI
4, which was positively modulated in macrophages exposed to GPI-mucins and in cardiac tissue from infected mice. The GPI
4 fragment initially cloned had no homology to any gene described previously.
After determining the complete sequence of the GPI
4 cDNA, we found that it encoded a novel, hypothetical protein containing two domains related to Ras-GEFN and Ras-GEF. These domains are common to the family of GEFs involved on activation of members of the family of Ras-GTPases, which are molecular switches cycling between the active-guanosine 5'-triphosphate (GTP)-bound and inactive guanosine 5'-diphosphate (GDP)-bound states. Upon activation by extracellular stimuli, the GEFs promote the release of inactive GDP from Ras, allowing their replacement with active GTP, which is present in molar excess in the cytoplasm [51
, 52
]. This GTP-bound Ras adopts an active conformation and signals downstream-effector proteins such as the Raf, phosphoinositide-3-kinase, and Ral-GDS [51
, 52
].
The Ras-GEFN is a domain present in a subset of GEFs for Ras-like, small GTPases. The crystal structure of the Sos-1 revealed that the Ras-GEFN domain is in essence
-helical with a structural role [53
]. In fact, GPI
4 was shown to have a high homology (1e-13) with the chain S of human Sos-1, known to be involved in forming complex with h-Ras. It is noteworthy that the Ras-GEFN also displayed a leucine-zipper pattern that is normally involved in associations with other proteins. The Ras-GEF domain is also found in GEFs specific for Ras proteins. Similar domains have been found in yeast CDC25 [54
] and SCD25 [55
] from yeast and are involved in cell-division control. In the Ras-GEF domains from GPI
4, we could identify three motifs for nuclear localization. In fact, other GEFs such as RCC1 [56
] and CDC42 [57
] were found, respectively, to be localized and targeted to the nucleus under certain physiological conditions. The RCC1 is primarily found inside the nucleus bound to chromatin [56
] associated to Ran, a member of the Ras-like GTPases, which is predominantly found in the cell nuclei as well [58
]. Thus, the motifs for nuclear localization present in the Ras-GEF domain from GPI
4 may indicate that this GEF may act in association to a Ras-like GTPase found in the cell nuclei.
The Ras superfamily consists of the Ras, Rho, Rab, Raf, and Ran families. The Ras family includes the Ras proteins (HA-Ras, KI-Ras, and N-Ras) and the TC21, R-Ras, M-Ras, Rap, Ral, RHEB, Rin, Rad, Kir/Gem, Rit, and K-B-Ras proteins [51
, 52
]. Although the function of many of these GTPases remains to be determined, they are presumably all regulated by similar GDP/GTP cycles. These proteins are grouped because of their similar amino acid sequence, but their known functions can differ quite significantly, varying from cellular proliferation, differentiation, and other roles in fully differentiated cells. This is because they can be activated by different upstream signals and affect distinct sets of downstream target proteins and signaling pathways. Although, we found a large number of proteins containing both domains, we focused our search to homologue proteins that have only the Ras-GEFN and Ras-GEF domains. In the NCBI database, the six proteins contain only the Ras-GEFN and Ras-GEF domains and with highest homology with the putative GPI
4 protein were the cell division control proteins from C. elegans (5e-65); aimless Ras-GEF from D. discoideum (5e-21); cAMP-regulated GEF II from D. discoideum (9e-17); Ras-GRF from H. sapiens (5e-16); SCD25 protein (version 2) from S. cerevisiae (2e-15); and the chain S from complex of human h-Ras with human Sos-1 from H. sapiens (1e-13). Although all the above proteins were classified as GEFs and were consistently associated to Ras [53
54
55
, 59
, 60
], their potential activities varied from involvement on cell-division control [55
] to processing chemotactic signals through the G-protein-coupled receptor [59
]. At the time of preparation of this manuscript and annotation of the GPI
4 gene to the CELERA database, the same gene was annotated by the NCI Annotation Project and deposited (on 5/15/02) in NCBI Genebank (AC #20838780). However, the predicted first and last exons, defined by in silico NCBI analysis, were incorrectly identified. Also, there is a misanotated splicing acceptor site at the boundary of Exon 5, leading to the loss of the first amino acid (glutamine) encoded by this exon. We confirmed the exons by sequencing the entire cDNA, so the nucleotide and amino acid sequences presented here should be the correct ones.
Although at this moment, we cannot attribute a specific function for the Ras-GEF protein encoded by the GPI
4 gene, the results of GPI
4 mRNA expression provide some interesting clues. First, we found a high constitutive expression of GPI
4 mRNA in brain, intestine, and testis (not shown) from uninfected mice. The lungs from uninfected mice expressed intermediary levels of GPI
4 mRNA. In contrast, we found that lymphoid organs such thymus, lymph nodes, and spleen as well as other peripheral organs/tissues such as the muscle, heart, kidney, and liver expressed very low (or none) levels of GPI
4 mRNA. It is interesting that in tissue from infected mice, we observed a significant enhancement of GPI
4 mRNA expression in lymphoid organs (i.e., thymus, spleen, and lymph nodes) and to a lesser extent, in the heart, kidney, and liver.
Consistent with our observations in vivo, we detected low levels of expression of GPI
4 mRNA in nonactivated murine inflammatory macrophages, nonactivated human primary macrophages, or murine-resting Th cell lines. Importantly, when human and mouse macrophages were activated by TLR agonists, such as GPI-mucins (agonist for TLR-2) and LPS (agonist for TLR-4) [17
, 61
], or Th1 as well as Th2 murine cell lines were activated with PHA, we observed a consistent and significant increase of GPI
4 mRNA. These results indicate that the expression of the Ras-GEF protein encoded by the GPI
4 gene is triggered during the process of activation of lymphoid and myeloid cells. It is noteworthy that activation of macrophages through TLRs and T cell by mitogen stimulation results in NF-
B translocation to the cell nucleus [61
, 62
]. As shown here, the promoter region at 5' upstream from the GPI
4 gene contains three NF-
B binding sites that could be involved with the induction of GPI
4 mRNA expression in activated macrophages and T lymphocytes. It is interesting that a recent study demonstrates that expression of TLR-2 is controlled by the transcription factors NF-
B and Sp-1, and we found three NF-
B and three Sp-1 potential sites in the promoter region of the GPI
4 gene. Thus, it is likely that the Ras-GEF protein encoded by the GPI
4 gene and TLR-2 involved in macrophage activation by GPI-mucins are coregulated by the same transcription factors.
In vivo infection with protozoan parasites results in the induction of various genes, where expression is dependent on nuclear translocation of NF-
B [63
]. In the case of T. cruzi infection, massive polyclonal B and T cell activation as well as production of high levels of proinflammatory cytokines are readily observed during the acute phase of infection [4
]. In fact, a high percentage of lymphocytes and macrophages present in the thymus, lymph nodes, and spleen of these animals expresses cell surface markers associated with the state of activated cells [18
, 64
]. These findings are consistent with the in vivo data showing that expression of GPI
4 mRNA is enhanced in lymphoid organs from mice experimentally infected with T. cruzi. The enhanced expression of GPI
4 mRNA in nonlymphoid peripheric tissues from infected animals, although consistent, was always more subtle than that observed in lymphoid organs. Infection with T. cruzi is systemic, and parasites were found in various organs, including heart, liver, and kidneys [11
, 12
]. The tissue parasitism is always accompanied by an inflammatory process. Whether the enhanced expression of GPI
4 mRNA in the nonlymphoid organs is a result of migration of activated lymphoid/myeloid cells or activation of nonlymphoid cells in infected tissue remains to be investigated.
Finally, this seems to be a first example of a GEF gene, where expression is induced and sustained during the process of macrophage/lymphocyte activation, potentially through the transcription factor NF-
B. It is well-established that mitogen-activated protein kinases (MAPKs) are involved in proliferation of T lymphocytes upon mitogen stimulation [65
, 66
], as well as synthesis of proinflammatory cytokines by macrophages exposed to TLR agonists [17
, 61
]. Although, Ras is an initial step that triggers phosphorylation of some MAPKs, the upstream molecular events controlling the activation of these protein kinases are largely unknown [65
, 66
]. Further, the potential cell nuclei localization of this GEF may indicate an alternative role on leukocyte activation. Thus, the role of Ras-GEF protein encoded by the GPI
4 gene on the initial activation events and functions displayed by the activated macrophages and T lymphocytes deserves to be investigated.
4 sequence, critically reading this manuscript, as well as helpful discussions; and Hélia Cannizzaro (Department of Biochemistry and Immunology, UFMG) for purifying the GPI-mucins. Received August 4, 2002; revised August 24, 2002; accepted August 26, 2002.
|
|
|---|
-primed macrophages J. Immunol. 159,6131-6139[Abstract]This article has been cited by other articles:
![]() |
C. A. Petersen and B. A. Burleigh Role for Interleukin-1{beta} in Trypanosoma cruzi-Induced Cardiomyocyte Hypertrophy Infect. Immun., August 1, 2003; 71(8): 4441 - 4447. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||