PeproTech Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, F.-G.
Right arrow Articles by Pisetsky, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, F.-G.
Right arrow Articles by Pisetsky, D. S.
(Journal of Leukocyte Biology. 2002;72:1154-1163.)
© 2002 by Society for Leukocyte Biology

Inhibition of murine dendritic cell activation by synthetic phosphorothioate oligodeoxynucleotides

Fu-Gang Zhu, Charles F. Reich and David S. Pisetsky

Medical Research Service, Durham Veterans Administration Hospital and Division of Rheumatology, Allergy and Clinical Immunology, Duke University Medical Center, Durham, North Carolina

Correspondence: Dr. David S. Pisetsky, Durham VA Medical Center, 508 Fulton Street, Box 151G, Durham, NC 27705. E-mail: dpiset{at}acpub.duke.edu


arrow
ABSTRACT
 
Depending on sequence and backbone structure, DNA can inhibit as well as stimulate immune responses. As previously shown, single-base phosphorothioate (Ps) oligodeoxynucleotides (ODN) can inhibit murine macrophage activation. To determine whether these compounds can also affect dendritic cells (DC), the effects of 30-mer Ps ODN (SdA, SdT, SdG, and SdC) on DC activation were assessed in an in vitro system. With DC preparations obtained from murine bone marrow cultured in granulocyte macrophage-colony stimulating factor, the Ps ODN blocked the production of interleukin-12 and nitric oxide induced by bacterial DNA, an immunostimulatory cytosine phosphate guanosine dinucleotide (CpG) ODN and lipopolysaccharide (LPS). Furthermore, these compounds inhibited up-regulation of costimulatory molecules CD40 and CD86 as well as major histocompatibility complex-II molecules, indicating an effect on DC maturation. Although the Ps ODN limited uptake of CpG ODN as assessed by flow cytometry, the Ps ODN did not affect LPS uptake, suggesting that these compounds inhibit DC responses by effects on downstream signaling pathways. Together, these observations extend the range of action of inhibitory ODN to DC and suggest a role of these compounds as immunomodulatory agents.

Key Words: DNA • CpG • lipopolysaccharide • IL-12 • nitric oxide


arrow
INTRODUCTION
 
DNA is a complex macromolecule whose immunological properties derive from structural microheterogeneity and encompass stimulation and inhibition [1 2 3 4 5 6 7 ]. As shown using natural and synthetic molecules, immune stimulation by DNA depends on short base sequences, with motifs centered on unmethylated cytosine phosphate guanosine (CpG) dinucleotides effective activators of B cells, monocytes, macrophages, dendritic cells (DC), and natural killer cells [8 ]. As these motifs occur more commonly in bacterial DNA than mammalian DNA, they may provide a signal by which foreign DNA stimulates the innate immune system [9 ]. The immunological activity of DNA also includes inhibition. In in vitro and in vivo studies, DNA from mammalian and viral sources as well as synthetic oligodeoxynucleotides (ODN) can inhibit cytokine production induced by agents such as bacterial DNA [7 , 10 11 12 ]. As in the case of immune stimulation, immune inhibition by DNA results from structural features that include sequence and patterns of base methylation [7 , 11 ].

In previous studies, we investigated the mechanisms by which DNA can inhibit murine macrophage responses, focusing on the actions of synthetic single-base phosphodiester (Po) and phosphorothioate (Ps) ODN [10 , 12 ]. Ps are DNA derivatives in which a sulfur atom replaces one of the nonbridging oxygen atoms in the Po backbone. This modification, which affects nuclease resistance among other properties, enhances the immune activities of ODN in general [13 ]. Using 30-mer Ps ODN, we showed that all four single-base compounds can inhibit the production of interleukin 12 (IL-12) and nitric oxide (NO) induced by bacterial DNA, a CpG-containing ODN and lipopolysaccharide (LPS) [10 , 12 ]. In contrast, among 30-mer Po ODN, only the dG compound had inhibitory activity. The inhibition with Ps ODN was observed even if the ODN was added several hours after the stimulant and, as shown by flow cytometry, did not simply reflect inhibition of DNA or LPS uptake [12 ]. These findings suggest that certain DNA molecules, depending on sequence and backbone structure, can directly inhibit signal transduction pathways induced by foreign macromolecules.

To explore further the action of inhibitory ODN and their possible use as immunomodulatory agents, we have now assessed the effects of single-base Ps ODN on murine DC. DC are a family of bone marrow-derived antigen presenting cells that are widely distributed in lymphoid and nonlymphoid tissues and play a key role in initiating and regulating innate and acquired immunity [14 ]. Because of their central role in immune responses and abundant production of cytokines, DC have been considered as potential targets of therapeutic manipulation with stimulation or inhibition as the goal, depending on the clinical situation.

In the present study, we have investigated the effects of single-base 30-mer Ps ODN on in vitro responses of murine bone marrow-derived DC stimulated with bacterial DNA, a CpG ODN or LPS. As a measure of immune activation, we have assessed IL-12 and NO production, as previous studies have shown that Ps ODN can block macrophage production of these mediators [10 , 12 ]. In results presented herein, we demonstrate that single-base Ps ODN can inhibit DC production of IL-12 and NO in a dose-dependent manner and that blockade of stimulant uptake does not fully account for the inhibition of mediator production. Furthermore, these compounds can limit DC maturation as reflected in cell surface molecule expression. Together, these findings extend the inhibitory potential of Ps ODN to the DC system and suggest the potential use of these compounds as anti-inflammatory or immunosuppressive agents.


arrow
MATERIALS AND METHODS
 
DNA preparation
Synthetic oligonucleotides were purchased from Midland Certified Reagent Company (Midland, TX). The compounds were synthesized using cyanoethyl phosphoramidite chemistry and purified by gel filtration. The inhibitory oligonucleotides were four single-base 30-mer Ps ODN, including SdA, SdC, SdG, and SdT. Our preliminary experiments with over 20 non-CpG Ps ODN of different sequences and chain lengths (6- to 30-mer) revealed that not all Ps ODN have inhibitory effects on DC. We, therefore, focused on studying SdA, SdC, SdG, and SdT as models of the inhibitory effects of Ps ODN on immune cells because of their demonstrated potency [10 , 12 ].

The sequence for a CpG-containing phosphorothioate oligonucleotide (TCCATGACGTTCCTGACGTT, CpG ODN) was taken from the literature [15 ]. In some experiments designed to confirm the results with CpG ODN, another CpG-containing ODN (TCCATGACGTTCCTGATGCT, ODN1668) was used [3 ]. Escherichia coli DNA (EC DNA), purchased from Sigma Chemical Co. (St. Louis, MO), was purified by repeated phenol extractions followed by chloroform/isoamyl alcohol extraction with a final ethanol precipitation step. The air-dried DNA preparations were dissolved at a concentration of 1 mg/ml in distilled water.

Boron dipyrromethene difluoride (BODIPY-Fl)-labeled CpG ODN was prepared with FluoReporter®BODIPY®FL oligonucleotide amine labeling kits (Molecular Probes, Inc., Eugene, OR) following the manufacturer’s instruction. To prepare fluorescently labeled SdG, an oligonucleotide containing an amino terminus was mixed with fluorescein isothiocyanate (FITC; Sigma Chemical Co.) in a ratio of 0.1 mg FITC/10 mg oligonucleotide in carbonate/bicarbonate buffer (pH 9.5). After a 2-h reaction at room temperature, unreacted FITC was removed by gel filtration through a Sephadex G-25 column (NAP10 column, Pharmacia, Piscataway, NJ) followed by ethanol precipitation.

Culture of DC and macrophages from murine bone marrow
DC were generated from the bone marrow of BALB/c mice (The Jackson Laboratory, Bar Harbor, ME) by a modification of a previously reported method [16 ]. Briefly, bone marrow cells were collected from femurs and tibias by repeated flushing of the bone shaft with RPMI-1640 medium (Life Technologies, Grand Island, NY) and were cultured in 75 cm2 cell-culture flasks (Costar Inc., Corning, NY) at a concentration of 1 x 106 cells/ml in DC medium. The DC medium consisted of RPMI-1640 medium supplemented with 20 ng/ml recombinant murine granulocyte macrophage-colony stimulating factor (rmGM-CSF; Peprotec, Inc., Rocky Hill, NJ), 10% fetal calf serum (FCS; HyClone, Logan, UT), and 20 µg/ml gentamicin (Life Technologies). At day 3, bone marrow cells were fed with fresh DC medium containing 20 ng/ml GM-CSF, and at day 6 and 8, the cells were fed with fresh DC medium containing 10 ng/ml GM-CSF. At days 10–12, the nonadherent cells were harvested and used in experiments as DC. At harvest, the purity of DC was evaluated by flow cytometry for murine DC surface markers, CD11c, major histocompatibility complex (MHC)-II, and NLDC145 (see below), and was 80–90%, consistent with that of other investigators [16 , 17 ].

Bone marrow-derived macrophages were generated from BALB/c mice as previously described [18 ]. The conditions for macrophage culture were similar to those for DC culture except that 20% L929-conditioned medium was added as a source of M-CSF [19 ]. Macrophages generated from mouse bone marrow cell culture were harvested between days 5 and 7 and were used for in vitro experiments.

Activation of murine DC and macrophages
Murine DC or macrophages suspended in RPMI-1640 medium containing 10% FCS and 20 µg/ml gentamicin were plated at 5 x 104 cells/well in 96-well cell-culture plates (Costar Inc.). DC or macrophages were pretreated at 37°C for 1 h with 30-mer Ps ODN (SdA, SdC, SdG, and SdT) at various doses as high as 50 µg/ml. The cells were then stimulated with 0.1–1 µg/ml CpG ODN or EC DNA or 1–10 ng/ml LPS (E. coli 0111:B4; Sigma Chemical Co.), and the culture supernatants were collected at 24 h for cytokine and nitrite assays (see below).

To assess possible toxicity of the synthetic ODN, the viability on the DC exposed to different synthetic ODN was measured by AlamarBlueTM (BioSource International, Inc., Camarillo, CA). All the synthetic ODN showed minimal effects on the viability of these cells at the highest dose (50 µg/ml) used in the current study (data not shown).

Cytokine enzyme-linked immunosorbent assays (ELISAs)
IL-12 p40/p70 (designated as IL-12 throughout the text) secretion was measured by ELISA. Briefly, ELISA plates (Immulon II HB, Dynex Technologies, Chantilly, VA) were prepared by coating each well with 100 µl capture antibody (C15.6; PharMingen, San Diego, CA), diluted to 1 µg/ml in phosphate-buffered saline (PBS), pH 8.5. After overnight incubation at 4°C, plates were washed three times with PBS, pH 7.4, using an automated plate washer (Skatron Instruments Inc., Sterling, VA). Culture supernatants (100 µl) diluted in PBS, pH 7.4, containing 0.5% bovine serum albumin (BSA; Sigma Chemical Co.) and 0.5% Tween-20 (Sigma Chemical Co.) were added to each well. Serial dilutions of rmIL-12 (PharMingen) were run in duplicate on each plate as standards.

Samples and standards were allowed to incubate for 2 h at room temperature. After washing the plates, 100 µl diluted, biotinylated detection antibody (C17.8; PharMingen; 1 µg/ml) was added to each well. After 2 h incubation, plates were washed, and 100 µl diluted (1/5000) avidin peroxidase (Zymed, San Francisco, CA) was added to each well. After a 30-min incubation, plates were washed, and 100 µl/well 0.1 M sodium citrate buffer, pH 4.0, containing 0.015% 3,3',5,5'-tetramethylbenzidine hydrochloride (Sigma Chemical Co.) and 0.01% hydrogen peroxide was added. Plates were read at 380 nm with an automated microplate reader (Molecular Devices, Menlo Park, CA), and cytokine concentrations were derived from standard curves.

Nitrite assay
NO production in the culture supernatants was quantified by using the Griess method to measure nitrite (NO2-), a stable breakdown product of NO [20 ]. Briefly, 50 µl culture supernatant was transferred to a well in a 96-well microtiter plate, followed by addition of 100 µl Griess reagent I (1% sulfanilamide in 2.5% phosphoric acid) and 100 µl Griess reagent II (0.1% naphthylenediamine in 2.5% phosphoric acid). The absorbency was read within 10 min at 550 nm on an automated microtiter plate reader, and nitrite concentrations were calculated by comparison with a standard curve generated with sequential dilutions of sodium nitrite.

Flow cytometric analysis of DC surface molecule expression
DC that had been treated with Ps ODN and different stimulants were harvested to evaluate surface molecule expression by flow cytometric analysis. DC were blocked with 10 µg/ml anti-mouse Fc{gamma} III/IIR antibody (clone 2.4G2) on ice for 30 min. For direct labeling, cells were incubated with phycoerythrin-labeled anti-mouse CD11c (clone HL3) or anti-I-Ad (clone AMS-32.1), FITC-labeled anti-mouse CD40 (clone HM40-3) or anti-mouse CD86 (clone GL1), or appropriately labeled isotype controls on ice for 30 min. For indirect labeling, DC were incubated on ice for 30 min with 10% supernatant of hybridoma cell line DEC-205 (American Type Culture Collection, Manassas, VA; HB-290), which produces antibody against mouse DC marker NLDC-145 [rat immunoglobulin G (IgG)2a], followed by incubation with FITC-labeled goat anti-rat IgG (TAGO, Inc., Burlingame, CA) on ice for 30 min. After washing DC three times with cold PBS/2% BSA/0.1% NaN3, expression of the surface molecules was examined by FACScan flow cytometer (Becton Dickinson, Mansfield, MA). The acquisition was performed with 10,000 events per sample, and the list mode data were analyzed using LYSYSTM II software (Becton Dickinson Immunocytometry Systems, San Jose, CA). All the antibodies used in assessment of DC surface markers were purchased from PharMingen.

Flow cytometric analysis of cellular uptake
An assay for the cellular uptake of oligonucleotides, LPS, and other ligands was performed as previously described [21 ]. Briefly, 1 x 106 cells of DC or macrophages in 100 µl culture medium were incubated at 37°C for 1 h with different doses (indicated in individual graphs) of BODIPY Fl-labeled CpG ODN, FITC-labeled SdG, E. coli LPS (Sigma Chemical Co.), FITC-albumin (Sigma Chemical Co.), FITC-E. coli bacteria (Sigma Chemical Co.), or Texas red-labeled dextran (70,000 MW, Molecular Probes) at 37°C for 1 h in RPMI-1640 medium containing 5% FCS. To examine the effects of Ps ODN on CpG ODN or LPS uptake by DC, cells were preincubated with 2–50 µg/ml SdA, SdC, SdG, or SdT 37°C for 1 h, followed by incubation with 1 µg/ml labeled CpG ODN or LPS 37°C for 1 h. Unbound ligands were stripped by incubating cells in 0.2 M acetic acid (pH 2.5) on ice for 10 min, and DC were washed three times with cold PBS/2% BSA/0.1% NaN3. Cells were examined and analyzed as above for DC surface markers by flow cytometry.

Confocal microscopy
To examine the intracellular distribution of CpG ODN, 30-mer Ps ODN, and LPS, DC in an eight-well Lab-Tek chambered coverglass system (Nalge Nunc Intl. Corp., Naperville, IL) were incubated with 1 µg/ml BODIPY-Fl-labeled CpG ODN, FITC-labeled SdG, or FITC-labeled LPS at 37°C for 1 h. To assess endocytosis of the fluorescently labeled ligands, DC were incubated simultaneously with 0.5 mg/ml Texas red-labeled dextran (70 kDa), a marker for fluid-phase endocytosis (pinocytosis) [22 ]. After incubation, the DC were washed three times with cold PBS/2% BSA/0.1% NaN3 and examined for intracellular oligonucleotides, LPS, and dextran under a confocal laser-scanning microscope (Zeiss LSM 510, Carl Zeiss, Oberkochen, Germany).


arrow
RESULTS
 
Effect of Ps ODN on cytokine and NO induction by CpG DNA
Previous studies have shown that DNA or ODN containing CpG motifs (CpG DNA) can stimulate human and murine DC cytokine production [23 , 24 ]. To investigate the effects of the 30-mer Ps ODN on this response, IL-12 levels were measured in supernatants from murine DC cultures pretreated with or without 2–50 µg/ml SdA, SdC, SdG, or SdT for 1 h, followed by stimulation with 0.1 µg/ml CpG ODN or EC DNA for 24 h (Fig. 1 ). In the absence of the inhibitory Ps ODN, CpG ODN and EC DNA induced substantial production of IL-12 from DC, and CpG ODN was a stronger IL-12 inducer than EC DNA (196±43 ng/ml vs. 24±3 ng/ml, mean±SD). In contrast, cultures of DC preincubated with the Ps ODN had markedly reduced production of IL-12 in response to the CpG ODN or EC DNA. This inhibition was dose-dependent, with concentrations of 50 µg/ml Ps ODN almost completely abolishing the IL-12 production by CpG ODN-activated DC.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Dose-dependent inhibition of IL-12 production by Ps ODN. DC were pretreated with medium or indicated concentrations of SdA, SdC, SdG, and SdT for 1 h and then stimulated with 0.1 µg/ml CpG ODN (A) or EC DNA (B) in the presence or absence of the Ps ODN for 24 h. IL-12 levels in the culture supernatants were determined by ELISA. The control group treated with medium alone displayed IL-12 levels of 2 ± 0.2 ng/ml (mean±SD). Each value represents mean of triplicates. Error bars depict the standard deviations. The data represent one of three independent experiments.

To determine the range of responses inhibited by the Ps ODN, we next assessed their effects on NO production by DC stimulated with CpG ODN or EC DNA. DC were pretreated with the Ps ODN for 1 h and then stimulated with CpG ODN or EC DNA at 1 µg/ml; a higher dose of the stimulatory DNA was used in these studies based on previous dose-response experiments for the NO induction in DC (data not shown). After 24 h of cultures, culture supernatants were harvested and assayed for nitrite levels as a measure of NO production. As results in Figure 2 show, Ps ODN markedly inhibited NO production in a dose-dependent manner. These results indicate that Ps ODN can inhibit DC responses other than IL-12 production.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Dose-dependent inhibition of NO production by Ps ODN. DC were pretreated with medium or indicated concentrations of SdA, SdC, SdG, and SdT for 1 h and then stimulated with 1 µg/ml CpG ODN (A) or EC DNA (B) in the presence or absence of the Ps ODN for 24 h. NO levels in the culture supernatants were determined by the Griess reaction assay. Each value represents mean of triplicates. Error bars depict the standard deviations. The data represent one of three independent experiments.

To confirm the inhibitory effects of Ps ODN on CpG ODN-induced DC activation, similar experiments were performed with another CpG-containing ODN-denoted 1668, which has been shown by other investigators to potently stimulate DC as well as macrophages [5 , 23 ]. Like CpG ODN, 1668 is a 20-mer ODN but has a different sequence and contains one "CpG" motif instead of two "CpG" as in CpG ODN. The two ODN, however, had similar stimulatory effects on DC cytokine and NO production. Figure 3 presents results of these experiments using 0.1 µg/ml ODN 1668 to stimulate IL-12 production and 1 µg/ml ODN 1668 for NO production. As these data indicate, DC cell stimulation by ODN 1668 is effectively blocked by pretreatment with the Ps ODN, indicating that the inhibitory ODN can affect activation by a variety of ODN.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 3. Inhibition of IL-12 and NO production induced by CpG-containing ODN 1668. DC were pretreated with medium or 50 µg/ml SdA, SdC, SdG, and SdT for 1 h, followed by stimulation with 0.1 µg/ml ODN 1668 for 24 h before supernatants were collected to measure IL-12 levels (A) or by stimulation with 1 µg/ml ODN 1668 for 24 h before supernatants were collected to measure NO levels (B). Each value represents mean of triplicates. Error bars depict the standard deviations. The data represent one of three independent experiments.

Effect of Ps ODN on cytokine and NO induction by LPS
LPS is a potent stimulant of a wide range of cells, including DC. To examine the effects of Ps ODN on LPS-induced DC activation, DC were pretreated with the Ps ODN, followed by stimulation with 1–10 ng/ml LPS for 24 h. Under these conditions, the four Ps ODN inhibited IL-12 production by DC stimulated with 1 ng/ml LPS (Fig. 4A ), although they had minimal effects on IL-12 induction by 10 ng/ml LPS (data not shown). These Ps ODN, however, blocked NO production by DC stimulated with 10 ng/ml LPS (Fig. 4B) . Thus, although the dose of LPS required for stimulation of IL-12 and NO production differs, the Ps ODN effectively blocked both responses in a pattern similar to that observed for stimulation by the CpG ODN.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Ps ODN inhibition of LPS-induced IL-12 (A) and NO (B) production. DC were pretreated with medium or 50 µg/ml SdA, SdC, SdG, and SdT for 1 h, followed by stimulation with 1 ng/ml LPS for 24 h before supernatants were collected to measure IL-12 levels (A) or by stimulation with 10 ng/ml LPS for 24 h before supernatants were collected to measure NO levels (B). Each value represents mean of triplicates. Error bars depict the standard deviations. The data represent one of three independent experiments.

Effect of Ps ODN on DC maturation
A variety of stimuli, including CpG-containing ODN, bacterial DNA, and LPS, can induce immature DC to differentiate into mature DC, resulting in increased expression of costimulatory molecules CD40 and CD86 as well as MHC-II [25 ]. To assess the effects of the Ps ODN on the up-regulation of these surface molecules, DC were preincubated with 50 µg/ml Ps ODN followed by stimulation with 0.1 µg/ml CpG ODN for 24 h. The DC surface markers were examined by flow cytometry. As shown in Figure 5 , the four Ps ODN blocked the increased expression of CD40, CD86, and MHC-II to varying degrees. The Ps ODN similarly blocked the up-regulation of CD40, CD86, and MHC-II in DC stimulated with 0.1 µg/ml EC DNA or 10 ng/ml LPS (data not shown). These results indicate an effect of the Ps ODN on DC maturation.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. Inhibition of DC maturation by Ps ODN. DC were pretreated with 50 µg/ml SdA, SdC, SdG, or SdT for 1 h, followed by stimulation with 0.1 µg/ml CpG ODN for 24 h. The expression of surface molecules CD40, CD86, and MHC-II was assessed with flow cytometry. The levels of surface moleclular expression were represented as MFI for each group. The data represent one of three independent experiments.

Effect of Ps ODN on DC uptake of DNA and LPS
To explore the mechanisms by which Ps ODN can block DC activation, their effects on stimulant uptake were assessed. Murine bone marrow-derived DC cultured with GM-CSF are mostly immature cells characterized by high levels of endocytosis [16 ]. In the current study, we first examined the uptake capacity of these DC in comparison with that of murine bone marrow-derived macrophages. As shown in Figure 6 , DC and macrophages differed in their ability to take up DNA (CpG ODN and SdG) and LPS, with the difference greater for DNA than for LPS. Nevertheless, the two cell types showed a similar uptake of albumin and dextran (markers of endocytosis) and E. coli bacteria (marker of phagocytosis).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 6. Comparison between murine DC ({blacksquare}) and macrophages (X) uptake. Bone marrow-derived DC and macrophages generated from the same mouse were incubated with different doses (indicated in individual graphs) of fluorescently labeled CpG ODN, SdG, LPS, dead E. coli bacteria, albumin, and dextran, respectively (see Materials and Methods), at 37°C for 1 h. Unbound ligands were stripped with 0.2 M acetic acid, and cells were washed three times and examined for cellular uptake with flow cytometry. The levels of the ligand uptake are represented as MFI for each group. The data represent one of three independent experiments.

Cell binding and/or internalization are necessary for cell activation by CpG DNA and LPS [3 , 26 ], and earlier studies have shown that non-CpG ODN are capable of blocking CpG DNA but not LPS uptake by macrophages [12 , 23 ]. In the current study, we tested whether the Ps ODN can inhibit such processes in DC. For this purpose, we used flow cytometry to determine whether the Ps ODN can affect the cellular uptake of fluorescently labeled CpG ODN and LPS. CpG ODN and LPS binding to DC was distinguished from internalization by performing uptake assays at 4°C and 37°C, respectively. When DC were preincubated with 2, 10, and 50 µg/ml SdA, SdC, SdG, or SdT at 4°C for 1 h followed by incubation with 1 µg/ml fluorescently labeled CpG ODN or LPS at 4°C for another 1 h, there was a dose-dependent inhibition of DC internalization of CpG ODN but not LPS, as shown by the reduction of mean fluorescence intensity (MFI), an indicator of the levels of ligand uptake. For example, 50 µg/ml SdA, SdC, SdG, and SdT at 4°C blocked CpG ODN binding to DC by 46%, 95%, 94%, and 82%, respectively, but had little effect on LPS binding to DC (less than 10% of inhibition for all four Ps ODN). Flow cytometric analysis also revealed that these Ps ODN at 37°C had dose-dependent inhibition of CpG ODN internalization but had little effect on LPS internalization (Fig. 7 ).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. Effect of Ps ODN on uptake of CpG ODN and LPS. DC were pretreated with 2–50 µg/ml SdA, SdC, SdG, or SdT for 1 h, followed by incubation with 1 µg/ml BODIPY Fl-labeled CpG ODN or FITC-labeled LPS at 37°C for another hour. The uptake of CpG ODN (A) and LPS (B) was examined by flow cytometry. The levels of DNA uptake are represented as MFI for each group. The data represent one of three independent experiments.

To investigate whether the differences in the effects of inhibitory ODN on uptake of CpG DNA and LPS related to the pathways for internalization, the role of endocytosis was determined. For this purpose, DC were incubated with 1 µg/ml fluorescently labeled CpG ODN, SdG, or LPS together with 0.5 mg/ml Texas red-labeled dextran at 37°C for 1 h and were examined using a confocal laser-scanning microscope. CpG ODN (Fig. 8 ) and SdG (not shown) were internalized to a comparable extent into DC and were peripherally distributed in the cells, in agreement with previous observations on DNA uptake by macrophages and B lymphocytes [18 , 27 ]. These compounds were mostly colocalized with dextran, a hydrophilic polysaccharide that enters cells through fluid-phase endocytosis (pinocytosis) [22 ]. LPS displayed an intracellular distribution pattern similar to that of ODN in DC (Fig. 8) . These findings suggest that although CpG ODN, LPS, and SdG enter DC primarily through a similar endocytic process, the uptake of CpG ODN but not LPS can be affected by inhibitory ODN.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 8. Representative photographs illustrating intracellular distribution of CpG ODN (upper panel) and LPS (lower panel) in DC. Cells were incubated with 1 µg/ml BODIPY Fl-labeled CpG ODN or FITC-labeled LPS together with 0.5 mg/ml Texas red-labeled dextran at 37°C for 1 h. Internalized CpG ODN or LPS (green-colored) and dextran (red-colored) were examined by confocal laser-scanning microscopy. CpG ODN and LPS are seen colocalized (yellow-colored) with dextran, indicating a fluid phase endocytosis pathway. (Original bar=5 µm.)


arrow
DISCUSSION
 
These findings presented herein extend previous studies on the inhibitory properties of DNA [6 , 7 , 10 11 12 ] and demonstrate that ODN can potently inhibit DC responses. As shown in the current study, single-base Ps ODN can block IL-12 and NO production by DC stimulated with bacterial DNA, a CpG-containing ODN and LPS. In addition to these effects, the Ps ODN reduced the up-regulation of CD40, CD86, and MHC-II expression during DC maturation. Taken together with other studies, these findings indicate that nucleic acids can inhibit as well as stimulate immune responses and could play a role as immunosuppressive agents [10 ].

In these studies, we have focused on ODN as examples of inhibitory DNA. As shown previously, single-base Ps ODN inhibit macrophage activation and can block the production of IL-12 and NO [10 , 12 ]. This inhibition is dependent on the phosphorothioate backbone, as among single-base Po compounds of the same length, only a 30-mer dG ODN had inhibitory activity in the systems tested. The activity of the Ps ODN likely reflects unique properties of the Ps backbone that confers nuclease resistance among other effects and may increase cell uptake and internalization [28 ].

Although all four 30 mer Ps ODN can block cytokine and NO production, not all Ps ODN are inhibitory. In preliminary experiments, we tested the inhibitory activities of over 20 Ps ODN previously shown to be nonstimulatory (F-G. Zhu and D. S. Pisetsky, preliminary observations). Among these compounds, which differed in chain length (6- to 30-mer) and sequence, only some blocked DC IL-12 production by a CpG ODN or EC DNA, and others had little or no inhibitory effect. These findings suggest that DNA can be divided into three types based on their immune activity: stimulatory, inhibitory, and neutral [7 , 10 , 12 , 29 ].

In contrast to the well-defined motifs for immune stimulation by DNA [3 ], the sequence requirements for inhibition are not clear. Other investigators have shown that a CpG motif preceded by a 5' C or followed by a 3' G has inhibitory activity [7 ]. Our studies on Ps ODN show that extended runs of dA, dC, dG, or dT sequence cause inhibition of cytokine and NO production, suggesting that inhibitory sequences are diverse [10 , 12 ]. In addition to sequence, DNA strandedness as well as cytosine methylation can affect the balance between stimulation and inhibition [11 , 30 , 31 ].

Because of the important role on DC in immune responses, we wanted to test the effects of inhibitory ODN on these cells to evaluate their potential for in vivo use. For these studies, we have used DC derived from murine bone marrow cells cultured in the presence of GM-CSF. Our preparations were not further fractionated and as shown by other investigators, likely contain various DC subpopulations that differ in their surface-marker expression and stage of activation [32 ]. Nevertheless, these cells provide a commonly used system to assess the in vitro effects of DNA [23 24 25 ].

In studies from our laboratory, we have found that, compared with macrophages, DC are more sensitive to stimulation by CpG DNA or LPS and in addition, produce much higher levels of IL-12 (F-G. Zhu and D. S. Pisetsky, unpublished data). In view of these findings, for these studies, we used concentrations of stimulants that were 10–100 times lower than those used in previous studies on macrophages [12 ]. It is of interest in this regard that despite their strong response to CpG DNA, DC take up ODN less effectively than macrophages. These observations suggest that DC and macrophages, despite their similar responses to stimulatory and inhibitory DNA, may differ in efficiency or operation of the pathways for cellular activation. Although CpG DNA and LPS elicit similar responses (e.g., IL-12 and NO production), the signaling events triggered by these molecules differ despite the common requirement for internalization. Thus, LPS activates cells through Toll-like receptor 4 (TLR4), and bacterial DNA and CpG ODN activate cells through TLR9 [33 , 34 ].

To characterize mechanisms by which Ps ODN may inhibit DC activity, we tested the effects of these compounds on the uptake of CpG ODN. As shown by flow cytometry, four Ps ODN significantly inhibited CpG ODN uptake. Although the doses for inhibition of uptake and cellular responses may differ, these findings nevertheless raise the possibility that Ps ODN may act in part by preventing uptake of CpG ODN or the access to a specific receptor (e.g., TLR9).

Previous studies by us as well as others, however, suggest that inhibition of DNA uptake may not be the major mechanism of action of inhibitory ODN [12 , 23 ]. Thus, as shown with macrophages, inhibition of CpG ODN uptake by Ps ODN is partial, with doses required for inhibition of uptake much greater than those for inhibition of responses [12 ]. Similarly, in the current study, the doses required for inhibiting DNA uptake were greater than those for blocking IL-12 and NO production. Coupled with the lack of effect of Ps ODN on LPS uptake, these observations suggest that inhibition of stimulant uptake can, at most, partially account for the inhibitory activity of these Ps ODN. Furthermore, with NO production by macrophages, inhibition can occur even if the inhibitor ODN is added hours after stimulation [12 ].

In contrast to the effects of Ps ODN on DNA uptake, these compounds do not affect the uptake of LPS by DC or macrophages as shown previously [12 ]. As the Ps ODN can block DC responses to LPS as well as CpG DNA, these findings suggest that, in addition to any effects on DNA uptake, the inhibitory compounds act on a step that is common to the signaling pathways for CpG DNA and LPS and may be downstream from the TLRs. We cannot exclude, however, the possibility that inhibitory Ps ODN block the interaction of LPS with an internal receptor following internalization.

In considering the action of inhibitory DNA, it is important to note that studies of other investigators indicate that inhibitory DNA, despite its effects on activation by CpG DNA, does not affect the response to LPS [23 , 35 ]. In contrast to these studies, we have shown an effect of inhibitory ODN on responses of macrophages and DCs to LPS. Although we do not know the basis for the differences among studies, they may relate to the sequences of the inhibitory ODN tested. Whereas we have used single-base compounds, other investigators have used mixed-base compounds. These mixed-base compounds have been generally derived from an active ODN in which a CpG sequence has been modified or switched to a GpC sequence. It is possible that the single-base ODN have structural features that allow a broader range of activity.

Although the basis of inhibition of DC activation by Ps ODN requires further investigation, these studies suggest the use of these compounds as immunomodulatory agents to suppress immune response. This use would be comparable with that proposed for immunostimulatory ODN, which has been explored as adjuvant or immune stimulants to activate the innate-immune system in the setting of infection [36 ]. As shown by studies on antisense compounds as well as immunostimulatory ODN, the Ps backbone confers at most limited activity or toxicity other than that resulting from the coding sequence [37 ]. Therefore, it is possible that systemic or local administration of inhibitory Ps ODN could down-regulate immune responses. Studies are in progress to explore this possibility.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by grants from the VA Merit Review, the Arthritis Foundation, and NIH grant AI44808. We thank Dr. Farshid Guilak and Mr. Robert Nelson for their assistance in confocal microscopic study.

Received April 19, 2002; revised August 18, 2002; accepted August 20, 2002.


arrow
REFERENCES
 
    1
  1. Tokunaga, T., Yamamoto, H., Shimada, S., Abe, H., Fukuda, T., Fujisawa, Y., Furutani, Y., Yano, O., Kataoka, T., Sudo, T. (1984) Antitumor activity of deoxyribonucleic acid fraction from Mycobacterium bovis BCG. I. Isolation, physicochemical characterization, and antitumor activity J. Natl. Cancer Inst. 72,955-962
  2. 2
  3. Messina, J. P., Gilkeson, G. S., Pisetsky, D. S. (1991) Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA J. Immunol. 147,1759-1764[Abstract]
  4. 3
  5. Krieg, A. M., Yi, A. K., Matson, S., Waldschmidt, T. J., Bishop, G. A., Teasdale, R., Koretzky, G. A., Klinman, D. M. (1995) CpG motifs in bacterial DNA trigger direct B-cell activation Nature 374,546-549[Medline]
  6. 4
  7. Klinman, D. M., Yi, A. K., Beaucage, S. L., Conover, J., Krieg, A. M. (1996) CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon gamma Proc. Natl. Acad. Sci. USA 93,2879-2883[Abstract/Free Full Text]
  8. 5
  9. Sparwasser, T., Miethke, T., Lipford, G., Borschert, K., Hacker, H., Heeg, K., Wagner, H. (1997) Bacterial DNA causes septic shock Nature 386,336-337[Medline]
  10. 6
  11. Halpern, M. D., Pisetsky, D. S. (1995) In vitro inhibition of murine IFN gamma production by phosphorothioate deoxyguanosine oligomers Immunopharmacology 29,47-52[Medline]
  12. 7
  13. Krieg, A. M., Wu, T., Weeratna, R., Efler, S. M., Love-Homan, L., Yang, L., Yi, A. K., Short, D., Davis, H. L. (1998) Sequence motifs in adenoviral DNA block immune activation by stimulatory CpG motifs Proc. Natl. Acad. Sci. USA 95,12631-12636[Abstract/Free Full Text]
  14. 8
  15. Krieg, A. M., Wagner, H. (2000) Causing a commotion in the blood: immunotherapy progresses from bacteria to bacterial DNA Immunol. Today 21,521-526[Medline]
  16. 9
  17. Pisetsky, D. S. (1997) Immunostimulatory DNA: a clear and present danger? Nat. Med. 3,829-831[Medline]
  18. 10
  19. Pisetsky, D. S., Reich, C. F. (2000) Inhibition of murine macrophage IL-12 production by natural and synthetic DNA Clin. Immunol. 96,198-204[Medline]
  20. 11
  21. Chen, Y., Lenert, P., Weeratna, R., McCluskie, M., Wu, T., Davis, H. L., Krieg, A. M. (2001) Identification of methylated CpG motifs as inhibitors of the immune stimulatory CpG motifs Gene Ther. 8,1024-1032[Medline]
  22. 12
  23. Zhu, F. G., Reich, C. F., Pisetsky, D. S. (2002) Inhibition of murine macrophage nitric oxide production by synthetic oligonucleotides J. Leukoc. Biol. 71,686-694[Abstract/Free Full Text]
  24. 13
  25. Stein, C. A., Subasinghe, C., Shinozuka, K., Cohen, J. S. (1988) Physicochemical properties of phosphorothioate oligodeoxynucleotides Nucleic Acids Res. 16,3209-3221[Abstract/Free Full Text]
  26. 14
  27. Banchereau, J., Steinman, R. M. (1998) Dendritic cells and the control of immunity Nature 392,245-252[Medline]
  28. 15
  29. Chace, J. H., Hooker, N. A., Mildenstein, K. L., Krieg, A. M., Cowdery, J. S. (1997) Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12 Clin. Immunol. Immunopathol. 84,185-193[Medline]
  30. 16
  31. Lutz, M. B., Kukutsch, N., Ogilvie, A. L., Rossner, S., Koch, F., Romani, N., Schuler, G. (1999) An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow J. Immunol. Methods 223,77-92[Medline]
  32. 17
  33. Inaba, K., Inaba, M., Romani, N., Aya, H., Deguchi, M., Ikehara, S., Muramatsu, S., Steinman, R. M. (1992) Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor J. Exp. Med. 176,1693-1702[Abstract/Free Full Text]
  34. 18
  35. Zhu, F. G., Reich, C. F., Pisetsky, D. S. (2001) The role of the macrophage scavenger receptor in immune stimulation by bacterial DNA and synthetic oligonucleotides Immunology 103,226-234[Medline]
  36. 19
  37. Fischer, H. G., Opel, B., Reske, K., Reske-Kunz, A. B. (1988) Granulocyte-macrophage colony-stimulating factor-cultured bone marrow-derived macrophages reveal accessory cell function and synthesis of MHC class II determinants in the absence of external stimuli Eur. J. Immunol. 18,1151-1158[Medline]
  38. 20
  39. Green, L. C., Wagner, D. A., Glogowski, J., Skipper, P. L., Wishnok, J. S., Tannenbaum, S. R. (1982) Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids Anal. Biochem. 126,131-138[Medline]
  40. 21
  41. Zhu, F. G., Pisetsky, D. S. (2001) Role of the heat shock protein 90 in immune response stimulation by bacterial DNA and synthetic oligonucleotides Infect. Immun. 69,5546-5552[Abstract/Free Full Text]
  42. 22
  43. Klein, G., Satre, M. (1986) Kinetics of fluid-phase pinocytosis in Dictyostelium discoideum amoebae Biochem. Biophys. Res. Commun. 138,1146-1152[Medline]
  44. 23
  45. Hacker, H., Mischak, H., Miethke, T., Liptay, S., Schmid, R., Sparwasser, T., Heeg, K., Lipford, G. B., Wagner, H. (1998) CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation EMBO J. 17,6230-6240[Medline]
  46. 24
  47. Hartmann, G., Weiner, G. J., Krieg, A. M. (1999) CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells Proc. Natl. Acad. Sci. USA 96,9305-9310[Abstract/Free Full Text]
  48. 25
  49. Sparwasser, T., Koch, E. S., Vabulas, R. M., Heeg, K., Lipford, G. B., Ellwart, J. W., Wagner, H. (1998) Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells Eur. J. Immunol. 28,2045-2054[Medline]
  50. 26
  51. Tapping, R. I., Gegner, J. A., Kravchenko, V. V., Tobias, P. S. (1998) Roles for LBP and soluble CD14 in cellular uptake of LPS Prog. Clin. Biol. Res. 397,73-78[Medline]
  52. 27
  53. Macfarlane, D. E., Manzel, L. (1998) Antagonism of immunostimulatory CpG-oligodeoxynucleotides by quinacrine, chloroquine, and structurally related compounds J. Immunol. 160,1122-1131[Abstract/Free Full Text]
  54. 28
  55. Zhao, Q., Matson, S., Herrera, C. J., Fisher, E., Yu, H., Krieg, A. M. (1993) Comparison of cellular binding and uptake of antisense phosphodiester, phosphorothioate, and mixed phosphorothioate and methylphosphonate oligonucleotides Antisense Res. Dev. 3,53-66[Medline]
  56. 29
  57. Lenert, P., Stunz, L., Yi, A. K., Krieg, A. M., Ashman, R. F. (2001) CpG stimulation of primary mouse B cells is blocked by inhibitory oligodeoxyribonucleotides at a site proximal to NF-kappaB activation Antisense Nucleic Acid Drug Dev. 11,247-256[Medline]
  58. 30
  59. Pisetsky, D. S., Reich, C. F. (1999) Influence of backbone chemistry on immune activation by synthetic oligonucleotides Biochem. Pharmacol. 58,1981-1988[Medline]
  60. 31
  61. Ishii, K. J., Suzuki, K., Coban, C., Takeshita, F., Itoh, Y., Matoba, H., Kohn, L. D., Klinman, D. M. (2001) Genomic DNA released by dying cells induces the maturation of APCs J. Immunol. 167,2602-2607[Abstract/Free Full Text]
  62. 32
  63. Banchereau, J., Briere, F., Caux, C., Davoust, J., Lebecque, S., Liu, Y. J., Pulendran, B., Palucka, K. (2000) Immunobiology of dendritic cells Annu. Rev. Immunol. 18,767-811[Medline]
  64. 33
  65. Poltorak, A., He, X., Smirnova, I., Liu, M. Y., Huffel, C. V., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M., Ricciardi-Castagnoli, P., Layton, B., Beutler, B. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene Science 282,2085-2088[Abstract/Free Full Text]
  66. 34
  67. Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., Akira, S. (2000) A Toll-like receptor recognizes bacterial DNA Nature 408,740-745[Medline]
  68. 35
  69. Sester, D. P., Naik, S., Beasley, S. J., Hume, D. A., Stacey, K. J. (2000) Phosphorothioate backbone modification modulates macrophage activation by CpG DNA J. Immunol. 165,4165-4173[Abstract/Free Full Text]
  70. 36
  71. Zimmermann, S., Egeter, O., Hausmann, S., Lipford, G. B., Rocken, M., Wagner, H., Heeg, K. (1998) CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis J. Immunol. 160,3627-3630[Abstract/Free Full Text]
  72. 37
  73. Agrawal, S. (1999) Importance of nucleotide sequence and chemical modifications of antisense oligonucleotides Biochim. Biophys. Acta 1489,53-68[Medline]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
D. Klinman, H. Shirota, D. Tross, T. Sato, and S. Klaschik
Synthetic oligonucleotides as modulators of inflammation
J. Leukoc. Biol., October 1, 2008; 84(4): 958 - 964.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Wang, G. Roderiquez, T. Jones, P. McPhie, and M. A. Norcross
Control of In Vitro Immune Responses by Regulatory Oligodeoxynucleotides through Inhibition of pIII Promoter Directed Expression of MHC Class II Transactivator in Human Primary Monocytes
J. Immunol., July 1, 2007; 179(1): 45 - 52.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
F. J. Barrat, T. Meeker, J. Gregorio, J. H. Chan, S. Uematsu, S. Akira, B. Chang, O. Duramad, and R. L. Coffman
Nucleic acids of mammalian origin can act as endogenous ligands for Toll-like receptors and may promote systemic lupus erythematosus
J. Exp. Med., October 17, 2005; 202(8): 1131 - 1139.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L.-Y. Huang, K. J. Ishii, S. Akira, J. Aliberti, and B. Golding
Th1-Like Cytokine Induction by Heat-Killed Brucella abortus Is Dependent on Triggering of TLR9
J. Immunol., September 15, 2005; 175(6): 3964 - 3970.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
O. Duramad, K. L. Fearon, B. Chang, J. H. Chan, J. Gregorio, R. L. Coffman, and F. J. Barrat
Inhibitors of TLR-9 Act on Multiple Cell Subsets in Mouse and Man In Vitro and Prevent Death In Vivo from Systemic Inflammation
J. Immunol., May 1, 2005; 174(9): 5193 - 5200.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Shirota, I. Gursel, M. Gursel, and D. M. Klinman
Suppressive Oligodeoxynucleotides Protect Mice from Lethal Endotoxic Shock
J. Immunol., April 15, 2005; 174(8): 4579 - 4583.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
R. F. Ashman, J. A. Goeken, J. Drahos, and P. Lenert
Sequence requirements for oligodeoxyribonucleotide inhibitory activity
Int. Immunol., April 1, 2005; 17(4): 411 - 420.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Shirota, M. Gursel, and D. M. Klinman
Suppressive Oligodeoxynucleotides Inhibit Th1 Differentiation by Blocking IFN-{gamma}- and IL-12-Mediated Signaling
J. Immunol., October 15, 2004; 173(8): 5002 - 5007.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, F.-G.
Right arrow Articles by Pisetsky, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, F.-G.
Right arrow Articles by Pisetsky, D. S.