Medical Research Service, Durham Veterans Administration Hospital and Division of Rheumatology, Allergy and Clinical Immunology, Duke University Medical Center, Durham, North Carolina
Correspondence: Dr. David S. Pisetsky, Durham VA Medical Center, 508 Fulton Street, Box 151G, Durham, NC 27705. E-mail: dpiset{at}acpub.duke.edu
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: DNA • CpG • lipopolysaccharide • IL-12 • nitric oxide
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In previous studies, we investigated the mechanisms by which DNA can inhibit murine macrophage responses, focusing on the actions of synthetic single-base phosphodiester (Po) and phosphorothioate (Ps) ODN [10 , 12 ]. Ps are DNA derivatives in which a sulfur atom replaces one of the nonbridging oxygen atoms in the Po backbone. This modification, which affects nuclease resistance among other properties, enhances the immune activities of ODN in general [13 ]. Using 30-mer Ps ODN, we showed that all four single-base compounds can inhibit the production of interleukin 12 (IL-12) and nitric oxide (NO) induced by bacterial DNA, a CpG-containing ODN and lipopolysaccharide (LPS) [10 , 12 ]. In contrast, among 30-mer Po ODN, only the dG compound had inhibitory activity. The inhibition with Ps ODN was observed even if the ODN was added several hours after the stimulant and, as shown by flow cytometry, did not simply reflect inhibition of DNA or LPS uptake [12 ]. These findings suggest that certain DNA molecules, depending on sequence and backbone structure, can directly inhibit signal transduction pathways induced by foreign macromolecules.
To explore further the action of inhibitory ODN and their possible use as immunomodulatory agents, we have now assessed the effects of single-base Ps ODN on murine DC. DC are a family of bone marrow-derived antigen presenting cells that are widely distributed in lymphoid and nonlymphoid tissues and play a key role in initiating and regulating innate and acquired immunity [14 ]. Because of their central role in immune responses and abundant production of cytokines, DC have been considered as potential targets of therapeutic manipulation with stimulation or inhibition as the goal, depending on the clinical situation.
In the present study, we have investigated the effects of single-base 30-mer Ps ODN on in vitro responses of murine bone marrow-derived DC stimulated with bacterial DNA, a CpG ODN or LPS. As a measure of immune activation, we have assessed IL-12 and NO production, as previous studies have shown that Ps ODN can block macrophage production of these mediators [10 , 12 ]. In results presented herein, we demonstrate that single-base Ps ODN can inhibit DC production of IL-12 and NO in a dose-dependent manner and that blockade of stimulant uptake does not fully account for the inhibition of mediator production. Furthermore, these compounds can limit DC maturation as reflected in cell surface molecule expression. Together, these findings extend the inhibitory potential of Ps ODN to the DC system and suggest the potential use of these compounds as anti-inflammatory or immunosuppressive agents.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The sequence for a CpG-containing phosphorothioate oligonucleotide (TCCATGACGTTCCTGACGTT, CpG ODN) was taken from the literature [15 ]. In some experiments designed to confirm the results with CpG ODN, another CpG-containing ODN (TCCATGACGTTCCTGATGCT, ODN1668) was used [3 ]. Escherichia coli DNA (EC DNA), purchased from Sigma Chemical Co. (St. Louis, MO), was purified by repeated phenol extractions followed by chloroform/isoamyl alcohol extraction with a final ethanol precipitation step. The air-dried DNA preparations were dissolved at a concentration of 1 mg/ml in distilled water.
Boron dipyrromethene difluoride (BODIPY-Fl)-labeled CpG ODN was prepared with FluoReporter®BODIPY®FL oligonucleotide amine labeling kits (Molecular Probes, Inc., Eugene, OR) following the manufacturer’s instruction. To prepare fluorescently labeled SdG, an oligonucleotide containing an amino terminus was mixed with fluorescein isothiocyanate (FITC; Sigma Chemical Co.) in a ratio of 0.1 mg FITC/10 mg oligonucleotide in carbonate/bicarbonate buffer (pH 9.5). After a 2-h reaction at room temperature, unreacted FITC was removed by gel filtration through a Sephadex G-25 column (NAP10 column, Pharmacia, Piscataway, NJ) followed by ethanol precipitation.
Culture of DC and macrophages from murine bone marrow
DC were generated from the bone marrow of BALB/c mice (The Jackson Laboratory, Bar Harbor, ME) by a modification of a previously reported method [16
]. Briefly, bone marrow cells were collected from femurs and tibias by repeated flushing of the bone shaft with RPMI-1640 medium (Life Technologies, Grand Island, NY) and were cultured in 75 cm2 cell-culture flasks (Costar Inc., Corning, NY) at a concentration of 1 x 106 cells/ml in DC medium. The DC medium consisted of RPMI-1640 medium supplemented with 20 ng/ml recombinant murine granulocyte macrophage-colony stimulating factor (rmGM-CSF; Peprotec, Inc., Rocky Hill, NJ), 10% fetal calf serum (FCS; HyClone, Logan, UT), and 20 µg/ml gentamicin (Life Technologies). At day 3, bone marrow cells were fed with fresh DC medium containing 20 ng/ml GM-CSF, and at day 6 and 8, the cells were fed with fresh DC medium containing 10 ng/ml GM-CSF. At days 10–12, the nonadherent cells were harvested and used in experiments as DC. At harvest, the purity of DC was evaluated by flow cytometry for murine DC surface markers, CD11c, major histocompatibility complex (MHC)-II, and NLDC145 (see below), and was 80–90%, consistent with that of other investigators [16
, 17
].
Bone marrow-derived macrophages were generated from BALB/c mice as previously described [18 ]. The conditions for macrophage culture were similar to those for DC culture except that 20% L929-conditioned medium was added as a source of M-CSF [19 ]. Macrophages generated from mouse bone marrow cell culture were harvested between days 5 and 7 and were used for in vitro experiments.
Activation of murine DC and macrophages
Murine DC or macrophages suspended in RPMI-1640 medium containing 10% FCS and 20 µg/ml gentamicin were plated at 5 x 104 cells/well in 96-well cell-culture plates (Costar Inc.). DC or macrophages were pretreated at 37°C for 1 h with 30-mer Ps ODN (SdA, SdC, SdG, and SdT) at various doses as high as 50 µg/ml. The cells were then stimulated with 0.1–1 µg/ml CpG ODN or EC DNA or 1–10 ng/ml LPS (E. coli 0111:B4; Sigma Chemical Co.), and the culture supernatants were collected at 24 h for cytokine and nitrite assays (see below).
To assess possible toxicity of the synthetic ODN, the viability on the DC exposed to different synthetic ODN was measured by AlamarBlueTM (BioSource International, Inc., Camarillo, CA). All the synthetic ODN showed minimal effects on the viability of these cells at the highest dose (50 µg/ml) used in the current study (data not shown).
Cytokine enzyme-linked immunosorbent assays (ELISAs)
IL-12 p40/p70 (designated as IL-12 throughout the text) secretion was measured by ELISA. Briefly, ELISA plates (Immulon II HB, Dynex Technologies, Chantilly, VA) were prepared by coating each well with 100 µl capture antibody (C15.6; PharMingen, San Diego, CA), diluted to 1 µg/ml in phosphate-buffered saline (PBS), pH 8.5. After overnight incubation at 4°C, plates were washed three times with PBS, pH 7.4, using an automated plate washer (Skatron Instruments Inc., Sterling, VA). Culture supernatants (100 µl) diluted in PBS, pH 7.4, containing 0.5% bovine serum albumin (BSA; Sigma Chemical Co.) and 0.5% Tween-20 (Sigma Chemical Co.) were added to each well. Serial dilutions of rmIL-12 (PharMingen) were run in duplicate on each plate as standards.
Samples and standards were allowed to incubate for 2 h at room temperature. After washing the plates, 100 µl diluted, biotinylated detection antibody (C17.8; PharMingen; 1 µg/ml) was added to each well. After 2 h incubation, plates were washed, and 100 µl diluted (1/5000) avidin peroxidase (Zymed, San Francisco, CA) was added to each well. After a 30-min incubation, plates were washed, and 100 µl/well 0.1 M sodium citrate buffer, pH 4.0, containing 0.015% 3,3',5,5'-tetramethylbenzidine hydrochloride (Sigma Chemical Co.) and 0.01% hydrogen peroxide was added. Plates were read at 380 nm with an automated microplate reader (Molecular Devices, Menlo Park, CA), and cytokine concentrations were derived from standard curves.
Nitrite assay
NO production in the culture supernatants was quantified by using the Griess method to measure nitrite (NO2-), a stable breakdown product of NO [20
]. Briefly, 50 µl culture supernatant was transferred to a well in a 96-well microtiter plate, followed by addition of 100 µl Griess reagent I (1% sulfanilamide in 2.5% phosphoric acid) and 100 µl Griess reagent II (0.1% naphthylenediamine in 2.5% phosphoric acid). The absorbency was read within 10 min at 550 nm on an automated microtiter plate reader, and nitrite concentrations were calculated by comparison with a standard curve generated with sequential dilutions of sodium nitrite.
Flow cytometric analysis of DC surface molecule expression
DC that had been treated with Ps ODN and different stimulants were harvested to evaluate surface molecule expression by flow cytometric analysis. DC were blocked with 10 µg/ml anti-mouse Fc
III/IIR antibody (clone 2.4G2) on ice for 30 min. For direct labeling, cells were incubated with phycoerythrin-labeled anti-mouse CD11c (clone HL3) or anti-I-Ad (clone AMS-32.1), FITC-labeled anti-mouse CD40 (clone HM40-3) or anti-mouse CD86 (clone GL1), or appropriately labeled isotype controls on ice for 30 min. For indirect labeling, DC were incubated on ice for 30 min with 10% supernatant of hybridoma cell line DEC-205 (American Type Culture Collection, Manassas, VA; HB-290), which produces antibody against mouse DC marker NLDC-145 [rat immunoglobulin G (IgG)2a], followed by incubation with FITC-labeled goat anti-rat IgG (TAGO, Inc., Burlingame, CA) on ice for 30 min. After washing DC three times with cold PBS/2% BSA/0.1% NaN3, expression of the surface molecules was examined by FACScan flow cytometer (Becton Dickinson, Mansfield, MA). The acquisition was performed with 10,000 events per sample, and the list mode data were analyzed using LYSYSTM II software (Becton Dickinson Immunocytometry Systems, San Jose, CA). All the antibodies used in assessment of DC surface markers were purchased from PharMingen.
Flow cytometric analysis of cellular uptake
An assay for the cellular uptake of oligonucleotides, LPS, and other ligands was performed as previously described [21
]. Briefly, 1 x 106 cells of DC or macrophages in 100 µl culture medium were incubated at 37°C for 1 h with different doses (indicated in individual graphs) of BODIPY Fl-labeled CpG ODN, FITC-labeled SdG, E. coli LPS (Sigma Chemical Co.), FITC-albumin (Sigma Chemical Co.), FITC-E. coli bacteria (Sigma Chemical Co.), or Texas red-labeled dextran (70,000 MW, Molecular Probes) at 37°C for 1 h in RPMI-1640 medium containing 5% FCS. To examine the effects of Ps ODN on CpG ODN or LPS uptake by DC, cells were preincubated with 2–50 µg/ml SdA, SdC, SdG, or SdT 37°C for 1 h, followed by incubation with 1 µg/ml labeled CpG ODN or LPS 37°C for 1 h. Unbound ligands were stripped by incubating cells in 0.2 M acetic acid (pH 2.5) on ice for 10 min, and DC were washed three times with cold PBS/2% BSA/0.1% NaN3. Cells were examined and analyzed as above for DC surface markers by flow cytometry.
Confocal microscopy
To examine the intracellular distribution of CpG ODN, 30-mer Ps ODN, and LPS, DC in an eight-well Lab-Tek chambered coverglass system (Nalge Nunc Intl. Corp., Naperville, IL) were incubated with 1 µg/ml BODIPY-Fl-labeled CpG ODN, FITC-labeled SdG, or FITC-labeled LPS at 37°C for 1 h. To assess endocytosis of the fluorescently labeled ligands, DC were incubated simultaneously with 0.5 mg/ml Texas red-labeled dextran (70 kDa), a marker for fluid-phase endocytosis (pinocytosis) [22
]. After incubation, the DC were washed three times with cold PBS/2% BSA/0.1% NaN3 and examined for intracellular oligonucleotides, LPS, and dextran under a confocal laser-scanning microscope (Zeiss LSM 510, Carl Zeiss, Oberkochen, Germany).
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
 View larger version (19K): [in a new window] |
Figure 1. Dose-dependent inhibition of IL-12 production by Ps ODN. DC were pretreated with medium or indicated concentrations of SdA, SdC, SdG, and SdT for 1 h and then stimulated with 0.1 µg/ml CpG ODN (A) or EC DNA (B) in the presence or absence of the Ps ODN for 24 h. IL-12 levels in the culture supernatants were determined by ELISA. The control group treated with medium alone displayed IL-12 levels of 2 ± 0.2 ng/ml (mean±SD). Each value represents mean of triplicates. Error bars depict the standard deviations. The data represent one of three independent experiments.
|
 View larger version (20K): [in a new window] |
Figure 2. Dose-dependent inhibition of NO production by Ps ODN. DC were pretreated with medium or indicated concentrations of SdA, SdC, SdG, and SdT for 1 h and then stimulated with 1 µg/ml CpG ODN (A) or EC DNA (B) in the presence or absence of the Ps ODN for 24 h. NO levels in the culture supernatants were determined by the Griess reaction assay. Each value represents mean of triplicates. Error bars depict the standard deviations. The data represent one of three independent experiments.
|
 View larger version (16K): [in a new window] |
Figure 3. Inhibition of IL-12 and NO production induced by CpG-containing ODN 1668. DC were pretreated with medium or 50 µg/ml SdA, SdC, SdG, and SdT for 1 h, followed by stimulation with 0.1 µg/ml ODN 1668 for 24 h before supernatants were collected to measure IL-12 levels (A) or by stimulation with 1 µg/ml ODN 1668 for 24 h before supernatants were collected to measure NO levels (B). Each value represents mean of triplicates. Error bars depict the standard deviations. The data represent one of three independent experiments.
|
 View larger version (18K): [in a new window] |
Figure 4. Ps ODN inhibition of LPS-induced IL-12 (A) and NO (B) production. DC were pretreated with medium or 50 µg/ml SdA, SdC, SdG, and SdT for 1 h, followed by stimulation with 1 ng/ml LPS for 24 h before supernatants were collected to measure IL-12 levels (A) or by stimulation with 10 ng/ml LPS for 24 h before supernatants were collected to measure NO levels (B). Each value represents mean of triplicates. Error bars depict the standard deviations. The data represent one of three independent experiments.
|
 View larger version (17K): [in a new window] |
Figure 5. Inhibition of DC maturation by Ps ODN. DC were pretreated with 50 µg/ml SdA, SdC, SdG, or SdT for 1 h, followed by stimulation with 0.1 µg/ml CpG ODN for 24 h. The expression of surface molecules CD40, CD86, and MHC-II was assessed with flow cytometry. The levels of surface moleclular expression were represented as MFI for each group. The data represent one of three independent experiments.
|
 View larger version (20K): [in a new window] |
Figure 6. Comparison between murine DC ( ) and macrophages (X) uptake. Bone marrow-derived DC and macrophages generated from the same mouse were incubated with different doses (indicated in individual graphs) of fluorescently labeled CpG ODN, SdG, LPS, dead E. coli bacteria, albumin, and dextran, respectively (see Materials and Methods), at 37°C for 1 h. Unbound ligands were stripped with 0.2 M acetic acid, and cells were washed three times and examined for cellular uptake with flow cytometry. The levels of the ligand uptake are represented as MFI for each group. The data represent one of three independent experiments.
|
 View larger version (19K): [in a new window] |
Figure 7. Effect of Ps ODN on uptake of CpG ODN and LPS. DC were pretreated with 2–50 µg/ml SdA, SdC, SdG, or SdT for 1 h, followed by incubation with 1 µg/ml BODIPY Fl-labeled CpG ODN or FITC-labeled LPS at 37°C for another hour. The uptake of CpG ODN (A) and LPS (B) was examined by flow cytometry. The levels of DNA uptake are represented as MFI for each group. The data represent one of three independent experiments.
|
 View larger version (26K): [in a new window] |
Figure 8. Representative photographs illustrating intracellular distribution of CpG ODN (upper panel) and LPS (lower panel) in DC. Cells were incubated with 1 µg/ml BODIPY Fl-labeled CpG ODN or FITC-labeled LPS together with 0.5 mg/ml Texas red-labeled dextran at 37°C for 1 h. Internalized CpG ODN or LPS (green-colored) and dextran (red-colored) were examined by confocal laser-scanning microscopy. CpG ODN and LPS are seen colocalized (yellow-colored) with dextran, indicating a fluid phase endocytosis pathway. (Original bar=5 µm.)
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In these studies, we have focused on ODN as examples of inhibitory DNA. As shown previously, single-base Ps ODN inhibit macrophage activation and can block the production of IL-12 and NO [10 , 12 ]. This inhibition is dependent on the phosphorothioate backbone, as among single-base Po compounds of the same length, only a 30-mer dG ODN had inhibitory activity in the systems tested. The activity of the Ps ODN likely reflects unique properties of the Ps backbone that confers nuclease resistance among other effects and may increase cell uptake and internalization [28 ].
Although all four 30 mer Ps ODN can block cytokine and NO production, not all Ps ODN are inhibitory. In preliminary experiments, we tested the inhibitory activities of over 20 Ps ODN previously shown to be nonstimulatory (F-G. Zhu and D. S. Pisetsky, preliminary observations). Among these compounds, which differed in chain length (6- to 30-mer) and sequence, only some blocked DC IL-12 production by a CpG ODN or EC DNA, and others had little or no inhibitory effect. These findings suggest that DNA can be divided into three types based on their immune activity: stimulatory, inhibitory, and neutral [7 , 10 , 12 , 29 ].
In contrast to the well-defined motifs for immune stimulation by DNA [3 ], the sequence requirements for inhibition are not clear. Other investigators have shown that a CpG motif preceded by a 5' C or followed by a 3' G has inhibitory activity [7 ]. Our studies on Ps ODN show that extended runs of dA, dC, dG, or dT sequence cause inhibition of cytokine and NO production, suggesting that inhibitory sequences are diverse [10 , 12 ]. In addition to sequence, DNA strandedness as well as cytosine methylation can affect the balance between stimulation and inhibition [11 , 30 , 31 ].
Because of the important role on DC in immune responses, we wanted to test the effects of inhibitory ODN on these cells to evaluate their potential for in vivo use. For these studies, we have used DC derived from murine bone marrow cells cultured in the presence of GM-CSF. Our preparations were not further fractionated and as shown by other investigators, likely contain various DC subpopulations that differ in their surface-marker expression and stage of activation [32 ]. Nevertheless, these cells provide a commonly used system to assess the in vitro effects of DNA [23 24 25 ].
In studies from our laboratory, we have found that, compared with macrophages, DC are more sensitive to stimulation by CpG DNA or LPS and in addition, produce much higher levels of IL-12 (F-G. Zhu and D. S. Pisetsky, unpublished data). In view of these findings, for these studies, we used concentrations of stimulants that were 10–100 times lower than those used in previous studies on macrophages [12 ]. It is of interest in this regard that despite their strong response to CpG DNA, DC take up ODN less effectively than macrophages. These observations suggest that DC and macrophages, despite their similar responses to stimulatory and inhibitory DNA, may differ in efficiency or operation of the pathways for cellular activation. Although CpG DNA and LPS elicit similar responses (e.g., IL-12 and NO production), the signaling events triggered by these molecules differ despite the common requirement for internalization. Thus, LPS activates cells through Toll-like receptor 4 (TLR4), and bacterial DNA and CpG ODN activate cells through TLR9 [33 , 34 ].
To characterize mechanisms by which Ps ODN may inhibit DC activity, we tested the effects of these compounds on the uptake of CpG ODN. As shown by flow cytometry, four Ps ODN significantly inhibited CpG ODN uptake. Although the doses for inhibition of uptake and cellular responses may differ, these findings nevertheless raise the possibility that Ps ODN may act in part by preventing uptake of CpG ODN or the access to a specific receptor (e.g., TLR9).
Previous studies by us as well as others, however, suggest that inhibition of DNA uptake may not be the major mechanism of action of inhibitory ODN [12 , 23 ]. Thus, as shown with macrophages, inhibition of CpG ODN uptake by Ps ODN is partial, with doses required for inhibition of uptake much greater than those for inhibition of responses [12 ]. Similarly, in the current study, the doses required for inhibiting DNA uptake were greater than those for blocking IL-12 and NO production. Coupled with the lack of effect of Ps ODN on LPS uptake, these observations suggest that inhibition of stimulant uptake can, at most, partially account for the inhibitory activity of these Ps ODN. Furthermore, with NO production by macrophages, inhibition can occur even if the inhibitor ODN is added hours after stimulation [12 ].
In contrast to the effects of Ps ODN on DNA uptake, these compounds do not affect the uptake of LPS by DC or macrophages as shown previously [12 ]. As the Ps ODN can block DC responses to LPS as well as CpG DNA, these findings suggest that, in addition to any effects on DNA uptake, the inhibitory compounds act on a step that is common to the signaling pathways for CpG DNA and LPS and may be downstream from the TLRs. We cannot exclude, however, the possibility that inhibitory Ps ODN block the interaction of LPS with an internal receptor following internalization.
In considering the action of inhibitory DNA, it is important to note that studies of other investigators indicate that inhibitory DNA, despite its effects on activation by CpG DNA, does not affect the response to LPS [23 , 35 ]. In contrast to these studies, we have shown an effect of inhibitory ODN on responses of macrophages and DCs to LPS. Although we do not know the basis for the differences among studies, they may relate to the sequences of the inhibitory ODN tested. Whereas we have used single-base compounds, other investigators have used mixed-base compounds. These mixed-base compounds have been generally derived from an active ODN in which a CpG sequence has been modified or switched to a GpC sequence. It is possible that the single-base ODN have structural features that allow a broader range of activity.
Although the basis of inhibition of DC activation by Ps ODN requires further investigation, these studies suggest the use of these compounds as immunomodulatory agents to suppress immune response. This use would be comparable with that proposed for immunostimulatory ODN, which has been explored as adjuvant or immune stimulants to activate the innate-immune system in the setting of infection [36 ]. As shown by studies on antisense compounds as well as immunostimulatory ODN, the Ps backbone confers at most limited activity or toxicity other than that resulting from the coding sequence [37 ]. Therefore, it is possible that systemic or local administration of inhibitory Ps ODN could down-regulate immune responses. Studies are in progress to explore this possibility.
Received April 19, 2002; revised August 18, 2002; accepted August 20, 2002.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
 |
|
 |
|
  D. Klinman, H. Shirota, D. Tross, T. Sato, and S. Klaschik Synthetic oligonucleotides as modulators of inflammation J. Leukoc. Biol., October 1, 2008; 84(4): 958 - 964. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, G. Roderiquez, T. Jones, P. McPhie, and M. A. Norcross Control of In Vitro Immune Responses by Regulatory Oligodeoxynucleotides through Inhibition of pIII Promoter Directed Expression of MHC Class II Transactivator in Human Primary Monocytes J. Immunol., July 1, 2007; 179(1): 45 - 52. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. J. Barrat, T. Meeker, J. Gregorio, J. H. Chan, S. Uematsu, S. Akira, B. Chang, O. Duramad, and R. L. Coffman Nucleic acids of mammalian origin can act as endogenous ligands for Toll-like receptors and may promote systemic lupus erythematosus J. Exp. Med., October 17, 2005; 202(8): 1131 - 1139. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L.-Y. Huang, K. J. Ishii, S. Akira, J. Aliberti, and B. Golding Th1-Like Cytokine Induction by Heat-Killed Brucella abortus Is Dependent on Triggering of TLR9 J. Immunol., September 15, 2005; 175(6): 3964 - 3970. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Duramad, K. L. Fearon, B. Chang, J. H. Chan, J. Gregorio, R. L. Coffman, and F. J. Barrat Inhibitors of TLR-9 Act on Multiple Cell Subsets in Mouse and Man In Vitro and Prevent Death In Vivo from Systemic Inflammation J. Immunol., May 1, 2005; 174(9): 5193 - 5200. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Shirota, I. Gursel, M. Gursel, and D. M. Klinman Suppressive Oligodeoxynucleotides Protect Mice from Lethal Endotoxic Shock J. Immunol., April 15, 2005; 174(8): 4579 - 4583. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. F. Ashman, J. A. Goeken, J. Drahos, and P. Lenert Sequence requirements for oligodeoxyribonucleotide inhibitory activity Int. Immunol., April 1, 2005; 17(4): 411 - 420. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Shirota, M. Gursel, and D. M. Klinman Suppressive Oligodeoxynucleotides Inhibit Th1 Differentiation by Blocking IFN-{gamma}- and IL-12-Mediated Signaling J. Immunol., October 15, 2004; 173(8): 5002 - 5007. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
