PeproTech Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taylor, L.
Right arrow Articles by Schwarz, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, L.
Right arrow Articles by Schwarz, H.
(Journal of Leukocyte Biology. 2002;72:522-529.)
© 2002 by Society for Leukocyte Biology

In vitro and in vivo activities of OX40 (CD134)-IgG fusion protein isoforms with different levels of immune-effector functions

Liz Taylor*, Marcus Bachler{dagger}, Imogen Duncan*, Simon Keen*, Rosie Fallon*, Catherine Mair*, Thomas T. McDonald{dagger} and Herbert Schwarz*

* Xenova Group plc, Cambridge, United Kingdom; and
{dagger} Division of Infection, Inflammation and Repair, University of Southampton, United Kingdom

Correspondence: Herbert Schwarz, Xenova Group, 310 Cambridge Science Park, Cambridge CB4 OWG, UK. E-mail: herbert_schwarz{at}xenova.co.uk


arrow
ABSTRACT
 
Recombinant fusion proteins consisting of the extracellular domain of immunoregulatory proteins and the constant domain of immunoglobulin G (IgG) are a novel class of human therapeutics. IgG isoforms exert different levels of immune effector functions, such as complement lysis and antibody-dependent cell cytotoxicity (ADCC). Several OX40-Ig fusion proteins were generated and compared in their potency to inhibit immune reactions. OX40-IgG fusion proteins act as decoys and inhibit T cell costimulation and extravasation induced by OX40 ligand-expressing antigen-presenting cells (APC) and vascular endothelial cells, respectively. In addition, OX40-IgG1 protein induces ADCC and complement lysis in OX40 ligand-expressing cells. Replacement of the IgG1 by the IgG4 domain (OX40-IgG4) eliminated complement lysis and reduced ADCC by half. Mutation of Leu235 to Glu in IgG4 eliminated the remaining ADCC activity and generated a protein devoid of immune effector functions (OX40-IgG4mut). In vitro, OX40-IgG1 was more potent in inhibiting proliferation and cytokine release by peripheral blood mononuclear cells than OX40-IgG4mut, as OX40-IgG1 induced cell death in APC. However, both proteins reduced T cell-mediated colitis in mice to the same extent, indicating that in vivo neutralization of OX40L is sufficient. This study also demonstrates that effector functions of antibodies are retained and can be rationally designed in receptor-IgG fusion proteins.

Key Words: ADCC • complement lysis • colitis


arrow
INTRODUCTION
 
Recombinant forms of immunoregulatory receptors are being increasingly used in the therapy of immune-mediated diseases [1 ]. Frequently, the extracellular domains of these receptors are fused to the constant domain of immunoglobulin G (IgG; Fc) to achieve enhanced serum half-life. A prominent example is Enbrel, a fusion protein of the extracellular domain of the p75 tumor necrosis factor receptor (TNFR) with IgG1 [2 ]. Enbrel neutralizes the activity of TNF and has shown remarkable, therapeutic efficacy in rheumatoid arthritis [3 ].

A crucial component of these fusion proteins is the class of the IgG domain. The Fc domain of IgG1, the most commonly used Fc domain in fusion proteins, exerts immune effector function, such as complement lysis and antibody-dependent cell cytotoxicity (ADCC). Although these activities can be important for the function of some of the fusion proteins, they may also lead to undesired side-effects in cases where the ligand is expressed on other cells and tissues.

OX40 is a costimulatory molecule of the TNFR family and is expressed selectively on activated T lymphocytes [4 ]. T cells receive activating and survival signals through OX40 [5 ]. Expression of OX40 ligand is activation-dependent and is found on antigen-presenting cells (APC). Further, OX40 ligand is expressed by activated vascular endothelial cells at sites of inflammation and plays a role in extravasation of OX40-positive T cells [6 7 8 9 ]. Therefore, soluble OX40 decoys can inhibit immune responses by blocking T cell costimulation and by preventing T cell extravasation into inflamed tissue [4 , 10 ].

An OX40-IgG1 fusion protein can inhibit murine splenocyte proliferation and cytokine production in vitro [11 ]. Further, it can successfully ameliorate trinitrobenzene sulfonic acid (TNBS)-induced colitis and spontaneous colitis in interleukin (IL)-2-deficient mice, as well as experimental autoimmune encephalomyelitis (EAE) [11 , 12 ].

Here, we describe the construction of further OX40-IgG fusion proteins with different levels of immune-effector functions. The role of these effector functions and the role of neutralizing OX40 ligand for OX40-IgG-mediated immune inhibition are investigated by in vitro and in vivo experiments.


arrow
MATERIALS AND METHODS
 
Reagents
The hOX40L-hIgG1 fusion protein was expressed and purified as described previously with a few modifications [11 , 13 ]. Briefly, the cDNA encoding the extracellular domain of human OX40L was fused to the 3' end of the cDNA encoding the constant domain of human IgG1 (hinge region, CH2 and CH3) and was inserted into the mammalian expression vector pEE14 (Lonza Biologics, Slough, UK). The hOX40L-hIgG1 fusion protein was expressed in Chinese hamster ovary (CHO) cells and purified by protein A sepharose.

Cells and cell culture
OX40-expressing 556 and OX40L-expressing 5L cells were a gift from Dr. W. Godfrey (University of Minnesota, Minneapolis). They are derived from the murine myeloma line SP-2, which was transfected and selected to stably express human OX40 or OX40L, respectively.

U937 cells were obtained from ECACC (Salisbury, UK) and were grown in RPMI 1640 with glutamine, penicillin (50 iu/ml)/streptomycin (50 µg/ml), and 10% Bioclear fetal bovine serum (FBS; Invitrogen Life Technologies, Inchinan, UK).

Human peripheral blood mononuclear cells (PBMC) were isolated from whole blood of healthy volunteers. Blood (50 ml) was added to 8 ml citrate-phosphate-dextrose solution, made up to 100 ml with phosphate-buffered saline (PBS) and layered onto three tubes with 17 ml lymphocyte separation medium (ICN, Basingstoke, UK). After centrifugation at 900 g for 30 min, the cells from the boundary of each tube were collected and resuspended in 50 ml PBS and spun at 900 g for 10 min. All cells from the three tubes were pooled, washed in 10 ml RPMI 10% fetal calf serum (FCS), and finally resuspended in 25 ml RPMI 10% FCS.

Cloning of the IgG4 domain
The Fc domain of human IgG4 was cloned by reverse transcriptase-polymerase chain reaction (RT-PCR) using cDNA of PBMC as template. The upstream primer (SWK92: 5' GATCGGATCCCGAGTCCAAATATGGTCCC) was designed to anneal to the 5' of the IgG4 hinge region and to incorporate a 5' BamHI site to allow fusion to the cDNA encoding the extracellular domain of OX40. The downstream primer (SWK93: 3' CTAGTCTAGATCATTATTTACCCAGAGACAGGGAG) was designed to anneal to the 3' of the IgG4 CH3 domain and incorporates two 3' stop codons followed by a XbaI restriction enzyme site. The OX40-IgG4 cDNA was inserted into plasmid pOX8 and was transfected into CHO cells. The secreted OX40-IgG4 fusion protein was purified via protein A sepharose.

Site-directed mutagenesis
The mutation of Leu235 to Glu in hIgG4 was achieved through site-directed mutagenesis using the Transformer Site Directed Mutagenesis kit (Clontech Laboratories, Basingstoke, UK). The oligonucleotide primer SWK115 (5': CCAGCACCTGAGTTCGAAGGGGGACCATCAGTC) was designed to replace Leu235 by a Glu. This primer was used alongside the oligonucleotide JCF35 (5': ATGACTTGGTTGAATACTCACCAGTCA), which served as a selection primer by destroying an essential ScaI site within the plasmid vector. Oligonucleotides were first phosphorylated, and using wild-type hIgG4 cDNA as template, mutagenesis was performed per the manufacturer’s protocol. The introduction of the mutation was verified by sequencing.

Expression of OX40-IgG fusion protein
The OX40-IgG1 fusion protein was expressed and purified as described previously with a few modifications [11 , 13 ]. Briefly, the cDNA encoding the extracellular domain of human OX40 from amino acid 1 to 208 was fused to the 5' end of the cDNA encoding the constant domain of human IgG1 (hinge region, CH2 and CH3) and inserted into the mammalian expression vector pEE14 (Lonza Biologics). The OX40-IgG1fusion protein was expressed in CHO cells and purified by protein A sepharose. The OX40-IgG4 and OX40-IgG4mut proteins were expressed and purified accordingly.

Fc receptor binding studies
U937 cells were stimulated overnight with 625 pg/ml human interferon-{gamma} (IFN-{gamma}; NBS Biologicals 22217, Huntingdon) for maximum Fc receptor expression. Cells were resuspended in fluorescein-activated cell sorter (FACS) buffer [PBS, 2% heat-inactivated Bioclear FBS (Invitrogen Life Technologies), 0.02% sodium azide] and were incubated with OX40-hIgG protein in serial 1:1 dilutions ranging from 100 µg/ml to approximately 0.1 µg/ml for 1 h on ice in a volume of 50 µl. Cells were then washed twice in 2 ml FACS buffer. Binding of the OX40-IgG fusion proteins was detected by an incubation (40 min on ice) with 20 µl 40 µg/ml biotinylated anti-OX40 antibody (clone L106, DAKO, Ely, UK) or an isotype-control antibody (biotinylated mIgG1, BD Pharmingen, Oxford). Cells were washed again and stained with 20 µl 5 µg/ml phycoerythrin (PE)-streptavidin (BD Pharmingen) for 40 min on ice. The cells were washed and resuspended at 1 x 106/ml and analyzed using a FACScan and LysisII software (Becton Dickinson, Mountain View, CA).

Complement-mediated cell lysis
Cells (106 5L and 565) were labeled with 4.6 MBq 51chromium sulfate (Amersham, Little Chalfont, UK) for 60–90 min and were then incubated with 2 µg/ml fusion proteins (200 µl per 5x105 cells) in cold PBS for 30 min at 4°C. After washing once in GVB++ buffer (150 mM NaCl, 5 mM sodium 5,5' diethyl barbiturate, 6.5% gelatin, 40 mM MgCl2, 60 µM CaCl2, pH 7.35), the cells were resuspended at 2 x 105/ml. One-hundred microliters was added to each well already containing 100 µl guinea pig complement serum (Sigma Chemical Co., Poole, UK) at a dilution of 1:100. After 2 h at 37°C, 25 µl supernatants from each well were added to 150 µl Opti-Phase supermix (Wallac, Milton Keynes, UK) in a flexible counter plate for evaluation in a MicroBetaPlus ß-counter. Spontaneous lysis was determined from 5L and 565 cells, which were incubated without the fusion proteins or PBMC, and maximal lysis was determined by the addition of 5% Triton X-100.

Antibody-dependent, cell-mediated cytotoxicity
Cells (106 5L or 565) were labeled with 4.6 MBq 51chromium sulfate (Amersham) for 60–90 min. Cells were washed three times with RPMI 10% FCS. Labeled 5L and 565 cells (100 µl) were plated in 96-well plates at a density of 105 cells/ml in RPMI 10% FCS with varying concentrations of the fusion proteins (ranging from 20 µg/ml to 652 ng/ml) and incubated at 37°C for 30 min. PBMC were then added to a final concentration of 106 cells per ml. After 4 h at 37°C, 25 µl supernatants from each well were added to 150 µl Opti-Phase supermix (Wallac) in a flexible counter plate for evaluation in a MicroBetaPlus ß-counter. Spontaneous lysis was determined from 5L and 565 cells that were incubated without the fusion proteins or PBMC, and maximal lysis was determined by the addition of 5% Triton X-100.

Cell proliferation
Proliferation of cells was determined in 96-well plates. Cells were pulsed with 0.5 µCi 3H-thymidine per well for 16 h and were harvested and evaluated on a microplate scintillation counter. Measurements were performed in triplicates, and results are represented as means ± standard deviations.

Measurement of cytokine release
IL-5 and IFN-{gamma} concentrations were determined by enzyme-linked immunosorbent assay (ELISA) using the protocol provided by the manufacturer (BioSource International, Nivelles, Belgium).

Quantification of cell death
The numbers of dead cells were determined by trypan blue staining. Live and dead cells in four fields of a hemacytometer were counted, and the percentages of dead cells were calculated. Means and standard deviations of four such countings are depicted.

Determination of OX40 binding to OX40L
OX40L-IgG1 at 10 µg/ml was incubated with OX40-IgG1, OX40-IgG4m, or hIgG4 at varying concentrations for 30 min at 37°C. Cells (565) expressing OX40 were added to this mix for 30 min at 37°C. After washing, the cells were labeled with biotinylated, anti-human OX40L antibody (clone H2.33) for 30 min at 4°C followed by PE-conjugated streptavidin. The cells were run through a Becton Dickinson FACScan to determine fluorescence of the cells.

Animals
Female BALB/c mice (8- to 10-weeks old) were obtained from A. Tuck & Sons (Southend-on-Sea, UK). All mice were housed under standard conditions with free access to food and water.

Induction of colitis
BALB/c mice were weighed before procedure. TNBS (Fluka, Gillingham, UK) was prepared in a 50% ethanol solution diluted to give a final concentration of 2 mg TNBS in 75 µl total volume. Mice were lightly anaesthetized using 200 µl of a 1/10 aqueous dilution of Hypnorm (Janssen-Cilag, High Wycombe, UK). Colitis was induced by intrarectal administration of 75 µl TNBS solution using a plastic catheter. Control mice received 50% aqueous ethanol only. The general condition and body weight of mice were checked daily.

Treatment with fusion proteins
TNBS colitic mice and ethanol-treated controls were injected intraperitoneally with hOX40-IgG (100 µg) on days 4–6 after induction of colitis.

RNA extraction and quantitative RT-PCR
Constructs encoding standard RNAs (pMCQ1, pMCQ2, pMCQ3, and pMCQ4), kindly provided by Dr. M. F. Kagnoff (Department of Medicine, University of California, San Diego) [14 ], were used for quantitative, competitive RT-PCR. To generate standard RNA, plasmids were linearized with SalI (pMCQ1) or NotI (pMCQ2, 3, 4) and were transcribed in vitro using T7 RNA polymerase under conditions recommended by the supplier (Promega, Southampton, UK).

Gut tissue was snap frozen in liquid nitrogen and stored at -70°C. Cellular RNA was isolated by homogenizing tissue in TRIzol (Life Technologies, Paisley, UK) and incubating at room temperature for 5 min. RNA was extracted using chloroform (Sigma Chemical Co.), followed by centrifugation for 15 min at 12,000 g at 4°C. The aqueous phase was precipitated with an equal volume of isopropanol (Sigma Chemical Co.), followed by centrifugation for 15 min at 12,000 g at 4°C. The pellet was washed with 70% ethanol and resuspended in 50 µl water. Total RNA was determined by spectrometric analysis.

Serial, tenfold dilutions of standard RNA (1 pg–1 fg) were coreverse transcribed with total cellular RNA (2 µg) at 42°C for 50 min in a 20 µl reaction volume containing 50 mM Tris, pH 8.3, 75 mM KCl, 3 mM MgCl2, 3 mM dithiothreitol, 10 mM dNTP mix, and 0.5 µg oligo(dT) (Pharmacia Biotech, Herts, UK), using 100 U RT (Superscript II RNase H-, Life Technologies). The reaction was terminated by heat inactivation at 70°C for 10 min. PCR amplification was conducted routinely in 50 µl reaction volumes {10 mM Tris, pH 9, 50 mM KCl, 1.5 mM MgCl2, 200 µM dNTPs, 10 pmol 5' and 3' primers, as described elsewhere (see ref. [14 ]), and 1 U Taq polymerase (Pharmacia Biotech)}. Forty amplification cycles of 45 s denaturation at 94°C, 45 s annealing at 58°C, and 75 s extension at 72°C were used. Primers used for TNF-{alpha} were: sense 5'-ATGAGCACAGAAAGCATGATC; antisense 5'-TACAGGCTTGTCACTCGAATT.

After amplification, PCR products were analyzed on 1% agarose gels, and bands were visualized by ethidium bromide staining. Band intensities were quantified by densitometry (Seescan, Cambridge, UK). The sensitivity of this technique enables the detection of >103 mRNA transcripts per µg total RNA.

Immunhistochemistry
Three-step avidin-peroxidase staining was performed on 5 µm frozen sections as described previously using the monoclonal anti-CD4 antibody YTS 191 (American Type Culture Collection, Manassas, VA) [15 ]. Biotin-conjugated rabbit anti-rat IgG (DAKO) and goat anti-hamster IgG (Vector Laboratories, Peterborough, UK) were used at 1:50 dilutions in Tris-buffered saline (TBS), pH 7.6, containing 4% (v/v) normal mouse serum (Harlan Seralab, Oxon, UK). Avidin peroxidase (Sigma Chemical Co.) was used at dilutions of 1:200 in TBS. Peroxidase activity was detected with 3,3'-diaminobenzidine-tetra-hydrochloride (Sigma Chemical Co.) in 0.5 mg/ml Tris-HCl, pH 7.6, containing 0.01% H2O2. The density of the cells in the lamina propria was determined by image analysis as described previously [15 ].


arrow
RESULTS
 
Generation of OX40-IgG fusion proteins
Three OX40-IgG fusion proteins were generated as described in Materials and Methods. In short, OX40-IgG1 consisted of the extracellular domain of human OX40 fused to the constant domain of human IgG1. Replacement of the IgG1 domain by that of IgG4 yielded OX40-IgG4, and mutation of Leu235 to Glu in IgG4 generated OX40-IgG4mut.

Binding affinities of OX40-IgG fusion proteins
The affinities of the IgG domains of the three OX40-IgG fusion proteins to the Fc receptor for IgG (Fc{gamma}R) were tested by incubation with the monocytic cell line U937. The cells were activated overnight with 625 ng/ml IFN-{gamma} to increase expression of Fc{gamma}R. OX40 ligand is not expressed as a result of this stimulation (not shown). Binding of the OX40 fusion proteins to Fc receptor was analyzed by flow cytometry after staining with an OX40-specific antibody. The strongest binding was found for OX40-IgG1 (Fig. 1 A ). OX40-IgG4 bound about half as strongly to the U937 cells, and no binding was obtained with OX40-IgG4mut (Fig. 1A) . Binding of OX40-IgG fusion protein was concentration-dependent and reached saturation at 3 µg/ml hOX40-hIgG1 (Fig. 1B) .



View larger version (27K):
[in this window]
[in a new window]
 
Figure 1. Analysis of Fc receptor binding. (A) U937 cells were activated overnight with 625 pg/ml IFN-{gamma}. Cells (106 U937) per condition were incubated with serial 1:1 dilutions of OX40-IgG fusion proteins. Binding of the fusion proteins to Fc receptor was analyzed by flow cytometry after staining with an OX40-specific antibody. This experiment was repeated twice with identical results. (B) Flow cytometry prolifles of hOX40-hIgG1 of (A). The highest concentration used was 100 µg/ml, which was titrated down in 10 1:1-dilution steps to 95 ng/ml. The arrows indicate the last FACS prolife for each dilution step. (top left panel) Controls: 2nd ab, secondary antibodies, which is biotinylated anti-OX40 (murine IgG1); isotype control, biotinylated murine IgG1.

Immune effector functions of OX40-IgG fusion proteins
Complement lysis of OX40 ligand-expressing cells (5L cells) could be induced by OX40-IgG1, but not by OX40-IgG4 or OX40-IgG4mut (Fig. 2 A ). To demonstrate the specificity of cell lysis, the proteins were incubated with OX40-expressing 565 cells. As expected, only OX40L-IgG1 caused cell death, whereas the three OX40-IgG fusion proteins were inactive (Fig. 2A) .



View larger version (27K):
[in this window]
[in a new window]
 
Figure 2. Immune effector functions of OX40-IgG fusion proteins. (A) Complement lysis: OX40L-expressing 5L cells (upper panel) and OX40-expressing 565 cells (lower panel) were labeled with 51chromium sulfate. Then they were incubated with indicated concentrations of fusion proteins in cold PBS for 30 min at 4°C. After washing the cells, 100 µl guinea pig complement serum was added at a dilution of 1:200. Released 51Cr was used to calculate the degree of cell lysis. Lysis at each point was determined in triplicates. Depicted are means ± standard deviations. (B) ADCC: OX40L-expressing 5L cells (upper panel) and OX40-expressing 565 cells (lower panel) were labeled with 51chromium sulfate and incubated with indicated concentrations of fusion proteins in the presence of PBMC. Released 51Cr was used to calculate the degree of cell lysis. Lysis at each point was determined in triplicates. Depicted are means ± standard deviations. (A and B) Experiments were performed at least three times with comparable results.

The ability of the fusion proteins to induce ADCC was also investigated. OX40-IgG1 served as a positive control and induced ADCC in up to 30% of OX40L-expressing 5L cells (Fig. 2B) . The negative control protein OX40L-IgG1 induced no ADCC. OX40-IgG4 was less potent at inducing ADCC than OX40-IgG1, but at its highest concentration it caused lysis of about 15% of the cells. The OX40-IgG4mut fusion protein lacked all ADCC activity indicating that the replacement of lysine235 by a glutamate was sufficient to eliminate the ADCC activity of IgG4 (Fig. 2B) . To demonstrate the specificity of cell lysis, the same fusion proteins were incubated with OX40-expressing 565 cells. As expected, only OX40L-IgG1 caused cell death, whereas the three OX40-IgG fusion proteins were inactive on 565 cells (Fig. 2B) . The respective capacities of the three OX40 fusion proteins to induce ADCC correlated with their Fc receptor-binding characteristics (Fig. 1) .

These experiments convincingly demonstrate that the replacement of the Fc domain of IgG1 with the one of IgG4 and the exchange of Leu235 by Glu completely eliminated the complement lysis activity and ADCC of OX40-IgG1.

Inhibition of immune functions by OX40-IgG fusion proteins in vitro
The comparison of OX40-IgG1 and OX40-IgG4mut in functional experiments should provide insight into the role of cell death in hOX40-hIgG-mediated immunomodulation. OX40-IgG1 reduced proliferation of anti-CD3-activated PBMC to about a quarter compared with the isotype control antibody (Fig. 3 A , upper panel). OX40-IgG4mut only reduced proliferation slightly at its highest concentration of 50 µg/ml and had no effect at 12.5 and 25 µg/ml (Fig. 3A , upper panel).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 3. OX40-IgG fusion proteins inhibit in vitro-immune functions. (A) PBMC (2x105) were activated with 3 ng/ml anti-CD3 (OKT3). OX40-IgG fusion proteins and isotype control antibodies were added at indicated concentrations. Proliferation was determined at day four by 3H-thymidine incorporation (upper panel), and the numbers of live and dead cells were evaluated by trypan blue staining at day four (lower panel) and are depicted as percentage of dead cells. (B) PBMC (5x105) in 0.5 ml medium were activated with IL-2 (10 U/ml) and phytohemagglutinin (PHA; 50 ng/ml). OX40-IgG fusion protein and isotype-control antibodies were added at indicated concentrations. Supernatants were harvested after three days, and concentrations of IL-5 were determined by ELISA. (C) PBMC (5x105) in 0.5 ml were activated with IL-2 (10 U/ml) and indicated concentrations of PHA. OX40 fusion protein and isotype control antibodies were added at 25 µg/ml. Supernatants were harvested after three days, and concentrations of IL-5 (upper panel) and IFN-{gamma} (lower panel) were determined by ELISA. (A and B) Experiments were performed at least three times with comparable results. (D) Indicated concentrations of OX40-IgG fusion proteins or IgG4 control antibody were incubated with 10 µg/ml hOX40L-hIgG1 for 30 min at 37°C. Afterwards, the solutions were added to 5 x 105 OX40-expressing 565 cells. OX40L-IgG1 bound to 565 cells was detected by staining with biotinylated anti-OX40L antibody followed by streptavidin-PE and flow cytometry.

Although hOX40-hIgG4mut and the isotype-control proteins had no effect on cell viability, OX40-IgG1 dramatically increased the number of dead cells in the culture three- to fivefold (Fig. 3A , lower panel). OX40-IgG4mut affected the number of surviving cells far less, and a significant increase in the number of dead cells was only found at 12.5 µg/ml OX40 fusion protein (Fig. 3A , lower panel). It has to be noted, that as a result of the lack of complement serum, only ADCC is measurable in this experimental set-up but not complement lysis.

The OX40-IgG1 and OX40-IgG4mut proteins were also compared with their effects on mitogen-induced cytokine release by human PBMC. Both proteins inhibited the release of IL-5 in mitogen-activated PBMC dose-dependently, with 5–10 µg/ml fusion resulting in a complete inhibition (Fig. 3B) . This result was not surprising in the case of OX40-IgG1, which can induce cell death. However, inhibition of IL-5 by OX40-IgG4mut implied a more genuine regulation of cytokine secretion distinct from merely knocking-out cells. This could be confirmed by demonstrating that OX40-IgG4mut enhanced levels of IFN-{gamma} (Fig. 3C) .

To exclude that the observed differences in activity were a result of different affinities to OX40 ligand, we tested the respective abilities of OX40-IgG1 and OX40-IgG4m to neutralize OX40 ligand in a flow cytometry-based competition assay. OX40-IgG and OX40-IgG4m had the same potency in neutralizing the OX40 ligand binding to the 565 cells (Fig. 3D) . This demonstrated that the observed differences between the two proteins are a result of their different IgG domains.

Inhibition of colitis by OX40-IgG fusion proteins
The potencies of OX40-IgG1 and OX40-IgG4mut fusion proteins to inhibit immune responses in vivo were evaluated in murine TNBS-induced colitis. In this widely used model of Crohn’s disease, much of the gut injury is because of local, cell-mediated immune reactions. The mice were treated on days 4–6 with 100 µg fusion protein or an isotype-control protein, respectively, and were killed on day 7. Both OX40-IgG fusion proteins reduced the number of infiltrating CD4-positive T cells into the lamina propria (Fig. 4A 4B 4C 4D 4E ). TNF-{alpha} mRNA expression was also reduced by the two OX40-IgG fusion proteins by the same degree to about a quarter compared with the isotype control (Fig. 4F) .



View larger version (45K):
[in this window]
[in a new window]
 
Figure 4. Treatment with OX40-IgG fusion proteins reduces inflammation. Colitis was induced in BALB/c mice by TNBS, and mice were treated with 100 µg hIgG, OX40-IgG1, or OX40-IgG4mut on days 4–6. Mice were killed at day 7, and gut tissue was stained for CD4-positive T cell infiltration (arrows) into the lamina propria, (A) ethanol control, (B) TNBS mice treated with hIgG, (C) TNBS mice treated with hOX40-hIgG1, and (D) TNBS mice treated with hOX40-hIgG4mut. Original magnification, x200. Serial section stained in parallel in the absence of primary antibody showed no staining. (E) Quantitative evaluation of infiltrated CD4-positive T cells: mean ± standard error of mean. (F) TNF-{alpha} mRNA transcript levels in gut tissue of mice (A–D) were determined by quantitative RT-PCR. Each group represents three to six mice, and the experiment was repeated twice with identical results.


arrow
DISCUSSION
 
The first OX40 fusion protein that was developed was OX40-IgG1 and consisted of the extracellular domain of human OX40 fused to the constant domain of human IgG1 (hinge-CH2-CH3). As human OX40 also binds to murine OX40 ligand, OX40-IgG1 could also be studied using murine cells and murine models of human inflammatory diseases. This protein substantially reduced colitis and EAE in mice [11 , 12 ].

Three separate mechanisms that are not mutually exclusive could account for the observed reduction in immune responses by OX40-IgG1. It could bind and neutralize the activity of OX40 ligand on the APC; it could kill APC by ADCC and/or complement lysis; and it could bind and neutralize the activity of OX40 ligand on inflamed endothelial cells. The first two mechanisms would block T cell costimulation, and the third mechanism would block T cell extravasation. Which of the three mechanisms was operational and to which extent could not be determined from the previous experiments.

As a result of the intact IgG1 domain OX40-IgG1, this fusion protein was expected to have the identical immune effector functions as a human antibody of the IgG1 isotype. Indeed, induction of ADCC and complement lysis by OX40-IgG1 could be demonstrated in OX40 ligand-expressing cells (Fig. 2) .

To assess the contribution of cell killing to the potency of OX40-IgG1, an isoform was constructed that lacked immune effector functions. The ability of OX40-IgG1 to induce complement lysis was eliminated by replacing the Fc domain of human IgG1 with that of human IgG4, which does not bind C1q, the first protein in the complement cascade. However, as the IgG4 domain retains some ADCC activity, although less than the IgG1 domain, an OX40-IgG4 protein could still kill OX40 ligand-expressing cells. Therefore, ADCC activity of hOX40-hIgG4 needed to be eliminated as well. The strategy to achieve this was based on earlier data that follow.

ADCC is exerted by monocytes and natural killer cells when they recognize opsonized cells via their Fc receptors. Human IgG4 does not bind Fc{gamma}RII and Fc{gamma}RIII, but it does bind Fc{gamma}RI. A crucial subdomain for this interaction has been mapped to amino acids 234–238 of IgG4 [16 ]. Murine IgG2a is the homologue of human IgG1, and both molecules have a high affinity for Fc{gamma}RI (10-8). Their FcR binding domains also share the following identical sequence: Leu234-Leu-Gly-Gly-Pro (Fig. 5 ). Leu235 was found to be essential for Fc{gamma}RI binding and subsequent ADCC induction by murine IgG2a [17 ]. Murine IgG2b is a variant of mIgG2a. Its Fc{gamma}RI binding site varies by a single amino acid substitution (Leu235->Glu) from that of murine IgG2a, resulting in a low affinity for Fc{gamma}RI (10-6). Targeted mutation of Glu235 to Leu in murine IgG2b not only changes its sequence to that of murine IgG2a but also increases its affinity for Fc{gamma}RI to that of murine IgG2a [17 , 18 ].



View larger version (19K):
[in this window]
[in a new window]
 
Figure 5. Sequence of FcR{gamma}I-binding sites Depicted are the sequence motifs (amino acids 234–238) of human and murine IgG, which are mainly responsible for binding to Fc{gamma}RI. Also listed are the respective affinities of the Igs to Fc{gamma}RI and their capacity to induce ADCC and CDC. +++, ++, +, and -, High, medium, low, and no activity, respectively; n.d., not determined; CDC, complement-dependent cytotoxicity.

The human IgG4 molecule has a medium affinity for Fc{gamma}RI (10-7) and the sequence Phe234-Leu-Gly-Gly-Pro. It retains the Leu at position 235, which is essential for Fc{gamma}RI binding as is outlined above. Therefore, we concluded that mutation of Leu235 to a Glu in human IgG4 (OX40-IgG4mut) should completely abolish Fc{gamma}RI binding and ADCC. This hypothesis could be confirmed nicely by FcR binding and ADCC assays (Figs. 1 and 2B) .

U937 cells not only express Fc{gamma}RI, but also Fc{gamma}RII and Fc{gamma}RIII. It is therefore not possible to reliably compare binding affinities between hOX40-hIgG1 and hOX40-hIgG4 using these cells, as IgG4 only binds to Fc{gamma}RI, whereas IgG1 binds to Fc{gamma}RII and Fc{gamma}RIII as well. However, the experiment in Figure 1 nicely demonstrates that substitution of Leu235 by Glu in IgG4 eliminates the Fc{gamma}RI binding of IgG4. Also, as IgG4 induces ADCC via Fc{gamma}RI, these data correlate well with the capacity of hOX40-hIgG4 and hOX40-hIgG4mut to induce ADCC.

OX40-IgG1 was more potent than OX40-IgG4mut in inhibiting immune reactions in vitro. OX40-IgG1 profoundly inhibited proliferation of PBMC and the release of IL-5 and IFN-{gamma}. OX40-IgG4mut had no or little effect on proliferation of PBMC. It inhibited IL-5 release but increased levels of IFN-{gamma}. The stronger effects of OX40-IgG1 are likely a result of the elimination of APC by ADCC, as evidenced by the higher number of dead cells in the OX40-IgG1-treated cultures. As OX40-IgG1 differs from OX40-IgG4mut only by its ability to induce cell death, this activity has to be the basis of its higher potency.

OX40-IgG4mut, which neutralizes OX40L, does not seem to be a general inhibitor of immune reactions in vitro. It had no effect on proliferation and did not inhibit cytokine release in general. Rather, by inhibiting an OX40L-mediated TH2 shift, it changed the cytokine profile toward a TH1 response.

While OX40-IgG1 seems to be more potent in inhibiting immune reactions in vitro, OX40-IgG1 and OX40-IgG4mut fusion proteins reduced colitis in mice to the same extent. A likely explanation for this difference is the fact that in vitro, the OX40-IgG fusion proteins are restricted to interfere with APC-mediated costimulation of T cells. However, in vivo, OX40 fusion proteins can act additionally on OX40L on the inflamed vascular endothelium, killing the endothelial cells or neutralizing OX40L on their surface. Both mechanisms would decrease the extravasation signal for OX40-positive T cells. The equal potencies of OX40-IgG1 and OX40-IgG4mut indicate that blocking T cell extravasation is sufficient to quench autoimmune reactions and may be the major mechanism for the OX40-IgG activity in vivo.

As the possibility cannot be excluded that the OX40-IgG1 fusion protein may kill endothelial cells, potentially entailing side effects for an OX40-IgG1-treated autoimmune patient, the OX40-IgG4mut protein may be the safer alternative for human therapy.

These data also demonstrate that Ig effector functions are active in fusion proteins in the same way as in antibodies. This should allow the design of fusion proteins with desired effector functions. Fusion proteins, which target cancer cells or autoreactive immune cells, may gain in potency if they have the capability to induce cell death in their target tissues. This increase in potency has to be balanced with possible side-effects if the ligand of the fusion protein is expressed on tissues other than the target cells.


arrow
ACKNOWLEDGEMENTS
 
M. A. B. is supported by Crohn’s in Childhood Research Association. L. T. and M. A. B. contributed equally to the study.

Received November 12, 2001; revised April 12, 2002; accepted April 15, 2002.


arrow
REFERENCES
 
    1
  1. Chamow, S. M., Ashkenazi, A. (1999) Antibody Fusion Proteins Wiley-Liss New York.
  2. 2
  3. Scallon, B. J., Trinh, H., Nedelman, M., Brennan, F. M., Feldmann, M., Ghrayeb, J. (1995) Functional comparisons of different tumour necrosis factor receptor/IgG fusion proteins Cytokine 7,759-770[Medline]
  4. 3
  5. Weinblatt, M. E., Kremer, J. M., Bankhurst, A. D., Bulpitt, K. J., Fleischmann, R. M., Fox, R. I., Jackson, C. G., Lange, M., Burge, D. J. (1999) A trial of etanercept, a recombinant tumor necrosis factor receptor:Fc fusion protein, in patients with rheumatoid arthritis receiving methotrexate N. Engl. J. Med. 340,253-259[Abstract/Free Full Text]
  6. 4
  7. Weinberg, A. D., Vella, A. T., Croft, M. (1998) OX-40: life beyond the effector T cell stage Semin. Immunol. 10,471-480[Medline]
  8. 5
  9. Gramaglia, I., Weinberg, A. D., Lemon, M., Croft, M. (1998) Ox-40 ligand: a potent costimulatory molecule for sustaining primary CD4 T cell responses J. Immunol. 161,6510-6517[Abstract/Free Full Text]
  10. 6
  11. Imura, A., Hori, T., Imada, K., Ishikawa, T., Tanaka, Y., Maeda, M., Imamura, S., Uchiyama, T. (1996) The human OX40/gp34 system directly mediates adhesion of activated T cells to vascular endothelial cells J. Exp. Med. 183,2185-2195[Abstract/Free Full Text]
  12. 7
  13. Imura, A., Hori, T., Imada, K., Kawamata, S., Tanaka, Y., Imamura, S., Uchiyama, T. (1997) OX40 expressed on fresh leukemic cells from adult T-cell leukemia patients mediates cell adhesion to vascular endothelial cells: implication for the possible involvement of OX40 in leukemic cell infiltration Blood 89,2951-2958[Abstract/Free Full Text]
  14. 8
  15. Souza, H. S., Elia, C. C., Spencer, J., MacDonald, T. T. (1999) Expression of lymphocyte-endothelial receptor-ligand pairs, alpha4beta7/MAdCAM-1 and OX40/OX40 ligand in the colon and jejunum of patients with inflammatory bowel disease Gut 45,856-863[Abstract/Free Full Text]
  16. 9
  17. Aten, J., Roos, A., Claessen, N., Schilder-Tol, E. J., Ten Berge, I. J., Weening, J. J. (2000) Strong and selective glomerular localization of CD134 ligand and TNF receptor-1 in proliferative lupus nephritis J. Am. Soc. Nephrol. 11,1426-1438[Abstract/Free Full Text]
  18. 10
  19. Nohara, C., Akiba, H., Nakajima, A., Inoue, A., Koh, C. S., Ohshima, H., Yagita, H., Mizuno, Y., Okumura, K. (2001) Amelioration of experimental autoimmune encephalomyelitis with anti-OX40 ligand monoclonal antibody: a critical role for OX40 ligand in migration, but not development, of pathogenic T cells J. Immunol. 166,2108-2115[Abstract/Free Full Text]
  20. 11
  21. Higgins, L. M., McDonald, S. A. C., Whittle, N., Crockett, N., Shields, J., MacDonald, T. T. (1999) Regulation of T cell activity in vitro and in vivo by targeting the OX40-OX40 ligand interaction: amelioration of ongoing inflammatory bowel disease with an OX40-IgG fusion protein, but not with an OX40 ligand fusion protein J. Immunol. 162,486-493[Abstract/Free Full Text]
  22. 12
  23. Weinberg, A. D., Wegmann, K. W., Funatake, C., Whitham, R. H. (1999) Blocking OX-40/OX-40 ligand interaction in vitro and in vivo leads to decreased T cell function and amelioration of experimental allergic encephalomyelitis J. Immunol. 162,1818-1826[Abstract/Free Full Text]
  24. 13
  25. Godfrey, W. R., Fagnoni, F. F., Harara, M. A., Buck, D., Engleman, E. G. (1994) Identification of a human OX-40 ligand, a costimulator of CD4+ T cells with homology to tumor necrosis factor J. Exp. Med. 180,757-762[Abstract/Free Full Text]
  26. 14
  27. Eckmann, L., Fierer, J., Kagnoff, M. F. (1996) Genetically resistant (Ityr) and susceptible (Itys) congenic mouse strains show similar cytokine responses following infection with Salmonella dublin J. Immunol. 156,2894-2900[Abstract]
  28. 15
  29. McDonald, S. A., Palmen, M. J., Van Rees, E. P., MacDonald, T. T. (1997) Characterization of the mucosal cell-mediated immune response in IL-2 knockout mice before and after the onset of colitis Immunology 91,73-80[Medline]
  30. 16
  31. Woof, J. M., Partridge, L. J., Jefferis, R., Burton, D. R. (1986) Localisation of the monocyte-binding region on human immunoglobulin G Mol. Immunol. 23,319-330[Medline]
  32. 17
  33. Duncan, A. R., Woof, J. M., Partridge, L. J., Burton, D. R., Winter, G. (1988) Localization of the binding site for the human high-affinity Fc receptor on IgG Nature 332,563-564[Medline]
  34. 18
  35. Greenwood, J., Clark, M., Waldmann, H. (1993) Structural motifs involved in human IgG antibody effector functions Eur. J. Immunol. 23,1098-1104[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
B. E. Burrell, G. Lu, X. C. Li, and D. K. Bishop
OX40 Costimulation Prevents Allograft Acceptance Induced by CD40-CD40L Blockade
J. Immunol., January 1, 2009; 182(1): 379 - 390.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Roosnek, P. Schneider, and B. Huard
Heparan sulfate proteoglycans, Fc receptors, and DC suppression
Blood, August 1, 2008; 112(3): 915 - 916.
[Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. D. Weinberg, D. E. Evans, C. Thalhofer, T. Shi, and R. A. Prell
The generation of T cell memory: a review describing the molecular and cellular events following OX40 (CD134) engagement
J. Leukoc. Biol., June 1, 2004; 75(6): 962 - 972.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
I. R. Humphreys, G. Walzl, L. Edwards, A. Rae, S. Hill, and T. Hussell
A Critical Role for OX40 in T Cell-mediated Immunopathology during Lung Viral Infection
J. Exp. Med., October 20, 2003; 198(8): 1237 - 1242.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
J. Wilson, C. P. Rossi, S. Carboni, C. Fremaux, D. Perrin, C. Soto, M. Kosco-Vilbois, and A. Scheer
A Homogeneous 384-Well High-Throughput Binding Assay for a TNF Receptor Using Alphascreen Technology
J Biomol Screen, October 1, 2003; 8(5): 522 - 532.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taylor, L.
Right arrow Articles by Schwarz, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, L.
Right arrow Articles by Schwarz, H.