Accuri C6 Flow Cytometer System

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maletto, B.
Right arrow Articles by Pistoresi-Palencia, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maletto, B.
Right arrow Articles by Pistoresi-Palencia, M. C.
(Journal of Leukocyte Biology. 2002;72:447-454.)
© 2002 by Society for Leukocyte Biology

CpG-DNA stimulates cellular and humoral immunity and promotes Th1 differentiation in aged BALB/c mice

Belkys Maletto, Andrea Rópolo, Victor Morón and María Cristina Pistoresi-Palencia

Departamento de Bioquímica Clínica, Facultad de Ciencias Químicas, Universidad Nacional de Córdoba, Argentina

Correspondence: Dr. María Cristina Pistoresi-Palencia, Departamento de Bioquímica Clínica, Facultad de Ciencias Químicas, Universidad Nacional de Córdoba, Ciudad Universitaria, Ala 1 Pabellón Argentina (5000), Córdoba, Argentina. E-mail: cpistore{at}bioclin.fcq.unc.edu.ar


arrow
ABSTRACT
 
We examined whether CpG-DNA could be used as adjuvant to induce a T helper cell type-1 (Th1) immunity in aged BALB/c mice that showed a Th2 polarization. Bordetella pertussis and complete Freund’s adjuvant (CFA) were used as well. Immunization with ovalbumin (OVA)/CpG-DNA showed that the immunoglobulin G (IgG)2a/IgG1 ratio and OVA-specific T cell response were similar in young and aged mice. OVA/CpG-DNA induced the secretion of interferon-{gamma} (IFN-{gamma}) and absence of interleukin (IL)-5. Similar results were found in mice immunized with OVA/CFA. When mice were immunized with OVA/B. pertussis, we found that the IgG2a/IgG1 ratio and OVA-specific T cell response were lower in aged mice and elicited IFN-{gamma} and IL-5. In vitro CpG-DNA stimulated antigen-presenting cells to display IL-12 and up-regulate the expression of major histocompatibility complex class II and B7-2 on B cells as efficiently in aged as in young mice, but the up-regulation of B7-1 was stronger in aged mice. The findings demonstrate that CpG-DNA is able to induce a young-like Th1 specific immune response in aged mice.

Key Words: vaccines • Th2 cells • adjuvant • immunosenescence • aging


arrow
INTRODUCTION
 
The immune system undergoes an age-associated reorganization, leading to changes that include enhanced as well as diminished function [1 ]. The age-related changes of the immune functions occur mainly in the T cell-dependent immune system. The T cells in the elderly are often characterized by reduced responses to mitogens [2 ], a shift from naive to memory phenotypes [3 , 4 ], and a shift from T helper cell type 1 (Th1) to Th2-type cytokine patterns [5 ]. At the same time, changes in B cell number and function during aging have been reported [6 , 7 ]. Many of these changes can be traced to an impaired capacity of T cells to support isotype switching and somatic mutation in B cells in the periphery and the generation of a diverse B cell repertoire from bone marrow B cell precursors. Finally, there are controversial studies about the functional capacity of antigen-presenting cells (APC). We have previously reported an impaired function of APC during aging in a model of experimental autoimmune prostatitis [8 ] and in BALB/c mice immunized with Trypanosoma cruzi antigens plus Bordetella pertussis (Bp) [9 ]. On the other hand, in nonimmunized aged animals, the arrival of accessory cells to the lymph nodes is unimpaired [10 ] and an intact functionality of dendritic cells has been demonstrated [11 , 12 ].

As a consequence of the dysregulation of the immune system during aging, there is an increased rise in the susceptibility to certain infectious diseases [13 ]. Therefore, the induction of a protective response is most important; however, the efficacy of vaccination is limited in the elderly. As the aging immune system has a shift toward a Th2-dominant state, there is a deficiency in the induction of the desired class of response, for example, the appropriate cytokine synthesis and cytolytic T lymphocyte response, which is essential for protection against many intracellular pathogens. For that, it is necessary to develop immunization strategies that allow enhancement of immune response and stimulate Th1 immunity during aging.

Adjuvants accepted for human use such as alum lack the capacity to generate cell-mediated Th1 immune responses [14 ]. The emergence of new adjuvants like CpG-DNA, oligonucleotides containing unmethylated CpG dinucleotides in particular base contexts, has opened the way for novel approaches to vaccination in aging. CpG-DNA have stimulatory effects on immune response and are able to elicit strong, Th1-type immune responses in young mice [15 , 16 ]. However, there is little information related to the use of CpG-DNA as an adjuvant in aged animals. To gain more information on this important issue, in this study we evaluated the efficiency (in terms of kinectics, intensity, and quality of humoral and cellular-immune response) of CpG-DNA to induce an ovalbumin (OVA)-specific immune response in aged (18-month-old) BALB/c mice. Moreover, we used as controls adjuvant Bp, which worked poorly when it was administered with T. cruzi antigens in aged mice [17 ], and complete Freund’s adjuvant (CFA), which led to Th1 immunity in young mice [18 ].

We report here that CpG-DNA induces specific immune responses, including significant immunoglobulin G (IgG)2a antibodies (Ab) and interferon-{gamma} (IFN-{gamma}) production, characteristics of Th1-type responses as efficiently in aged as in young animals. Moreover, CpG-DNA displayed levels of interleukin (IL)-12 by APC, activation (expression B7-2), and proliferation of B cells as efficiently in aged mice as in young mice. Our findings may be important for the development of Th1-promoting vaccine adjuvants applied in the elderly.


arrow
MATERIALS AND METHODS
 
Oligodeoxynucleotides
DNAs used were TCCATGACGTTxCCTGACGTTx (1826; CpG-DNA) and TCCAATGAGCTTCCTGAGTCT (1745; non-CpG-DNA). All DNAs were synthesized with a nuclease-resistant, phosphorothioate backbone, and no DNA contained any lipopolysaccharide contaminants (Operon Technologies, Inc., Alameda, CA). The CpG motifs or corresponding non-CpG motifs are underlined.

Animals
The experiments were performed using 3- (young) and 18- (aged) month-old female BALB/c mice. Mice were originally obtained from the Comisión Nacional de Energía Atómica (Argentina). The Institutional Care Use of Animals Committee (Exp. No. 15-01-44195) approved animal handling and experimental procedures.

Antigen and adjuvants
OVA (grade II) was purchased from Sigma Chemical Co. (St. Louis, MO). In all events, the dose of OVA injected was the same (60 µg OVA/animal/dose). Inactivated Bp (strain 10536, Instituto Nacional de Producción de Biológicos, Buenos Aires, Argentina) was used as adjuvant at a concentration of 1.5 x 109 bacterial cells per mouse per dose. CFA (oil containing inactived mycobacteria) was emulsified with OVA at a 1:1 (vol/vol) ratio (Sigma Chemical Co). The CpG-DNA or non-CpG-DNA were administered at a dose of 50 µg per animal.

Immunization
Immunization with OVA was performed as follows: one group received OVA mixed with phosphate-buffered saline (PBS; OVA/PBS), CpG-DNA (OVA/CpG-DNA), or non-CpG-DNA (OVA/non-CpG-DNA) on days 0 and 15; another group received OVA with CFA on days 0, 15, and 30 (OVA/CFA); and the other experimental group received OVA with Bp on days 0, 15, and 30 (OVA/Bp). Each mouse was injected subcutaneously (s.c.) in the tail, in the neck region, and in both hind limbs. Blood was collected by retro-orbital puncture at various time-points after immunization.

Antibody assays
Specific Ab against OVA were determined by enzyme-linked immunosorbent assay (ELISA). Briefly, 96-well flat-bottom plates were coated by incubation overnight at 4°C with OVA (1 µg/well) in 0.1 M sodium carbonate-bicarbonate buffer (pH 9.6). The plates were then blocked with PBS containing 0.5% gelatin for 1 h at 37°C. After washing, the plates were incubated with the plasma sample diluted in PBS with 0.05% Tween containing 0.5% gelatin for 1 h at 37°C. Total, specific IgG was detected with horseradish peroxidase (HRP)-conjugate anti-mouse IgG ({gamma}-chain-specific). For IgG subclass detection, plates were incubated with goat anti-mouse IgG1, IgG2a, IgG2b, or IgG3, and the reaction was followed by incubation with a HRP-conjugate rabbit anti-goat IgG. All Ab were purchased from Sigma Chemical Co. Plates were read on a Bio-Rad Model 450 microplate at 490 nm after incubation with H2O2 and o-phenylenediamine. Plasma from each mouse was assayed in duplicate, and the mean value of absorbance [optical density (OD)490] was used to represent each animal. These values were used to calculate the mean and SD for each group of mice.

Cell cultures
Spleen or lymph nodes (axillary and inguinal) from nonimmunized or OVA-primed mice were surgically removed. Red blood cells from spleen cell suspensions were removed by hypotonic shock. After wash, cell suspensions were cultured in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum (Natocor, Córdoba, Argentina), 2 mM L-glutamine, 50 µM 2-mercaptoethanol, and gentamicin (40 µg/ml) at 37°C in a 5% CO2 humidified incubator. In all cases, cell viability was >95%, as was determined by Trypan blue dye exclusion. Lymph node cell suspensions from OVA-primed mice were cultured with medium alone or OVA (100 µg/ml). Lymph node or mononuclear spleen cell suspensions from nonimmunized mice were cultured with medium alone, concanavalin A (Con A; 5 µg/ml), CpG-DNA (3 µM), or non-CpG-DNA (3 µM). For proliferation assays, cells were pulsed with [3H]thymidine (1 µCi/96 tissue-culture well; Dupont NEN, Boston, MA) 18 h before harvest, and incorporation of label was measured using a ß-scintillation counter. Culture supernatants were harvested after 72 h (for IL-5 and IFN-{gamma}) or at 45 h of incubation (for IL-12) and were then subjected to cytokine-specific ELISA.

Cytokine-specific ELISA
Levels of IFN-{gamma}, IL-5, and IL-12 in culture supernatants were measured in culture supernatants by capture ELISA, following instructions from the manufacturer (PharMingen, San Diego, CA). For coating and detection, the following monoclonal antibodies (mAb) were used: for anti-IFN-{gamma}, R4-6A2 and XMG1.2 clones; for anti-IL-5, TRFK5 and TRFK4 clones, and for anti-IL-12, C15.6 and C17.8 clones. Values for IFN-{gamma}, IL-5, and IL-12 were expressed by reference to a standard curve constructed by assaying serial dilutions of the respective murine standard cytokines. The levels of specific cytokine production in response to a stimulus were calculated by subtracting concentrations measured in unstimulated cultures. The detection limits of this ELISA assay were 195 pg/ml IFN-{gamma}, 15 pg/ml IL-5, and IL-12.

Flow cytometric analysis
Immunofluorescent staining of lymph node cell suspensions was performed by flow cytometry. All Ab were from PharMingen. The cells were pretreated for 20 min at 4°C with anti-CD32/CD16 mAb (clone 2.4G2) and were subsequently stained with mAb phycoerythrin (PE)-conjugated anti-mouse-CD19 (clone 1D3), fluorescein isothiocyanate (FITC)-conjugated anti-mouse-CD80 (B7-1, clone 16-10A1), FITC-conjugated anti-mouse-CD86 (B7-2, clone GL1), and FITC-conjugated anti-mouse-major histocompatibility complex (MHC) class II (clone 2G9) for 30 min at 4°C. After appropriate washes, stained cells were fixed in 2% formaldehyde and stored at 4°C. Flow cytometry data acquisition was performed on a Cytoron Absolute cytometer (Ortho Diagnostic System, Raritan, NJ; live/gated on the basis of forward- and side-scatter profiles). Data were analyzed using the computer program WinMDI version 2.8.

Statistical analysis
Statistical significance of differences between groups was evaluated by Student’s or nonparametric Mann-Whitney test (for two groups). All data were considered statistically significant if P values were <0.05.


arrow
RESULTS
 
Cytokine patterns in nonimmunized aged BALB/c mice
Age-related alterations of cytokine production profile by T cell subsets in mice have been reported [19 , 20 ]. We first evaluated in our experimental model the cytokine profile. For that, lymph node cells from nonimmunized 3- and 18-month-old mice were incubated with medium containing Con A (5 µg/ml). Cell culture supernatants were harvested at 72 h, and the production of IFN-{gamma} (Th1-type) and IL-5 (Th2-type) cytokines was analyzed using capture-ELISA. We found that although the production of IFN-{gamma} increased twofold higher in aged mice than in young mice, the IL-5 increased much more (100-fold more compared with young animals; Fig. 1 ). These results indicated that 18-month-old BALB/c mice showed a Th2 profile. In addition, lymphocytes of aged mice have shown a decreased proliferation after activation with Con A (5 µg/ml; data not shown). Taking everything into account, we concluded that in BALB/c mice, the aging affects the mitotic responsiveness and cytokine production to a significant extent.



View larger version (8K):
[in this window]
[in a new window]
 
Figure 1. Cytokine patterns (IFN-{gamma} and IL-5) in nonimmunized mice. Lymph node cells from nonimmunized 3 (open bars)- and 18 (solid bars)-month-old BALB/c mice were cultured for 72 h with 5 gmg/ml Con A (5x105 cells/200 µl/well). The supernatants from triplicate cultures were pooled and cytokine content was measured by triplicate by capture-ELISA. One typical experiment of three performed is shown.

Kinetics and strength of OVA-specific Ab response
To assess the capacity of CpG-DNA to enhance the humoral response during aging, 3- and 18-month-old BALB/c mice were s.c. immunized with OVA/CpG-DNA. Other groups of animals were injected with OVA in the following adjuvants: Bp, CFA, or non-CpG-DNA. Based on preliminary dose titration studies, we used the schedules indicated in Materials and Methods. At regular intervals, mice were bled, anti-OVA IgG levels in plasma were assessed by ELISA. The results obtained are summarized in Figure 2 . When aged animals were primed with OVA/Bp or OVA/CFA, the Ab levels were lower than in young mice 15 days after the second immunization (day 30). But, after a third priming with OVA/Bp or OVA/CFA, the levels of specific Ab response against OVA were similar in 3- and 18-month-old mice (Fig. 2A and 2B) . In contrast, young and aged mice, after the second immunization with OVA/CpG-DNA, developed specific anti-OVA Ab at similar levels (Fig. 2C) . Finally, OVA/non-CpG-DNA was able to develop OVA-specific IgG in 3- and 18-month-old mice (data not shown). On the whole, these results indicate that the immunization with OVA/Bp, OVA/CFA, or OVA/CpG-DNA was successful to generate an Ab response to OVA in aged mice.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 2. Kinetics and intensity of OVA-specific Ab response (IgG). Three ({circ})- and 18 (•)-month-old BALB/c mice were s.c. immunized with OVA/Bp (A), OVA/CFA (B), or OVA/CpG-DNA (C). Mice were immunized at times indicated in Materials and Methods. In x-axis, the times of bleeding are represented in days. Plasma (1:100 dilution) from individual mice was assayed in duplicate for anti-OVA Ab (IgG; ELISA). Each point represents the OD mean ± SD (n:6 per each group) from one of four experiments. *P = 0.003; **, P = 0.008; ***, P < 0.0001 compared with 3- versus 18-month-old mice.

Analysis of the OVA-specific Ab-isotype patterns
To examine antigen-specific Th1 and Th2 responses induced by OVA/CpG-DNA, OVA/CFA, and OVA/Bp in aged mice, we measured anti-OVA IgG isotype levels. For that, levels of IgG1, IgG2a, IgG2b, and IgG3 were assayed by ELISA 10 days after the third immunization with OVA/Bp and OVA/CFA or 10 days after the second immunization with OVA/CpG-DNA and OVA/non-CpG-DNA.

We found that a different pattern of IgG isotypes was induced by each adjuvant used (Fig. 3 ). Aged mice immunized with OVA/Bp showed an equivalent level of IgG1 but significantly lower levels of IgG2a and IgG3 than in young mice (Fig. 3A) . These results indicated that the lowest levels of total IgG observed in aged mice were a result of the diminished production of IgG2a and IgG3. Conversely, 18-month-old mice primed with OVA/CFA or OVA/CpG-DNA developed comparable levels of IgG1, but it is interesting that they also developed similar levels of IgG2a, IgG2b, and IgG3 Ab than did young mice. Furthermore, in aged mice the levels of IgG2a were certainly higher with OVA/CFA or OVA/CpG-DNA than with OVA/Bp immunization (Fig. 3B and 3C) . Mice (3 and 18 months old) injected with OVA/non-CpG-DNA produced essentially anti-OVA IgG1 Ab isotype, but the anti-OVA IgG2a, IgG2b, and IgG3 responses were significantly lower than those seen in mice injected with OVA/CpG-DNA (Fig. 3D) . Finally, in mice injected with OVA-PBS we observed that the antibody response was low, with a predominance of IgG1 isotype.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. OVA-specific Ab isotype patterns. Three- and 18-month-old BALB/c mice were s.c. immunized with OVA/Bp (A), OVA/CFA (B), OVA/CpG-DNA (C), OVA/non-CpG-DNA (D), or OVA/PBS (E). Ten days after the third immunization (OVA/Bp, OVA/CFA) or 10 days after the second immunization (OVA/CpG-DNA, OVA/non-CpG-DNA, OVA/PBS), plasma (1:100 dilution) from individual mice was assayed in duplicate for IgG isotype anti-OVA Ab (ELISA). The ELISA assays of all groups were performed at the same moment. Each bar represents the OD mean ± SD (n:6 per each group) from one of four experiments. *, P < 0.05 Bp-treated 18- compared with 3-month-old mice; **, P < 0.05 non-CpG-DNA-treated 3- and 18-month-old mice compared with CpG-DNA-treated 3- and 18-month-old mice.

To better establish the influence of each adjuvant on the specific IgG response, we titered the levels of anti-OVA IgG1 (which has been associated with Th2 responses) and IgG2a (which has been associated with Th1 responses) [21 , 22 ] present in the plasma obtained 10 days after the last immunization. Figure 4 shows that OVA/CpG-DNA (Fig. 4C) and OVA/CFA (Fig. 4B) , which have been shown to be a Th1-type adjuvant in young mice, were able to elicit similar levels of IgG2a antibodies in aged and young mice. Moreover, in aged mice, the values of IgG2a were 10 times higher with OVA/CpG-DNA and OVA/CFA than with OVA/Bp. OVA/CpG-DNA and OVA/non-CpG-DNA had an adjuvant effect on an OVA-specific IgG response, but the levels of IgG2a were lower when OVA/non-CpG-DNA was used.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. Titers of IgG1 and IgG2a Ab specific against OVA. Three (open bars)- and 18 (solid bars)-month-old BALB/c mice were s.c. immunized with OVA/Bp (A), OVA/CFA (B), OVA/CpG-DNA (C), or OVA/non-CpG-DNA (D). Ten days after the third immunization (OVA/Bp, OVA/CFA) or 10 days after the second immunization (OVA/CpG-DNA, OVA/non-CpG-DNA), plasma from individual mice was assayed in duplicate for OVA-specific IgG1 and IgG2a (ELISA). Each bar represents the mean of specific antibody titers (log10) ± SD (n:6 per each group). IgG1 and IgG2a antibody titers were calculated as the reciprocal of the last plasma dilution that yielded an A490 above that of the double-mean value of preimmune plasma. One typical experiment of three performed is shown. *, P < 0.05 Bp-treated, 18-month-old mice compared with Bp-treated, 3-month-old mice for IgG1 and IgG2a. **, P < 0.05 CpG-DNA or CFA-treated, 18-month-old mice compared with Bp-treated, 18-month-old mice for IgG2a. ***, P < 0.05 non-CpG-DNA-treated, 3- and 18-month-old mice compared with CpG-DNA-treated, 3- and 18-month-old mice for IgG2a.

The relationship between both IgG isotypes is better illustrated in Table 1 , where the ratio of IgG2a/IgG1 anti-OVA, acceptable as an indicative parameter of the Th1 or Th2 response, is shown. In 18-month-old mice challenged with OVA/CpG-DNA, the ratio IgG2a/IgG1 was similar to that obtained in OVA/CFA-treated mice and higher than that found after OVA/Bp priming. On the whole, these results demonstrate that when 18-month-old BALB/c mice were primed with OVA plus CpG-DNA or CFA, the anti-OVA antibody-isotype distribution was similar to that induced in 3-month-old BALB/c mice. It is interesting that we observed that in 18-month-old mice, specific IgG2a Ab were induced by OVA/CpG-DNA. These data suggest that CpG-DNA induced in aged mice a Th1-dominate response to coadministered protein antigen.


View this table:
[in this window]
[in a new window]
 
Table 1. IgG2a/IgG1 Ratio (OD mean±SD)

OVA-specific cellular immune response
After the characterization of the humoral response, we studied the ability of CpG-DNA to induce an OVA-specific T cell proliferative response in aged mice. With this purpose, 3- and 18-month-old BALB/c mice were s.c. immunized with OVA/Bp, OVA/CFA, OVA/CpG-DNA, or OVA/non-CpG-DNA. Ten days after the last injection, mice were sacrificed and draining lymph node cells were cultured in vitro to study the OVA-specific T cell proliferative response (Fig. 5 ). Mice (18-month-old) primed with OVA/Bp showed lower proliferative response against OVA than did those of 3-month-old mice. In marked contrast to the impaired response seen in old mice immunized with OVA/Bp, an OVA-specific proliferative response was not reduced in aged mice immunized with OVA/CpG-DNA. In this way, an OVA-specific proliferative response in aged mice immunized with OVA/CpG-DNA was comparable with that observed in young mice. The priming with OVA/CFA leads to a strong response against OVA at both ages. Finally, the injection of OVA/non-CpG-DNA caused little, if any, effect on the proliferation of T cells. These results ratify that in aged mice, CpG-DNA displayed a T cell adjuvant activity as strong as in young mice.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 5. T cell proliferation response against to OVA. Three (open bars)- and 18 (hatched bars)-month-old BALB/c mice were s.c. immunized with OVA/Bp (A), OVA/CFA (B), OVA/CpG-DNA (C), or OVA/non-CpG-DNA (D). Ten days after the third immunization (OVA/Bp, OVA/CFA) or 10 days after the second immunization (OVA/CpG-DNA, OVA/non-CpG-DNA), the proliferative recall response in draining lymph node cell pools from three mice per group was tested. The lymph node cells were plated at 2 x 105 cells/200 µl/well and incubated with OVA (100 µg/ml) for 6 days. Results are expressed as stimulation index (SI=mean cpm of triplicate OVA-containing wells divided by mean cpm of triplicate wells with medium alone). Dotted line shows SI = 2, the margin between positive and negative results. Lymph node cells were stimulated with 5 µg/ml Con A as a positive control (data not shown). One typical experiment of three performed is shown.

Cytokine patterns in immune mice
We used a capture-ELISA to assess recall antigen-specific IFN-{gamma} secretion as a measure of Th1 cell responses and IL-5 secretion as a measure of Th2 cell responses induced after immunization with OVA coadministered with Bp, CFA, CpG-DNA, and non-CpG-DNA. BALB/c mice (3- and 18-month-old) were s.c. immunized with OVA/Bp, OVA/CFA, OVA/CpG-DNA, or OVA/non-CpG-DNA. Ten days after the last immunization, mice were killed, and cytokine levels were assayed in culture supernatants of lymph node cells after restimulation in vitro with OVA (100 µg/ml; Fig. 6 ). The pattern of cytokines induced depends on the adjuvant used for immunization. In this way, when animals were immunized with OVA/Bp, a pattern of mixed IFN-{gamma} and IL-5 secretion was present; however, when animals were immunized with OVA/CFA or OVA/CpG-DNA, cultured cells preferentially produced IFN-{gamma}. In aged mice, the immunization with OVA/Bp elicited secretion of IFN-{gamma} and IL-5 (both cytokines levels were less than in young mice). In contrast, aged mice immunized with OVA/CpG-DNA showed secretion of IFN-{gamma} and absence of IL-5 response. Also, when mice were immunized with OVA/CFA, high levels of IFN-{gamma} were present in the supernatants of cells from 18- and 3-month-old mice. These cytokines were not detected in culture supernatants of OVA-restimulated lymph node cells from animals nonimmunized or immunized with OVA/non-CpG-DNA. Summing up, the priming with CpG-DNA in aged mice deflects the cellular response against OVA to a Th1 phenotype.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 6. Cytokine patterns of IFN-{gamma} (open bars) and IL-5 (solid bars) in immune mice. Three- and 18-month-old BALB/c mice were s.c. immunized with OVA/Bp, OVA/CFA, OVA/CpG-DNA, or OVA/non-CpG-DNA. Ten days after the third immunization (OVA/Bp, OVA/CFA) or 10 days after the second immunization (OVA/CpG-DNA, OVA/non-CpG-DNA), draining lymph node cells from three mice per group were cultured for 72 h with 100 µg/ml OVA (5x105 cells/200 µl/well). The supernatants from triplicate cultures were pooled, and cytokine content was measured by triplicate by capture-ELISA. One typical experiment of three performed is shown.

IL-12 production by spleen cells stimulated in vitro with CpG-DNA
The preceding results imply that CpG-DNA is able to induce in vivo a Th1 response in aged mice. It is generally recognized that IL-12 is a cytokine secreted by APC required in the induction of a Th1 response [23 , 24 ]. Previous studies demonstrated that CpG-DNA activate dendritic cells [25 , 26 ] and monocytes/macrophages [27 ] from young mice, which produced IL-12 cytokine. Thus, to evaluate the ability of CpG-DNA to stimulate IL-12 secretion in aged mice, we incubated in vitro spleen cells from nonimmunized 3- or 18-month-old mice with CpG-DNA (3 µM) or non-CpG-DNA (3 µM). Significant and similar levels of IL-12 were detected in the supernatant of cells from both age groups incubated with CpG-DNA but not in non-CpG-DNA (Table 2 ). Thus, aged APC were able to respond to CpG-DNA stimulation by secreting IL-12 cytokine.


View this table:
[in this window]
[in a new window]
 
Table 2. IL-12 Levels

Activation of aged cells incubated in vitro with CpG-DNA
As we previously stated (Figs. 2 3 4) , the immunization with OVA/CpG-DNA resulted in the production of comparable levels of antibody in aged as in young mice. This effect can be attributed to the activation of APC and generation of Th1 cells, but additionally, it can be attributed to the activation and differentiation of B cell by CpG-DNA. Therefore, to study the direct influence of CpG-DNA on B lymphocyte from aged mice, we incubated mononuclear spleen cells from normal 3- and 18-month-old mice with CpG-DNA (3 µM) or non-CpG-DNA (3 µM), a procedure that previously was shown, which only induced proliferation of B cells [28 ]. These experiments indicate that a strong and comparable proliferative response was observed in both age groups (Fig. 7 ). Furthermore, we examined the expression of CD80 (B7-1), CD86 (B7-2), and MHC class II molecules on B cells stimulated in vitro with CpG-DNA to check their end-state of activation. Lymph node cells from young and aged mice were incubated with CpG-DNA (3 µM) or non-CpG-DNA (3 µM) for 45 h and were then analyzed by flow cytometry. B cells (gated out as CD19+ cells) incubated with CpG-DNA showed a proliferation and an up-regulation of the expression of CD86 and MHC class II molecules in mice of both ages as compared with no treated cells. In contrast, CD80 expression induced by CpG-DNA was stronger in B cells from aged mice at the time point studied (Fig. 8 ). These results indicate that CpG-DNA is able to activate and stimulate the proliferation of B cells as efficiently in aged as in young mice.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 7. Mononuclear cells incubated in vitro with CpG-DNA. Spleen cells from nonimmunized 3- and 18-month-old BALB/c mice were incubated for 90 h with CpG-DNA (3 µM; solid bars) or non-CpG-DNA (3 µM; open bars; 2x105 cells/200 µl/well). Results are expressed as stimulation index (SI=mean cpm of triplicate CpG-DNA or non-CpG-DNA-containing wells divided by mean cpm of triplicate wells with medium alone).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 8. Lymph node cells (2x106 cells/ml) from nonimmunized 3- and 18-month-old BALB/c mice were incubated with medium alone (bold-line gray histograms), CpG-DNA (3 µM; thin-line histograms), or non-CpG-DNA (3 µM; shaded-line histograms). After 45 h of culture, cells were harvested, washed, and stained with antibody to anti-CD80-FITC, anti-CD86-FITC, anti-MHC class II-FITC, and anti-CD19-PE followed by flow cytometric analysis. All histograms are derived from the CD19+-gated cells. One typical experiment of three performed is shown.


arrow
DISCUSSION
 
It has been widely recognized that during the aging process, a dysregulation of the immune response occurs. Also, it has been described that with advanced age, there is a change in the Th1/Th2 balance, where the immune response is biased to a Th2 phenotype, associated with a decrease in the naive T cell number. Aging is accompanied by a higher incidence of infectious diseases, cancer, and a lower efficacy of most vaccinations [29 ]. As Th1 responses play an important role in protection against intracellular pathogens and tumor development [30 ], it is necessary to redirect the aging immune system toward a Th1 behavior that might increase the responsiveness to foreign antigens.

Based on the cytokine secretion pattern and antigen-specific effector function, CD4+ Th cell responses can be divided into three types: Th0, Th1, and Th2 [31 ]. Many factors are involved in the regulation of Th1 and Th2 cell subsets. In a variety of systems, the evidence shows the importance of the genetic background, the type of APC, the form and the dose of antigen used, and the route of immunization [32 , 33 ]. Furthermore, the use of adjuvants can polarize the T cell response toward Th1 or Th2 [34 ].

In this study, we examined the capacity of three adjuvants to induce and modulate Th1 and Th2 responses in aged mice. We evaluated the ability of CpG-DNA, Bp, and CFA to induce an OVA-specific immune response in 18-month-old BALB/c mice. We wish to point out that this is the first study to evaluate the efficacy of these three adjuvants under the same experimental conditions (antigen, route of injection, strain) in aged mice. We feel that the findings presented in this report may be of importance for the development of effective vaccines for the elderly.

Regarding age-related alterations of the cytokine profile, we found that T cells from nonimmunized, 18-month-old mice secreted high levels of IL-5 after stimulation with Con A. Our findings indicated 18-month-old BALB/c mice present a Th2-biased response under unspecific mitogens released by the physiological changes associated with the aging process. A similar cytokine profile was also described by Hobbs et al. [35 ]. The increase of IFN-{gamma} production observed through aging might be a result of a chronic antigenic exposure or preferential expansion of subsets of T cells that produce IFN-{gamma}. Related to this, Takayama et al. [36 ] have reported that CD8+ CD122+ T cells increase and produce large amounts of IFN-{gamma} with age. Additionally, it has been reported [37 ] that IFN-{gamma} production correlates with the CD8 (+high) CD28 (-) CD57 (+) T cell population elevated in aged individuals. In summary, our results showed that T cells from nonimmunized, 18-month-old mice produced a Th2-type cytokine response. Thus, we believe that our aged mice are attractive models to investigate the antigen-specific cytokine profile induced by injection in vivo of OVA plus Bp, CFA, or CpG-DNA as adjuvants.

In this study, we observed differences in terms of intensity and quality of the humoral and cellular responses between aged and young mice depending on the adjuvant used. When aged mice were immunized with OVA/CFA or OVA/Bp, they required three immunizations to reach the OVA-IgG levels observed in young mice. However, aged mice treated with OVA/CpG-DNA even after the second immunization were able to carry out an immune response with similar levels to those of young mice. In all groups, irrespective of the adjuvants used or the age of mice tested, we observed production of IgG1 and IgG2a. This coexpression of IgG1 and IgG2a is not surprising for two reasons: the genetic background of the host Th-2-biased BALB/c strain [38 ], and the switching to IgG1 is not strictly IL-4-dependent but can also be promoted by IL-2 [39 ]. We found a remarkable difference in the levels of anti-OVA IgG subtypes in 18-month-old mice depending on the adjuvant used during immunization. When aged mice received three doses of OVA/Bp, the magnitude of specific IgG2a response was significantly reduced. Aged mice that had received two injections with OVA/CpG-DNA generated titers of IgG2a anti-OVA Ab comparable with 3-month-old mice immunized under similar conditions. The mean IgG2a titers in aged mice immunized with OVA/CpG-DNA were enhanced tenfold compared with OVA/Bp-immunized aged mice.

By antigen-specific, proliferative-response assays, we found that all three adjuvants used led to an effective OVA-specific, T cell proliferative response in young mice, but only when aged mice were immunized with OVA plus CFA or CpG-DNA did they reach similar proliferation levels to the one found in young mice.

The analysis of cytokine production by OVA-specific T cells from mice immunized with OVA/Bp revealed a mixed Th1-Th2 or Th0 in aged and young mice. A lower proliferative response and production of IFN-{gamma} and IL-5 cytokines were obtained with cells from aged mice. Therefore, it appears that although Bp does not shift the response to a Th1 profile in young or aged mice, it does partially reverse the age-associated alteration in these cytokines, as less of these two cytokines is made in aged compared with young mice. It appears that Bp can at least have some affect on minimizing the age-associated shift. Therefore, although OVA is a strongly immunogenic antigen, Bp failed to mount an efficient, antigen-specific immune response in aged mice comparable with young mice. Related to this, we have previously reported that aged BALB/c mice exposure to T. cruzi antigens in Bp showed a lower immune response in terms of magnitude and quality compared with young mice [17 ]. When OVA/CFA was used, a polarization of the immune response toward Th1 was observed, characterized by the production of high levels of IFN-{gamma} and scarce levels of IL-5 (INF-{gamma}/IL-5>1) in both ages. CFA, due to its inflammatory side effects, cannot be used in humans, but it is an important adjuvant used in an experimental model, as it is highly effective in inducing a vigorous immune response. It is well known that in young mice, CFA elicited a Th1 response [18 ], and our findings showed that CFA also acts as a strong Th1 adjuvant in aged BALB/c mice. Following priming with OVA/CpG-DNA, the measurements of the cytokines synthesis by OVA-specific T cells have shown that a Th1-like profile was obtained (characterized by secretion of IFN-{gamma} and not detectable levels of IL-5). Thus, in aged mice CpG-DNA induced a Th1 response, demonstrating the ability of CpG-DNA to modulate T cell responses even under favorable conditions for the induction of a Th2 response. Altogether, CFA or CpG-DNA can induce a Th1-like response in aged mice. In the present study, we found lack of a OVA-specific proliferative response and cytokine production after injection of OVA/non-CpG-DNA, although the levels of specific IgG in plasma were comparable with those found after immunization with OVA/CpG-DNA. These findings are in accordance with the data found by Jakob et al. [25 ], which indicated that there is an immunostimulatory activity independent of the CpG sequence, which might possibly be associated with the phoshorothioate backbone of DNA.

At present, the mechanisms involved in polarization toward Th2 during aging are not known. The finding that CpG-DNA reverts this effect is an excellent tool to explore it. Probably CpG-DNA improves the aging-immune response by adequate activation of APC, as we found in in vitro studies where CpG-DNA is capable of activating aged APC to produce IL-12 and enhancement of the expression of costimulatory molecules in aged B cells. This is in accordance with previous studies demonstrating that the immunodulatory effect of CpG-DNA is associated with the secretion of cytokines, especially Th1-like cytokines such IL-12 and IL-18 by APC and the induction of costimulatory molecules in young mice [15 ]. Previously, it was reported that CpG-DNA directly activate young, murine B cells [28 ]. Our data demonstrate that CpG-DNA triggered a consistent up-regulation of CD80, CD86, and MHC class II surface molecules in aged B cells. Interestingly, CpG-DNA induced a higher expression of B7.1 in aged than in young B cells. Selective expression of B7.1 versus B7.2 has been shown in many models to preferentially influence Th1- and Th2-type responses, respectively [40 ]. Moreover, Chiaramonte et al. [41 ] have observed a role for B7-1 expression in the prophylactic inhibition of Th2 responses in CpG-treated animals. Although the mechanisms by which CpG-DNA restore the immune response in aged mice remain unclear, these results suggest that the expression of this molecule possibly contributes to the inhibition of Th2 activities in aged mice.

Under the light of recent results by Hemmi et al. [42 ], who reported that cellular response to CpG-DNA is mediated by a Toll-like receptor 9 in young mice, our further efforts are focused on elucidation of the exact cellular and molecular mechanisms that contribute to Th1-related responses after immunization with CpG-DNA on aged BALB/c mice.

In summary, we have demonstrated here that CpG-DNA immunization induces Th1 response, including significant, specific IgG2a antibodies and IFN-{gamma} production, as efficiently in aged as in young animals. This potent Th1 adjuvant effect of CpG-DNA can even override Th2 predisposition of aged individuals. Our results strongly emphasize the relevance of the experimental model in the development of immunotherapeutical strategies for vaccination during this stage of life and identify CpG-DNA as a strong and likely possible adjuvant to be used during aging.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by grants from the Consejo de Investigaciones Científicas y Tecnológicas de la Provincia de Córdoba, Secretaría de Ciencia y Técnica de la Universidad Nacional de Córdoba, Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Subsecretaría de Investigación y Tecnología del Ministerio de Salud de la República Argentina, and Fundación Alberto J. Roemmers. M. C. P-P. is a career member from CONICET.

Received January 4, 2002; revised April 17, 2002; accepted April 17, 2002.


arrow
REFERENCES
 
    1
  1. Globerson, A., Effros, R. B. (2000) Ageing of lymphocytes and lymphocytes in the aged Immunol. Today 21,515-521[Medline]
  2. 2
  3. Flurkey, K., Miller, R. A., Harrison, D. E. (1992) Cellular determinants of age-related decrements in the T-cell mitogen response of B6CBAF1 mice J. Gerontol. 47,B115-B120[Abstract]
  4. 3
  5. Miller, R. A. (1997) Age-related changes in T cell surface markers: a longitudinal analysis in genetically heterogeneous mice Mech. Ageing Dev. 96,181-196[Medline]
  6. 4
  7. Cossarizza, A., Ortolani, C., Paganelli, R., Barbieri, D., Monti, D., Sansoni, P., Fagiolo, U., Castellani, G., Bersani, F., Londei, M., Franceschi, C. (1996) CD45 isoforms expression on CD4+ and CD8+ T cells throughout life, from newborns to centenarians: implications for T cell memory Mech. Ageing Dev. 86,173-195[Medline]
  8. 5
  9. Shearer, G. M. (1997) Th1/Th2 changes in aging Mech. Ageing Dev. 94,1-5
  10. 6
  11. Ginaldi, L., De Martinis, M., D’Ostilio, A., Marini, L., Loreto, M. F., Corsi, M. P., Quaglino, D. (1999) The immune system in the elderly: I. Specific humoral immunity Immunol. Res. 20,101-108[Medline]
  12. 7
  13. Weksler, M. E. (2000) Changes in the B-cell repertoire with age Vaccine 18,1624-1628[Medline]
  14. 8
  15. Pistoresi-Palencia, M. C., Romero-Piffiguer, M., Ferro, M. E. (1991) Effect of aging on the autoimmune response to rat male accessory glands: deficit of I-E-positive peritoneal cells capable of inducing suppression Eur. J. Immunol. 21,1685-1689[Medline]
  16. 9
  17. Maletto, B. A., Gruppi, A., Moron, G., Pistoresi-Palencia, M. C. (1996) Age-associated changes in lymphoid and antigen-presenting cell functions in mice immunized with Trypanosoma cruzi antigens Mech. Ageing Dev. 88,39-47[Medline]
  18. 10
  19. Rópolo, A., Morón, V. G., Maletto, B., Pistoresi-Palencia, M. C. (2001) Diminished percentage of antigen bearing cells in the lymph nodes of immune aged rats Exp. Gerontol. 36,519-535[Medline]
  20. 11
  21. Lung, T. L., Saurwein-Teissl, M., Parson, W., Schonitzer, D., Grubeck-Loebenstein, B. (2000) Unimpaired dendritic cells can be derived from monocytes in old age and can mobilize residual function in senescent T cells Vaccine 18,1606-1612[Medline]
  22. 12
  23. Castle, S. C., Uyemura, K., Crawford, W., Wong, W., Makinodan, T. (1999) Antigen presenting cell function is enhanced in healthy elderly Mech. Ageing Dev. 107,137-145[Medline]
  24. 13
  25. Burns, E. A., Goodwin, J. S. (1997) Immunodeficiency of aging Drugs Aging 11,374-397[Medline]
  26. 14
  27. Gupta, R. K., Griffin, P., Chang, A. C., Rivera, R., Anderson, R., Rost, B., Cecchini, D., Nicholson, M., Siber, G. R. (1996) The role of adjuvants and delivery systems in modulation of immune response to vaccines Adv. Exp. Med. Biol. 397,105-113[Medline]
  28. 15
  29. Krieg, A. M. (2000) The role of CpG motifs in innate immunity Curr. Opin. Immunol. 12,35-43[Medline]
  30. 16
  31. Krieg, A. M., Wagner, H. (2000) Causing a commotion in the blood: immunotherapy progresses from bacteria to bacterial DNA Immunol. Today 21,521-526[Medline]
  32. 17
  33. Maletto, B., Gruppi, A., Pistoresi-Palencia, M. C. (1994) Aging: the cellular immune response against autologous and foreign antigens is affected before the humoral response Immunol. Lett. 40,243-250[Medline]
  34. 18
  35. Yip, H. C., Karulin, A. Y., Tary-Lehmann, M., Hesse, M.D, Radeke, H., Heeger, P. S., Trezza, R. P., Heinzel, F. P., Forsthuber, T., Lehmann, P. V. (1999) Adjuvant-guided type-1 and type-2 immunity: infectious/noninfectious dichotomy defines the class of response J. Immunol. 162,3942-3949[Abstract/Free Full Text]
  36. 19
  37. Dayan, M., Segal, R., Globerson, A., Habut, B., Shearer, G. M., Mozes, E. (2000) Effect of aging on cytokine production in normal and experimental systemic lupus erythematosus-afflicted mice Exp. Gerontol. 35,225-236[Medline]
  38. 20
  39. Wakikawa, A., Utsuyama, M., Wakabayashi, A., Kitagawa, M., Hirokawa, K. (1999) Age-related alteration of cytokine production profile by T cell subsets in mice: a flow cytometric study Exp. Gerontol. 34,231-242[Medline]
  40. 21
  41. Esser, C., Radbruch, A. (1990) Immunoglobulin class switching: molecular and cellular analysis Annu. Rev. Immunol. 8,717-835[Medline]
  42. 22
  43. Martin, R. M., Lew, A. M. (1998) Is IgG2a a good Th1 marker in mice? Immunol. Today 19,49[Medline]
  44. 23
  45. Del Prete, G. (1998) The concept of type-1 and type-2 helper T cells and their cytokines in humans Int. Rev. Immunol. 16,427-455[Medline]
  46. 24
  47. Seder, R. A., Paul, W. E. (1994) Acquisition of lymphokine-producing phenotype by CD4+ T cells Annu. Rev. Immunol. 12,635-673[Medline]
  48. 25
  49. Jakob, T., Walker, P. S., Krieg, A. M., Udey, M. C., Vogel, J. C. (1998) Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA J. Immunol. 161,3042-3049[Abstract/Free Full Text]
  50. 26
  51. Sparwasser, T., Koch, E. S., Vabulas, R. M., Heeg, K., Lipford, G. B., Ellwart, J. W., Wagner, H. (1998) Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells Eur. J. Immunol. 28,2045-2054[Medline]
  52. 27
  53. Chace, J. H., Hooker, N. A., Mildenstein, K. L., Krieg, A. M., Cowdery, J. S. (1997) Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12 Clin. Immunol. Immunopathol. 84,185-193[Medline]
  54. 28
  55. Krieg, A. M., Yi, A. K., Matson, S., Waldschmidt, T. J., Bishop, G. A., Teasdale, R., Koretzky, G. A., Klinman, D. M. (1995) CpG motifs in bacterial DNA trigger direct B-cell activation Nature 374,546-549[Medline]
  56. 29
  57. Ginaldi, L., De Martinis, M., D’Ostilio, A., Marini, L., Loreto, M. F., Martorelli, V., Quaglino, D. (1999) The immune system in the elderly: II. Specific cellular immunity Immunol. Res. 20,109-115[Medline]
  58. 30
  59. Matsui, S., Ahlers, J. D., Vortmeyer, A. O., Terabe, M., Tsukui, T., Carbone, D. P., Liotta, L. A., Berzofsky, J. A. (1999) A model for CD8+ CTL tumor immunosurveillance and regulation of tumor escape by CD4 T cells through an effect on quality of CTL J. Immunol. 163,184-193[Abstract/Free Full Text]
  60. 31
  61. Mosmann, T. R., Coffman, R. L. (1989) TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties Annu. Rev. Immunol. 7,145-173[Medline]
  62. 32
  63. Sedlik, C., Deriaud, E., Leclerc, C. (1997) Lack of Th1 or Th2 polarization of CD4+ T cell response induced by particulate antigen targeted to phagocytic cells Int. Immunol. 9,91-103[Abstract/Free Full Text]
  64. 33
  65. Constant, S. L., Bottomly, K. (1997) Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches Annu. Rev. Immunol. 15,297-322[Medline]
  66. 34
  67. Comoy, E. E., Capron, A., Thyphronitis, G. (1997) In vivo induction of type 1 and 2 immune responses against protein antigens Int. Immunol. 9,523-531[Abstract/Free Full Text]
  68. 35
  69. Hobbs, M. V., Weigle, W. O., Noonan, D. J., Torbett, B. E., McEvilly, R. J., Koch, R. J., Cardenas, G. J., Ernst, D. N. (1993) Patterns of cytokine gene expression by CD4+ T cells from young and old mice J. Immunol. 150,3602-3614[Abstract]
  70. 36
  71. Takayama, E., Seki, S., Ohkawa, T., Ami, K., Habu, Y., Yamaguchi, T., Tadakuma, T., Hiraide, H. (2000) Mouse CD8+ CD122+ T cells with intermediate TCR increasing with age provide a source of early IFN-gamma production J. Immunol. 164,5652-5658[Abstract/Free Full Text]
  72. 37
  73. Bandres, E., Merino, J., Vazquez, B., Inoges, S., Moreno, C., Subira, M. L., Sanchez-Ibarrola, A. (2000) The increase of IFN-gamma production through aging correlates with the expanded CD8(+high)CD28(-)CD57(+) subpopulation Clin. Immunol. 96,230-235[Medline]
  74. 38
  75. Hsieh, C. S., Macatonia, S. E., O’Garra, A., Murphy, K. M. (1995) T cell genetic background determines default T helper phenotype development in vitro J. Exp. Med. 181,713-721[Abstract/Free Full Text]
  76. 39
  77. DeKruyff, R. H., Mosmann, R. R., Umetsu, D. T. (1990) Induction of antibody synthesis by CD4+ T cells: IL 5 is essential for induction of antigen-specific antibody responses by TH2 but not TH1 clones Eur. J. Immunol. 20,2219-2227[Medline]
  78. 40
  79. Kuchroo, V. K., Das, M. P., Brown, J. A., Ranger, A. M., Zamvil, S. S., Sobel, R. A., Weiner, H. L., Nabavi, N., Glimcher, L. H. (1995) B7-1 and B7-2 costimulatory molecules activate differentially the Th1/Th2 developmental pathways: application to autoimmune disease therapy Cell 80,707-718[Medline]
  80. 41
  81. Chiaramonte, M. G., Hesse, M., Cheever, A. W., Wynn, T. A. (2000) CpG oligonucleotides can prophylactically immunize against Th2-mediated schistosome egg-induced pathology by an IL-12-independent mechanism J. Immunol. 164,973-985[Abstract/Free Full Text]
  82. 42
  83. Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., Akira, S. (2000) A Toll-like receptor recognizes bacterial DNA Nature 408,740-745[Medline]



This article has been cited by other articles:


Home page
Int ImmunolHome page
A. Pellegrini, N. Guinazu, M. P. Aoki, I. C. Calero, E. A. Carrera-Silva, N. Girones, M. Fresno, and S. Gea
Spleen B cells from BALB/c are more prone to activation than spleen B cells from C57BL/6 mice during a secondary immune response to cruzipain
Int. Immunol., December 1, 2007; 19(12): 1395 - 1402.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. A. Maletto, A. S. Ropolo, D. O. Alignani, M. V. Liscovsky, R. P. Ranocchia, V. G. Moron, and M. C. Pistoresi-Palencia
Presence of neutrophil-bearing antigen in lymphoid organs of immune mice
Blood, November 1, 2006; 108(9): 3094 - 3102.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
G. Sen, Q. Chen, and C. M. Snapper
Immunization of Aged Mice with a Pneumococcal Conjugate Vaccine Combined with an Unmethylated CpG-Containing Oligodeoxynucleotide Restores Defective Immunoglobulin G Antipolysaccharide Responses and Specific CD4+-T-Cell Priming to Young Adult Levels
Infect. Immun., April 1, 2006; 74(4): 2177 - 2186.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. Alignani, B. Maletto, M. Liscovsky, A. Ropolo, G. Moron, and M. C. Pistoresi-Palencia
Orally administered OVA/CpG-ODN induces specific mucosal and systemic immune response in young and aged mice
J. Leukoc. Biol., June 1, 2005; 77(6): 898 - 905.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maletto, B.
Right arrow Articles by Pistoresi-Palencia, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maletto, B.
Right arrow Articles by Pistoresi-Palencia, M. C.