* Departments of Pathology and
Neurology, University of Regensburg, Germany
Correspondence: Herbert Schwarz, Xenova Research Ltd., 310 Cambridge Science Park, Cambridge CB4 OWG, U.K. E-mail: herbert_schwarz{at}xenova.co.uk
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: antigen-presenting cells • hematoxylin/eosin • Staphylococcus aureus
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
FDC support B lymphocyte development and the humoral immune response in several ways. FDC have the capacity to retain the antigen on their surface in specialized structures called iccosomes, thereby providing a source for the selection of high-affinity clones [3 ]. They also express costimulatory molecules, which deliver antigen-nonspecific signals to the B lymphocytes [2 ]. Further, FDC participate in the elimination of B lymphocytes with low affinity antibodies [4 , 5 ].
Proliferation of preactivated B lymphocytes can be substantially increased by FDC [6 ]. For this costimulation, cell contact is required, and it is partly mediated by intercellular adhesion molecule-1 (ICAM-1) and lymphocyte function-associated antigen-1, expressed on FDC and B lymphocytes, respectively [7 ]. CD11a, CD11b, and the antigen 8D6 have also been shown to participate in the interaction of the two-cell populations [8 9 10 ]. Further, FDC express CD23 and interleukin (IL)-7, which induce differentiation of B lymphocytes to plasma cells and ensure their survival [11 , 12 ]. However, additional molecules are likely to play a role in FDC-mediated, B lymphocyte costimulation.
CD137 (ILA/4-1BB) is a member of the tumor necrosis factor (TNF) receptor family and is expressed on activated T lymphocytes [13 , 14 ]. Costimulation through CD137 delivers a potent, costimulatory signal to T lymphocytes, which is equivalent to and synergistic with the costimulatory signal through CD28 [15 ]. The CD137 signal enhances T lymphocyte activity, enabling the immune system to eliminate tumors in mice [16 ].
The CD137 ligand is expressed constitutively on B lymphocytes and other antigen-presenting cells (APC) [15 ]. Bidirectional signal transduction has been demonstrated for the CD137 receptor/ligand system. Immobilized but not soluble CD137 (sCD137) protein induces activation, prolongation of survival, and proliferation in primary monocytes, another class of APC [11 12 13 14 15 16 17 18 19 20 ].
Here we show that CD137 is expressed by FDC in germinal centers and that cross-linking the CD137 ligand on B lymphocytes enhances proliferation and Ig synthesis of B lymphocytes via reverse signaling. These data identify the CD137 receptor/ligand system as a potent regulator for B lymphocyte development and humoral immune responses.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
CD137-Fc fusion protein was produced in Chinese hamster ovary cells. After transfection with a CD137-Fc (ILA-IgG) expression vector, the cells were selected in 0.6 mg/ml geneticin [21 ]. CD137-Fc protein was purified from supernatants by protein A sepharose.
Cells and cell culture
The FDC-like cell line FDC-H1 was a generous gift from Dr. Feller, University of Lübeck (Germany). It is a hybrid cell line generated by a fusion of enriched FDC from human tonsils with the murine myeloma cell line SP2/0-Ag14 and constantly expresses surface antigens and a cytokine profile characteristic of FDC [22
].
Human peripheral blood mononuclear cells (PBMC) were isolated from buffy coats of healthy volunteers. Buffy coats were diluted with 2 equal volumes of phosphate-buffered saline (PBS), overlaid onto an equal volume of Histopaque (Sigma Chemical Co.), and spun for 20 min at 1200 g. PBMC, which accumulated as a white layer at the Percoll boundary, were recovered, and erythrocytes were lysed with 2 ml 200 mM NH4Cl, 10 mM NaHCO3, 10 mM ethylenediaminetetraacetate, pH 7.4, for 2 min at room temperature (RT). Cells were washed two times with PBS, pelleted at 250 g, and resuspended in RPMI, 5% fetal calf serum (FCS).
The B lymphocytes fraction (IB1) in PBMC was enriched by elutriation [23 ] and contained between 60% and 80% B lymphocytes as estimated by CD19 expression. The remaining cells were T lymphocytes as determined by CD3 expression.
Immunhistochemistry
Frozen tissue sections were fixed with 2% paraformaldehyde for 10 min. Endogenous peroxidases were inactivated by 2% hydrogen peroxide in methanol for 15 min. Unspecific staining was blocked by 3% dry milk in PBS for 30 min. Anti-CD137 (2 µg/ml; clone BBK-2, Biosource) or an isotype-control antibody (MOPC 21, Sigma Chemical Co.) in 3% dry milk was added overnight. Positive hybridization was detected by the ABC staining kit (DAKO) at 37°C using diaminobenzidine as substrate. After each step, the samples were washed three times with PBS. Tissue sections were stained with hematoxylin and embedded in Entellan (Merck, Darmstadt, Germany).
For double staining, frozen tissue sections were fixed with ice-cold acetone for 10 min, air-dried, and then rehydrated with PBS for 5 min. Anti-CD137 (2 µg/ml; clone BBK-2) and 2.8 µg/ml anti-FDC (DAKO) were added for 2 h at RT. Sections were incubated simultaneously with 13 µg/ml Cy3-conjugated goat anti-mouse IgM and 3.75 µg/ml fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (both from Jackson Laboratories, Bar Harbor, ME) for 1 h at RT. Subsequently, the sections were counterstained with 4 µg/ml Hoechst 33342 (Sigma Chemical Co.) for 30 min at 37°C. After each step, the sections were washed three times with PBS and were finally embedded with H-1000 (Linaris GmbH, Wertheim, Germany).
Reverse transcriptase-polymerase chain reaction (RT-PCR)
Total RNA was isolated using RNAzol B (Tel-Test, Inc., Friendswood, TX), and up to 5 µg RNA was reverse-transcribed in a 20 µl volume, using random hexanucleotide primers (50 µg/ml), 25 µM dNTP, 10 mM dithiothreitol, 200 units SuperScriptTMII RNaseH-RT (BRL, Eggenstein, Germany), and 20 units RNAsin (Roche, Mannhein, Germany) for 60 min at 42°C.
The RT reaction (2 µl) served as a template for the subsequent PCR, which was performed in a 20 µl volume with 1 unit Taq DNA polymerase (Roche), 200 µM dNTP, 1.5 mM MgCl2, 10 mM Tris, pH 8.3, 50 mM KCl, and 10 µM each primer. After a 5-min denaturation step at 94°C, the reaction proceeded in 35 cycles of 1 min at 94°C, 1 min at 60°C, and 1 min at 72°C, followed by 10 min at 72°C.
Primers used were: CD137 sense, 5' ATCATGGGAAACAGCTGTTACAAC, position, minus 3–21; CD137 antisense, 5' TGGTCCACAGACCACGTCCCTCTC, position, 480–457; G3PDH sense, 5' TGGTATCGTGGAAGGACTCATGAC; and G3PDH antisense, 5' ATGCCAGTGAGCTTCCCGTTCAGC.
Enzyme-linked immunosorbent assay (ELISA)
A specific ELISA using a matched set of IgM-specific antibodies and the protocol provided by the manufacturer (Pharmingen, Hamburg, Germany) was used to determine concentrations of IgM in cell supernatants. For coating, mouse anti-human IgM (clone JDC-15) at 2 µg/ml and for detection, mouse anti-human IgM biotin (clone G20-127) at 6 µg/ml were used. The concentration of sCD137 was determined as described previously [24
].
Cell proliferation
Proliferation of cell populations was determined in a 96-well microtiter plate. PBMC (2x105) or IB1 cells per well in a 100 µl volume were pulsed for 24 h with 0.5 µCi; 3H-thymidine at day 2 and were harvested and evaluated on the TopCount microplate scintillation counter (Packard, Meriden, CT). Each condition was performed in triplicate and depicted as means ± SD.
CFSE [5 (and 6-)-carboxyfluorescein diacetate succinimidyl ester] labeling
IB1 cells (1x107/ml) were washed three times with PBS. In dimethyl sulfoxide, CFSE (5 mM) was diluted to 5 µM in PBS and added to the cell for 10 min at 37°C. The reaction was stopped by adding 10% FCS-containing RPMI. The cells were washed two times in RPMI, 10% FCS.
Flow cytometry analysis
Cells were analyzed using a FACS-Calibur (Becton Dickinson, Mountain View, CA) and Cellquest software. One million cells were used per condition. Cells were washed in fluorescence-activated cell sorting (FACS) buffer (PBS, 2% FCS, 0.1% NaN3), resuspended in 50 µl FACS buffer, and stained with PE-conjugated anti-CD137 antibody, PE-conjugated isotype-control antibody (each 10 µg/ml), or PE-conjugated anti-CD20 antibody (dilution 1:25) for 30 min at 4°C. After two washes, cells were analyzed by flow cytometry.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
 View larger version (176K): [in a new window] |
Figure 1. CD137 expression in germinal centers. (A) Serial frozen sections of a human lymph node were stained with antibodies specific for CD137 and an isotype-control antibody (control). Staining with HE was used for a better visualization of the tissue. Photographs were taken at an original magnification of 50x. (B) Close-up photography of a single germinal center (upper) stained for CD137 (brown) and counterstained with hematoxylin (blue) and of the CD137-positive fiber-like extensions (lower). Photographs were taken at an original magnification of 200x.
|
 View larger version (115K): [in a new window] |
Figure 2. CD137 is expressed by FDC. (A) Serial frozen sections of a germinal center in a tonsil were stained with antibodies specific for CD137 (CD137), FDC (Wü), B lymphocytes (CD19), T lymphocytes (CD3), and an isotype-control antibody (control). Staining with HE was used for visualization of the tissue. Photographs were taken at an original magnification of 200x. (B) A frozen section of a tonsil was stained simultaneously with antibodies specific for CD137 (green) and FDC (red) and for chromatin (blue). Areas of colocalization appear yellow (upper left panel; superimposition). Photographs were taken at an original magnification of 400x.
|
The expression of CD137 in FDC was also confirmed using the FDC-derived cell line FDC-H1 [22 ]. RT-PCR revealed constitutive expression of CD137 mRNA (Fig. 3A ). In accordance with these mRNA data, strong expression of CD137 protein was found on FDC-H1 cells by flow cytometry, and CD137 levels on FDC-H1 cells were higher than those on activated PBMC (Fig. 3B) . Activated T lymphocytes can express membrane-bound as well as sCD137, the latter being encoded by differentially spliced mRNA isoforms [24 ]. No sCD137 could be detected in the supernatants of FDC-H1 cells by ELISA, and no splice forms were detected by RT-PCR (ref [24 ] and not shown).
 View larger version (32K): [in a new window] |
Figure 3. CD137 expression on FDC. (A) FDC-1 cells (106) were cultured for 16 h before expression of CD137 mRNA (upper panel) was evaluated by RT-PCR using the primers CD137-sense and CD137-antisense. The expected product is 460 bp. MWM, Molecular weight marker VI (Roche); H20, negative control; resting and activated (16 h, 20 ng/ml PMA+200 nM A23187) PBMC, negative and positive PCR controls, respectively. (B) CD137 cell surface expression on the FDC line FDC-H1 was assessed by flow cytometry. Cells (106) were used per condition, and the cells were not activated. White peak, solid line, Autofluorescence; white peak, stiched line, isotype control (mouse IgG, PE-conjugated); shaded peak, anti-CD137, PE-conjugated (clone 4B4-1).
|
 View larger version (36K): [in a new window] |
Figure 4. CD137 costimulates B lymphocyte proliferation. (A) Primary B lymphocytes (2x105) per well were activated by indicated concentrations of SAC or by anti-CD40 (5 µg/ml) + IL-4 (100 ng/ml) and were cultured on immobilized Fc or CD137-Fc protein (5 µg/ml). Cells were labeled at day 2 with 3H-thymidine, and proliferation was determined at day 3. Identical results were obtained in four independent experiments. (B) Primary B lymphocytes were labeled with CFSE, cultured on plates coated with CD137-Fc protein (5 µg/ml), and activated by SAC (1:1000). After 3 days, the cells were stained with anti-CD20 (left panel, y-axis). The forward-scatter (FSC-H1; x-axis) measures the size of the cells (the more to the right, the bigger). Cell blasts stain positive for CD20, a B lymphocyte-specific protein. The degree of cell division was determined by flow cytometry for the CD20-positive B lymphocytes (upper right panel) and the CD20-negative T lymphocytes (lower right panel). Shaded, filled, Nonactivated cells; solid, open, SAC-activated cells. Peaks marked by arrows represent cells that have completed one or two cell divisions since labeling. Identical results were obtained in three independent experiments.
|
 View larger version (14K): [in a new window] |
Figure 5. CD137 costimulates IgM synthesis. Primary B lymphocytes (2x105) were activated by SAC (1:105) and cultured on immobilized Fc or CD137-Fc protein (5 µg/ml). Supernatants were collected at day 10, and the concentration of IgM was determined by ELISA. Identical results were obtained in five independent experiments.
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The activities of CD137 and its ligand in B lymphocyte activation are reminiscent of that of a related receptor/ligand pair, also belonging to the TNF receptor and ligand families. The interaction of CD40 ligand on T lymphocytes with CD40 on B lymphocytes is essential for B lymphocyte expansion and the initiation of affinity maturation [25 ]. The CD40 receptor/ligand system mediates T lymphocyte help to B lymphocytes, which have encountered their specific antigen for the first time (Fig. 6 ). The B lymphocytes then migrate to germinal centers where they undergo affinity maturation and clonal selection. It can be hypothesized that at initial antigen encounter, the antigen is presented by the TCR of the helper T lymphocyte, and costimulation is provided by the CD40 receptor/ligand system. After somatic hypermutation of the complementary determining region, the second antigen encounter takes place on the surface of FDC in the form of iccosomes, and here, costimulation is mediated by the CD137 receptor/ligand system (Fig. 6) .
 View larger version (19K): [in a new window] |
Figure 6. Model of the CD40 and CD137 receptor/ligand systems in the costimulation of humoral immune responses.
|
B lymphocytes, which have generated higher affinity antibodies during affinity maturation will become positively selected and will expand and leave the germinal center. However, affinity maturation also generates B lymphocytes with lower affinity antibodies, and these B lymphocytes will be eliminated through apoptosis initiated by CD95 ligand on FDC [26 , 27 ]. As CD137 induces expression of CD95 in B lymphocytes [28 ], it is possible that CD137 also participates in the elimination of B lymphocytes with low affinity antibodies.
The absence of sCD137 in supernatants of the FDC-derived cell line FDC-H1 and the inability to detect the mRNA splice form encoding sCD137 indicate that FDC only express the membrane-bound isoform of CD137 but not sCD137. As sCD137 is antagonistic, FDC seem to use CD137 solely to deliver an activating signal to B lymphocytes. In contrast, T lymphocytes can express both CD137 isoforms and switch from expressing the agonistic membrane-bound CD137 to the antagonistic sCD137 when their activation status is very high, limiting immune reactions and avoiding activation-induced cell death [29 ].
During germinal center formation, FDC not only deliver but also receive signals. FDC express CD40, and their interaction with CD40 ligand-expressing T lymphocytes stimulates cytokine release by FDC [30 ]. CD137 ligand is expressed by B lymphocytes and other APC. At T and B lymphocyte interactions, T lymphocytes receive a costimulatory signal through CD137, which enhances proliferation and cytolytic activity [15 , 21 , 31 ]. It is therefore possible that FDC also receive a signal through their surface-expressed CD137 when they interact with B lymphocytes. Bidirectional transduction of costimulatory signals through the receptor as well as the ligand has also been described for the OX40, CD40, and CD30 receptor/ligand systems, three other members of the TNF receptor and ligand families [32 33 34 ].
CD137 not only enhances the activity of B lymphocytes: immobilized CD137 protein has been shown to induce activation, prolongation of survival, and proliferation of monocytes [17 18 19 20 ]. Therefore, reverse signaling through the CD137 ligand seems to be a general activating signal for APC. However, although the signal through CD137 was sufficient for activation of monocytes, it had no effect on B lymphocytes on its own, but CD137 enhanced the activity of preactivated B lymphocytes.
Recently, evidence of CD137 ligand-transducing signals into APC has also been obtained in vivo [35 ]. Constitutive expression of CD137 ligand on APC of transgenic mice led to the elimination of peripheral B cells and an increase in monocyte numbers. The augmentation of monocytes in vivo matches well the induction of monocyte proliferation by immobilized CD137 in vitro. However, the depletion of B cell stands seems to contrast our in vitro findings that CD137 ligand signaling enhances B cell proliferation and activity. The reason for this difference is not known. One possible explanation may be that the CD137 ligand signal is sufficient for monocytes to become activated and to proliferate, and the CD137 ligand signal is only costimulatory for B cells, and B cells require another signal (for example, through the B cell receptor). The CD137 ligand-transgenic mice have normal B cell numbers and functions up to the age of 3 months and develop B cell deficiencies only later in life. This indicates that only prolonged CD137 ligand signals may be deleterious for B cell numbers and functions.
Expression of CD137 in lymph follicles is easily detectable by immunhistochemistry, and strong staining signals are obtained in the FDC-containing light zone. This stands in contrast to activated T lymphocytes, from where human CD137 was originally cloned [13 ]. CD137-positive T lymphocytes are hardly detectable by immunhistochemistry, even in inflamed tissues, suggesting a significantly higher expression of CD137 on FDC compared with activated T lymphocytes. This is supported by the flow cytometry analysis of FDC, which shows about two order-of-magnitude higher staining with the anti-CD137 antibody compared with the isotype control (Fig. 2B) . In activated T lymphocytes, this difference was just one order of magnitude [21 , 29 ].
Only few cells were detected in germinal centers, which expressed CD137 and were not FDC (Fig. 2A) . However, activated T lymphocytes, which can express CD137, are present in significantly larger numbers in germinal centers. An explanation could be that only a limited number of T lymphocytes are specific for a certain antigen, and only those would interact with APC and receive activating signals. It may be that only these T lymphocytes, and only in a specific activation state, express CD137. A contributing factor could be that CD137 is expressed predominantly on CD8-positive T lymphocytes and to a lesser extent, on CD4-positive ones, which are the ones populating the germinal centers. The larger numbers of CD137-positive T lymphocytes found by flow cytometry likely reflect an artificial, in vitro situation where T lymphocytes were stimulated unspecifically by polyclonal activators.
Expression of CD137 was detected in most but not all lymph follicles. The most likely explanation for finding CD137-negative lymph follicles may be experimental coincidences, i.e., tissue sections, which were cut above or below the inner zone containing the FDC. Another possibility is that the negative follicles represent primary follicles where germinal centers are not yet formed. However, it cannot be ruled out that CD137 may not be expressed in every germinal center.
The CD137 receptor/ligand system has been associated with a cytotoxic immune response as a result of higher expression on CD8-positive T lymphocytes than on CD4-positive ones [36 ]. Also, anti-CD137 antibodies and recombinant CD137 ligand induce strong, cell-mediated, immune responses against tumors and allogeneic transplants [16 , 37 ]. The data presented here indicate that CD137 and its ligand also play an important role in humoral immune responses.
Received August 29, 2001; revised January 31, 2002; accepted February 6, 2002.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-transgenic mice J. Immunol. 167,2671-2676This article has been cited by other articles:
 |
|
 |
|
  D. Jiang, Y. Chen, and H. Schwarz CD137 Induces Proliferation of Murine Hematopoietic Progenitor Cells and Differentiation to Macrophages J. Immunol., September 15, 2008; 181(6): 3923 - 3932. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Jiang, P. S. E. Yue, D. Drenkard, and H. Schwarz Induction of Proliferation and Monocytic Differentiation of Human CD34+ Cells by CD137 Ligand Signaling Stem Cells, September 1, 2008; 26(9): 2372 - 2381. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. S. Olofsson, L. A. Soderstrom, D. Wagsater, Y. Sheikine, P. Ocaya, F. Lang, C. Rabu, L. Chen, M. Rudling, P. Aukrust, et al. CD137 Is Expressed in Human Atherosclerosis and Promotes Development of Plaque Inflammation in Hypercholesterolemic Mice Circulation, March 11, 2008; 117(10): 1292 - 1301. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sun and P. J. Fink A New Class of Reverse Signaling Costimulators Belongs to the TNF Family J. Immunol., October 1, 2007; 179(7): 4307 - 4312. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Drenkard, F. M. Becke, J. Langstein, T. Spruss, L. A. Kunz-Schughart, T. E. Tan, Y. C. Lim, and H. Schwarz CD137 is expressed on blood vessel walls at sites of inflammation and enhances monocyte migratory activity FASEB J, February 1, 2007; 21(2): 456 - 463. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Sun, S. E. Blink, J. H. Chen, and Y.-X. Fu Regulation of Follicular Dendritic Cell Networks by Activated T Cells: The Role of CD137 Signaling J. Immunol., July 15, 2005; 175(2): 884 - 890. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Schwarz Biological activities of reverse signal transduction through CD137 ligand J. Leukoc. Biol., March 1, 2005; 77(3): 281 - 286. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kirchner, S. Boldt, W. Kolch, S. Haffner, S. Kazak, P. Janosch, E. Holler, R. Andreesen, and G. Eissner LPS resistance in monocytic cells caused by reverse signaling through transmembrane TNF (mTNF) is mediated by the MAPK/ERK pathway J. Leukoc. Biol., February 1, 2004; 75(2): 324 - 331. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
