




* Departments of Medical,
Pathobiological, and
Comparative Bio-Sciences, School of Veterinary-Medicine, and
Department of Biomolecular Chemistry, University of Wisconsin, Madison
Correspondence: Dr. Benjamin J. Darien, Department of Medical Sciences, School of Veterinary-Medicine, University of Wisconsin, Madison, WI 53706-1102. E-mail: darienb{at}svm.vetmed.wisc.edu
|
|
|---|
B in human monocytes and in THP-1 human monocytic cells. Furthermore, treatment of monocytes with BzATP induced the expression of cyclooxygenase-2 (COX-2) and tissue factor, which are two important endpoints that have not been previously shown to be regulated by nucleotide receptor action in monocytes. Together, these data indicate that a subpopulation of human monocytes express P2X7 receptors that are functional with respect to pore formation, signal transduction, and mediator production, further supporting a key role for this nucleotide receptor in host immune responses.
Key Words: extracellular nucleotides YO-PRO COX-2 tissue factor NF-
B
|
|
|---|
629 Daltons). Human monocytes and macrophages constitute an important line of defense upon infection and exposure to inflammatory stimuli [9 ]. Circulating blood monocytes become activated, migrate to tissues, and undergo differentiation into macrophages during inflammation [10 ]. The molecular changes that occur in monocytes during differentiation have been studied extensively, and numerous alterations in gene expression and the activation of signaling proteins have been demonstrated [11 ]. Monocytes have been shown to express several P2Y receptors, whereas macrophages also express elevated levels of the P2X7 receptor. Up-regulation of P2X7 receptor mRNA in monocytes has been observed upon cell differentiation to macrophages [6 , 8 , 12 13 14 15 ].
Although the specific mechanisms of signal transduction used by the P2X7 receptor are poorly understood in monocytes/macrophages, activation of several downstream signaling molecules has been shown upon P2X7 receptor activation in macrophages [16
17
18
19
]. One of these signaling events is the stimulation of several mitogen-activated protein kinases (MAPKs; ERK1/ERK2 and p38), which play an important role in a variety of pathophysiological responses critical for inflammation and tissue remodeling. MAPKs are differentially activated by growth factors, cytokines, and cellular stress, and are known to control gene expression and various cellular regulatory events such as differentiation and survival [20
]. Stimulation of the P2X7 receptor with ATP has been shown to activate MAPKs in macrophages as well as induce the nuclear translocation of the transcription factor, nuclear factor-
B (NF-
B) in microglial cells [16
17
18
, 21
22
23
]. The nuclear translocation of NF-
B can be regulated by proteosome-mediated degradation of its inhibitory subunit, I
B, which sequesters NF-
B basally in the cytosol [24
]. Upon degradation of I
B
, NF-
B is free to enter the nucleus and promote gene transcription. The observation that ATP can promote the nuclear translocation of NF-
B links P2X7 receptor action with the control of gene expression, because NF-
B is responsible for inducing the transcription of numerous genes, including inflammatory cytokines, cyclooxygenase-2 (COX-2), and tissue factor [25
].
Monocytes and macrophages share the ability to produce interleukin-1ß (IL-1ß) [11 ], which is central for a variety of immunological activities. In addition, IL-1ß release can act in an autocrine manner and leads to the activation of other proinflammatory genes that further contribute to the process of inflammation [26 ]. IL-1ß is present in the cytosol as an inactive, 31-kDa procytokine precursor that is cleaved by the IL-1-converting enzyme (caspase-I) to generate the active 17 kDa form [27 ]. Activation of the P2X7 receptor is associated with an increase in IL-1ß processing in lipopolysaccharide (LPS)-treated monocytes and macrophages [11 , 27 , 28 ].
Monocytes and macrophages present a hemostatic barrier during infection and are recruited to the sites of tissue damage and inflammation upon tissue injury [10 ]. In the event of inflammation as a result of cell lysis, very high concentrations of ATP (mM range) are present in the microenvironment of the inflamed region [9 ]. These high levels of ATP have been proposed to orchestrate the cascades that lead to inflammatory mediator production including eicosanoids and tissue factor. The synthesis of the prostaglandin E2 involves the action of the enzyme COX-2 [29 30 31 32 33 34 ], which is in turn regulated in response to a variety of stimuli [35 ]. LPS and ATP have been shown to induce COX-2 synthesis via activation of P2Y receptors in peripheral blood monocytes/macrophages [36 ]. Furthermore, the P2X7 receptor has also been implicated in the LPS-mediated release of arachadonic acid by ATP in macrophages [37 , 38 ]. Monocytes also express tissue factor (coagulation factor III, CD142), a cell surface protein that initiates the blood coagulation system upon stimulation with pathogens [39 ]. The process of inflammation has been linked recently with the expression of tissue factor in monocytes and macrophages in response to LPS [39 ]. Although tissue factor is absent from cells in contact with plasma, monocytes can be induced to express cell surface tissue factor by various inflammatory mediators [40 ]. Up-regulation of tissue factor has been implicated in thrombotic disorders, tumor biology, angiogenesis, metastasis, and mediating outside-in signaling [41 ]. However, the role of the P2X7 receptor in the generation of tissue factor is not known.
Although monocytes have been shown to release IL-1ß upon stimulation with LPS and adenine nucleotides (P2X7 agonists) [17
, 22
, 23
, 42
], their capacity to express functional P2X7 receptor is not clear [13
, 14
, 43
]. Human THP-1 monocytic cells have been shown to express low levels of P2X7 receptor mRNA that can be substantially up-regulated upon the induction of cellular differentiation into macrophages with interferon-
, tumor necrosis factor
(TNF-
), or LPS [13
, 21
, 43
]. Higher levels of P2X7 receptor mRNA in differentiated THP-1 cells have been hypothesized to translate into increased protein expression, although a direct relationship has not been shown in primary human monocytes [14
]. As monocytes have been shown to express little or inactive P2X7, but are able to respond to ATP by producing IL-1ß, we hypothesized that a definable subpopulation of blood monocytes express functional P2X7 receptors and therefore undertook experiments to evaluate P2X7 receptor expression and function in freshly isolated human monocytes.
|
|
|---|
Cell isolation and culture
Heparinized blood was drawn from healthy adult volunteers at the University of Wisconsin (UW) Hospitals and Clinics (Madison) in compliance with the requirements of the UW Health Sciences, Human Subjects Committee protocol. Peripheral blood mononuclear cells (PBMC) were isolated from buffy coats and were separated subsequently by gradient centrifugation as described previously [44
]. Isolated monocytes were washed and resuspended in RPMI with 10% human AB+ serum. Monocytes were plated in Costar tissue-culture dishes (Corning, NY) and were allowed to adhere at 37°C in a humidified atmosphere at 5% CO2 for 2 h, and nonadherent cells were removed by replacing the medium only in experiments examining MAPKs, I
B
, NF-
B, COX-2, and IL-1ß. Cell viability was determined by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay and trypan blue exclusion [45
, 46
] (unpublished results). More than 99% cells were typically found to be viable, and >95% of the cells isolated were identified as monocytes, as evidenced by morphologic, cytological evaluation, and nonspecific esterase staining.
Flow cytometry
Freshly isolated PBMC (obtained within 1 h of drawing donor blood) were washed twice and resuspended in phosphate-buffered saline (PBS) with 1% cosmic calf serum to examine the expression of the cell-surface proteins. To determine YO-PRO uptake by monocytes, freshly isolated cells were resuspended in the fluorescein-activated cell sorter (FACS) buffer (130 mM NaCl, 5 mM KCl, 20 mM HEPES, pH 7.4, 1 mM glucose, and 0.1% bovine serum albumin). Forward- and side-scatter were used to distinguish the monocytes, lymphocytes, and cell debris on the flow cytometer (FACScan, Becton Dickinson, San Jose, CA). Cell viability was determined to be approximately 99%, based on cellular uptake of propidium iodide. For each assay, at least 3 x 105 cells were used, and 10,000 monocyte events were acquired by gating-out cells positive for propidium iodide. The geometric mean fluorescence intensity (MFI) for each histogram was used to quantify the expression of cell surface markers and YO-PRO uptake. Monocytes were double stained with the P2X7 mAb directed against the extracellular domain of the P2X7 receptor (0.5 µg/mL) or with the isotype-control antibody IgG2b (0.5 µg/mL) on ice for 30 min and were also labeled with the polyclonal CD14 antibody (0.5 µg/mL) or the isotype-control antibody IgG2 (0.5 µg/mL). The cells were labeled using constant agitation and were then washed once with PBS. In some cases, magnetic beads coupled to anti-CD14 (Miltenyi Biotech Inc., Auburn, CA) were used to isolate monocytes (according to the manufacturers protocol) as a parallel approach for determining the expression levels of the P2X7 receptor on monocytes.
After incubating the cells for 30 min on ice with the fluorescein isothiocyanate (FITC)-labeled goat anti-mouse and R-phycoerytherin (R-PE)-labeled goat anti-rabbit secondary antibodies (0.5 µg/mL), the cell-associated fluorescence was assessed by flow cytometry. The cells were washed once and resuspended in PBS. For determining YO-PRO uptake, PBMC were treated with YO-PRO (2 µM) and with or without BzATP (250 µM) for 15 min at 37°C. Some cells were preincubated for 2 h with the P2X7 receptor antagonist oATP (250 µM) or for 30 min with the P2X7 receptor antagonist KN-62 (300 nM). Monocytes suspended in buffer alone served as a control, whereas cells incubated with YO-PRO (15 min) were used as a baseline for quantifying the MFI. Cells were washed once, resuspended in PBS, and subjected immediately to FACS analysis.
Immunoprecipitation and immunoblotting
Freshly isolated human monocytes or cells from the human monocytic cell line, THP-1 (plated overnight), were lysed in radioimmunoprecipitation assay buffer [1% Nonidet P-40, 0.25% deoxycholate, 1 mM Na3VO4, 1 mM phenylmethysulfonyl fluoride, 1 µg/ml leupeptin, 1 µg/ml aprotinin, 1 mM ethylenediaminetetraacetate (EDTA), 1 mM ethyleneglycol-bis(ß-aminoethylether)-N,N'-tetraacetic acid, 150 mM NaCl, 10 mM Tris, pH 8.0]. Cell lysates were precleared with protein G-conjugated agarose beads and then immunoprecipitated with the mAb against the extracellular region of the P2X7 receptor or with nonspecific mouse IgG2b antibodies followed by incubation with protein G-conjugated agarose beads. The immunoprecipitates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the proteins were transferred to a polyvinylidene difluoride (PVDF) membrane. The membrane was blocked in 5% nonfat milk/Tris-buffered saline/Tween 20 (TBST) for 1 h at 37°C, and the expression of the P2X7 receptor was determined by immunoblotting the membrane for 16 h at 4°C with the polyclonal P2X7 receptor antibody. After being washed 3 times with TBST, the blots were incubated for 1 h at 37°C with horseradish peroxidase-conjugated anti-rabbit secondary antibodies and were then washed at room temperature. The bound antibodies were visualized using the Lumi-Glo chemiluminescent detection method (Kirkegaard and Perry Labs, Gaithersburg. MD).
For immunoblotting analyses, monocytes (35x106 cells) were plated in six-well culture dishes and allowed to adhere for 2 h. The cells were washed once with PBS, and whole cell lysates were prepared by lysing monocytes in SDS-PAGE sample buffer without bromophenol blue [20 mM Tris, 2 mM EDTA, 1 mM Na3VO4, 2 mM dithiothreitol (DTT), 2% SDS, and 20% glycerol; ref. 47
]. Protein content was determined using Micro-BCA protein assay (Pierce Biochemical Company, Rockford, IL). Equal amounts of protein (
50 µg/lane) were loaded per lane and resolved by 10% SDS-PAGE [47
]. Proteins were transferred to Immobilon PVDF membranes (Millipore Corp., Bedford, MA), and the membranes were blocked overnight in 5% dry, nonfat milk/TBST (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.05% Tween 20) at 4°C or were blocked for 1 h at 37°C. Expression of the P2X7 receptor was determined via immunoblotting with a polyclonal anti-P2X7 receptor (1.5 µg/mL) antibody. Anti-active ERK antibodies that recognize the dually (serine/threonine) phosphorylated and active forms of ERK1/ERK2 were used at a dilution of 1:5000. Anti-active p38 antibodies and COX-2 mAb were used at a final dilution of 1:2000. To measure the degradation of I
B
, anti-I
B
, antibodies were used at a final dilution of 1:1000. The immunoreactive bands were visualized using standard protocols as indicated above. Equal protein loading was confirmed by stripping the membranes at 70°C for 30 min in stripping buffer [62.5 mM Tris-HCl (pH 6.7), 2% SDS, and 100 mM DTT]. The immunoblots were blocked again in 5% nonfat milk and reprobed with anti-ERK1/2 antibodies that recognize active and inactive forms of both proteins. Bound antibodies were visualized using chemiluminescence detection. Each experiment was replicated at least three times using separate blood donors.
Electrophoretic mobility shift assay (EMSA)
Nuclear extracts for determining the nuclear translocation of the transcription factor NF-
B were prepared as described previously [19
, 48
]. Briefly, monocytes were plated at 1 x 107 cells/well, incubated overnight in six-well plates, and incubated in media (20 mM HEPES) alone or treated with LPS (1000 ng/mL; 120 min) or BzATP (100 µM; 60 min). Some samples were pretreated with KN-62 (3 µM) for 30 min. A double-stranded oligonucleotide containing two consensus NF-
B binding sites (5' GATCCAAGGGACTTTCCATGGATCCAAGGGGACTTTCCATG 3') was end labeled with
-[32P]-ATP using T4 polynucleotide kinase. Labeled oligonucleotide (105 counts per min) was incubated with 10 µg nuclear extract protein for 20 min. The proteins were then separated on a 6% nondenaturing polyacrylamide gel and analyzed by autoradiography.
Measurement of cytokine release
To determine the levels of IL-1ß production, freshly isolated human monocytes and THP-1 cells (1x106) were cultured in 12-well plates. Cells were treated with LPS (100 and 1000 ng/mL) and BzATP (100 µM) for 6 h. Subsequently, the medium was removed and assayed for IL-1ß release, according to the manufacturers protocol. This assay measures the processed and immature forms of IL-1ß.
Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis
Total RNA was purified from monocyte samples, and 1 µg was used to prepare cDNA as described previously [49
]. Quantitative RT-PCR analysis for tissue factor was performed by monitoring in real time the increase in fluorescence of the SYBR-green dye using the TaqMan 5700 sequence detection system (Perkin Elmer, Foster City, CA) as outlined earlier [50
, 51
]. Relative amounts of each gene in the samples were determined using a standard curve of serial dilutions of the cDNA containing the highest amount of the gene. These values were then normalized to the relative amounts of 18S cDNA, which were obtained from a similar standard curve. The following primers were used for tissue factor: CTCCCCAGAGTTCACACCTTCC and AACATCCCGGAGGCTTAGGA. Each experiment was replicated at least three times using separate blood donors.
|
|
|---|
![]() View larger version (20K): [in a new window] |
Figure 1. Detection of the P2X7 receptor in human monocytes by flow cytometry. Freshly isolated peripheral blood monocytes were incubated with 0.5 µg/mL polyclonal CD14 or the anti-P2X7 receptor mAb or the respective rabbit or mouse isotype control antibodies. The primary antibodies were detected by staining with 0.5 µg/mL PE-tagged goat anti-rabbit (GARPE) and FITC-labeled goat anti-mouse antibodies (GAMFITC) and were analyzed by flow cytometry. At least 10,000 live monocyte events were recorded. Live and dead cells were distinguished by gating out the cells that stained positive with propidium iodide (dead cells). The data are representative of results obtained from five different experiments.
|
![]() View larger version (18K): [in a new window] |
Figure 2. Immunodetection of the P2X7 receptor in human monocytes. (A) Whole cell lysates obtained from freshly isolated human monocytes (50 µg protein/lane) and rat brain cells (Rat Pituitary WCL; 20 µg protein/lane) were resolved by SDS-PAGE. The proteins were then transferred to a PVDF membrane and were immunoblotted with a polyclonal anti-P2X7 receptor antibody (Chemicon International Inc.) as detailed in Materials and Methods. (B) Human THP-1 cells and freshly isolated human monocytes were lysed, and 1 µg anti-human P2X7 receptor mAb or the isotype-control antibody IgG2b was used for immunoprecipitation. The immunoprecipitates were subjected to SDS-PAGE and immunoblotted with a polyclonal anti-P2X7 receptor antibody as described in Materials and Methods. Whole cell lysates from rat brain membrane (Rat Brain WCL) were used as positive controls. Analogous results were obtained in three separate experiments.
|
![]() View larger version (35K): [in a new window] |
Figure 3. Effect of P2X7 receptor antagonists on BzATP-induced YO-PRO uptake in human monocytes. Freshly isolated human PBMC were preincubated with the P2X7 receptor antagonists oATP (250 µM) for 2 h (A) or KN-62 (300 nM) for 30 min (B) in RPMI supplemented with 10% human serum. The PBMC were then treated with or without BzATP (250 µM) and YO-PRO (2 µM) for 15 min at 37°C and were followed by analysis using flow cytometry. Human monocytes exposed to buffer alone served as a control, whereas cells incubated with YO-PRO alone (15 min) were used as a baseline for quantifying agonist-induced increases in the MFI. For each treatment, at least 10,000 events were recorded. Live and dead cells were distinguished by gating out the cells positive with propidium iodide. These experiments were performed using cells obtained from multiple donors.
|
Mechanisms of signal transduction
Because these data support the hypothesis that a population of monocytes express functional P2X7 receptors in terms of pore formation, we evaluated whether additional signaling events are activated in monocytes following exposure to P2X7 receptor agonists. Human monocytes and THP-1 cells were stimulated with BzATP, and the activation of the ERK1 (p44)/ERK2 (p42) and p38 isoforms of the MAPKs was assessed by immunoblotting using phosphorylation state-specific antibodies (Fig. 4A
4B
4C
). As shown in Figure 4A , intermediate concentrations of BzATP (100250 µM) induced the peak activation of ERK1/ERK2 within 5 and 15 min of ligand exposure in monocytes (the time range was donor-dependent). THP-1 cells appeared more sensitive to lower levels of BzATP than freshly isolated monocytes because 50 and 100 µM BzATP resulted in the peak activation of ERK1/ERK2 (Fig. 4B)
and p38 (Fig. 4C)
within 5 min of treatment of THP-1 cells (Fig. 4B)
.
![]() View larger version (34K): [in a new window] |
Figure 4. BzATP induces the activation of MAPK in a time- and dose-dependent manner in human monocytes and human THP-1 cells. (A) Human monocytes were treated for various time points with 250 µM BzATP as indicated in the figure, the cells were harvested, and cell lysates were resolved by SDS-PAGE. Human monocytes were also stimulated with varying concentrations of BzATP for 15 min, the cells were then harvested and lysed, and the proteins were electrophoresed by SDS-PAGE. The proteins were transferred to PVDF membranes and subjected to immunoblotting using anti-active ERK1/ERK2 antibodies as detailed in Materials and Methods. (B) Similarly, human monocytic THP-1 cells were treated with 100 µM BzATP for times indicated in the figure, and in a separate experiment, THP-1 cells were treated with varying concentrations of BzATP for 10 min. The cells were harvested, and the lysates were subjected to SDS-PAGE. Protein content of the samples was analyzed by Micro-BCA protein assay. The proteins were transferred to PVDF membrane and immunoblotted using anti-active ERK1/ERK2 antibodies (C). THP-1 cells were treated with 100 µM BzATP for the indicated times, the cells were harvested, and the lysates were electrophoresed by SDS-PAGE. The proteins were transferred to PVDF membrane and subjected to immunoblotting using an anti-active p38 antibody as detailed in Materials and Methods. The proteins on the membranes were detected using enhanced chemiluminescence. Similar results were obtained in experiments using monocytes from five different donors.
|
![]() View larger version (39K): [in a new window] |
Figure 5. Inhibition of BzATP-induced activation of ERK1/ERK2 in human monocytes and THP-1 cells by P2X7 receptor antagonists. (A) Human monocytes were pretreated with various concentrations of the P2X7 receptor antagonist KN-62 for 30 min, followed by stimulation with BzATP (250 µM) for 10 min. The cells were then harvested and lysed, and equal amounts of protein (50 µg/lane) were resolved by SDS-PAGE and transferred to PVDF membranes. The membranes were immunoblotted with anti-active ERK1 and ERK2 antibodies as outlined in Materials and Methods. (B) Human THP-1 cells were pretreated for 2 h with oATP (B) or with KN-62 for 30 min (C) and were subsequently stimulated with BzATP or PMA for 10 min. Cells were harvested, and the lysates were resolved using SDS-PAGE. The proteins were transferred to PVDF membranes, and immunoblotting was performed using anti-active ERK1/ERK2 antibodies as detailed in Materials and Methods. Equal protein loading was determined by stripping and reprobing the same membranes with an antibody that recognized total ERK1/ERK2. The proteins on the membrane were detected using enhanced chemiluminescence. These experiments were repeated at least three separate times with analogous results.
|
B
, which is an inhibitory protein that binds to and sequesters the transcription factor NF-
B in the cytoplasm. Human THP-1 cells were treated with 100 ng/mL LPS for 15 min (as a positive control) or the indicated concentrations of BzATP for 10 min. As illustrated in Figure 6
, treatment of THP-1 cells with BzATP or LPS promoted the rapid degradation of I
B
, again suggesting that at least a portion of the P2X7 receptors on monocytes are functional. As another approach to assess the influence of P2X7 receptor antagonists on the NF-
B-I
B system, we examined the nuclear translocation of the NF-
B in response to stimulation with BzATP using gel mobility shift assays. Monocytes were pretreated with the P2X7 receptor antagonist KN-62 followed by treatment with BzATP for 30 min, and nuclear fractions were prepared (Fig. 6B) . LPS was used as a positive control. BzATP induced the nuclear translocation of NF-
B, and this activity was reduced substantially in monocytes pretreated with KN-62 (Fig. 6B)
. The nuclear translocation of NF-
B stimulated by 100 µM BzATP was abrogated by oATP at all time points measured (data not shown), further supporting the notion that the P2X7 receptor can mediate the degradation of I
B
and the nuclear translocation of the transcription factor NF-
B in monocytes.
![]() View larger version (34K): [in a new window] |
Figure 6. BzATP induces the degradation of I B in THP-1 cells and the nuclear translocation of the NF- B in human monocytes. (A) THP-1 cells were treated with 50 µM or 100 µM BzATP for 10 min or with 1 µg/mL LPS for 15 min, the cells were harvested, and lysates were prepared as described in Materials and Methods. The lysates (equal amounts of protein) were subjected to SDS-PAGE, and the levels of I B were immunodetected using I B -specific antibodies. (B) Human monocytes were pretreated with KN-62 for 30 min and were followed by stimulation with the P2X7 receptor agonist BzATP (100 µM) for 30 min or with 1 µg/mL LPS for 60 min. The LPS-treated cells were used as a positive control for determining the nuclear translocation of NF- B. Nuclear extracts were prepared as outlined in Materials and Methods. NF- B-specific DNA protein-binding activity in nuclear extracts was determined using an EMSA and analyzed by autoradiography. Similar results were obtained in three separate experiments.
|
![]() View larger version (14K): [in a new window] |
Figure 7. Effect of BzATP on the modulation of IL-1ß production in human monocytes. (A) Freshly isolated human monocytes and (B) THP-1 cells (1x106) were cultured in 12-well plates treated with vehicle (V) or various concentrations of LPS (L; 100 and 1000 ng/mL) and/or 100 µM BzATP (Bz; 50 or 100 µM) for 6 h. The medium was assayed for the processed and immature forms of IL-1ß according to the manufacturers protocol. The data are expressed as the mean (pg/mL) ± SD of samples that were measured in triplicate.
|
![]() View larger version (12K): [in a new window] |
Figure 8. Effect of BzATP on the expression of inducible COX-2 and tissue factor in human monocytes. To determine the induction of COX-2, human monocytes from a single donor were treated with 100 µM BzATP for 4 h. Whole cell lysates were prepared, and equal amounts of protein ( 30 µg/lane) were resolved by SDS-PAGE and transferred to PVDF membranes. The membranes were immunoblotted with anti-COX-2, and the bands were visualized using chemiluminescence. Densitometry was performed on the COX-2 immunoblots to quantify the relative levels of the enzyme following treatment with BzATP. To assess the expression of tissue factor, human monocytes were treated for 2 h with 100 µM BzATP, total RNA was purified from samples, and quantitative RT-PCR analysis was performed using the TaqMan 5700 sequence detection system (Perkin Elmer). The results shown are representative of experiments performed on cells obtained from three separate donors. The data are expressed as the mean (pg/mL) ± SD of the samples measured in triplicate.
|
|
|
|---|
B, are activated by an agonist of this purinergic receptor. In addition, stimulation of monocytes with the P2X7 receptor agonist BzATP modulated the release of the proinflammatory cytokine IL-1ß and the expression of COX-2 protein and tissue factor mRNA.
Signaling via ERK1/ERK2, p38, and NF-
B has been implicated in regulating the expression/action of various cytokines and mediators (nitric oxide, IL-1ß, and TNF-
) during inflammation, and their excessive production can ultimately lead to cell and tissue damage [17
, 19
, 22
, 23
, 28
, 42
]. Although the biophysical characteristics of the P2X7 receptor have been studied more extensively [7
, 63
], few studies evaluate the physiological effects and mechanisms of signal transduction by this receptor. The distribution of the P2X7 receptor has largely been inferred by cell-permeability studies and RT-PCR analyses of cultured monocytes/macrophages, dendritic cells, and mast cells [43
, 61
, 64
, 65
]. Therefore, the present studies were undertaken to examine the potential, functional role of the P2X7 receptor in orchestrating pore formation, signal transduction, and inflammatory mediator production in freshly isolated human monocytes.
Freshly isolated monocytes were previously reported to express low levels or immature forms of the P2X7 receptor [21
, 43
]. However, upon exposure to PMA or LPS and 1
,25-dihydroxycholecalciferol (vitamin D3), they have been found to express the mature form of the receptor [14
]. Very recent studies conducted on human monocytes, however, have indicated that approximately 70% of blood monocytes express the P2X7 receptor on the cell surface [66
67
68
69
], which are observations consistent with our findings described here. Furthermore, upon differentiation of monocytes into macrophages, no difference in levels of P2X7 mRNA was detected, although a tenfold increase in macrophage-surface P2X7 levels was observed [66
]. In the present study, we have demonstrated the expression of the P2X7 receptor protein at the cell surface in monocytes by flow cytometry. Given the recent availability of P2X7 receptor antibodies suitable for immunoblotting, we have also substantiated that a large population of freshly isolated human monocytes and human monocytic THP-1 cells express immunodetectable P2X7 receptors.
Earlier studies have indicated that freshly isolated monocytes, when stimulated with various concentrations of ATP in the standard saline buffer, do not take up substantial amounts of YO-PRO [18 , 28 , 43 , 61 , 66 , 70 ], suggesting that P2X7 receptor-associated pore activity is absent in these cells. We conducted similar experiments and confirmed that little cellular accumulation of YO-PRO occurs in response to various concentrations of ATP (2 and 5 mM). However, studies conducted by Gudipaty et al. [66 ] reveal that monocytes could form a pore in response to ATP when the Na+ and Cl- ions in normal saline were replaced by K+ and nonhalide ions. After extending these findings, we observed that monocytes can exhibit the cellular accumulation of YO-PRO in the standard saline buffer when the cells are treated with BzATP rather than ATP. One potential explanation for this difference is that BzATP is more resistant to degradation than ATP or that it is more effective at stabilizing an active conformation of P2X7. Moreover, as a control for the specificity of BzATP, monocytes were also stimulated with the P2Y2 receptor agonist, UTP. Treatment with UTP did not result in intracellular accumulation of YO-PRO, thereby making it unlikely that P2Y2 receptors mediate dye uptake or pore formation (data not shown).
Numerous studies describe the importance of MAPKs and NF-
B in the modulation of inflammatory mediator production in macrophages; however, little data exist about the roles of these effector molecules in the P2X7-mediated regulation of monocytes function. Thus, we first undertook studies to investigate the ability of the P2X7 receptor to stimulate MAPK signal transduction pathways in monocytes. Our results indicate that the MAPKs ERK1/ERK2 and p38 are stimulated strongly in monocytes in response to BzATP treatment, suggesting that the P2X7 receptor is functional with respect to signaling capacity in monocytes and that these pathways may play a role in nucleotide modulation of cytokine production.
Secondly, the present study reveals that stimulation of human blood monocytes with BzATP promotes NF-
B DNA binding activity and that the P2X7 receptor antagonist KN-62 substantially abolishes this activity. Because NF-
B is essential for the inducible expression of genes associated with inflammation and because it is regulated by the degradation of an inhibitory protein I
-B, it was also important to evaluate the influence of P2X7 activation on I
B degradation. In human monocytes, treatment with BzATP induces the degradation of I
B
(Fig. 6A)
. This result is of interest because P2X7 receptor stimulation has not been previously shown to result in the degradation of any I
B proteins, although NF-
B is activated in human macrophages [17
, 22
, 23
].
In addition to these signaling pathways, we have shown that P2X7 agonists can also promote IL-1ß release into the medium when the monocytes are cotreated with LPS. These results are also supported by other studies indicating the modulation of IL-1ß production by BzATP [27 , 28 , 42 , 71 ]. However, we have further investigated the function of the P2X7 receptor in human monocytes by evaluating the induction of COX-2, which is an important enzyme, in eicosanoid biosynthesis, induced in monocytes upon infection [72 ]. The P2Y nucleotide receptors have been shown to modulate COX-2 induction in macrophages [36 ], but there are no studies indicating the role of the P2X7 receptor in regulating this endpoint. It is noteworthy that our studies in human monocytes are the first to indicate that stimulation of the P2X7 receptor by concentrations of BzATP in the low micromolar range (100 µM) can promote an increase in the expression of the enzyme COX-2.
Another factor that plays a crucial role during sepsis in terms of initiating the coagulation cascade is tissue factor [40
]. The current studies suggest an important role of the P2X7 receptor in the induction of tissue factor, which is a function of the P2X7 receptor that has not been shown previously. In the presence of the inflammatory stimuli such as LPS, monocytes express tissue factor on their surface and thus may contribute to the coagulopathy of sepsis. An increase in tissue factor levels by monocytes in response to LPS has been observed as being dependent on the presence of CD14 [73
]. Although there is a host of information on the role of monocytes in the expression of tissue factor, comparatively little is known about the role of the P2X7 receptor in this response. In the present study, we have demonstrated that BzATP treatment induced a three- to sixfold increase in the production of tissue factor mRNA, suggesting that the P2X7 receptor can regulate the generation of this coagulation factor. In addition, a consensus site for the transcription factor NF-
B, which acts as a central mediator of human immune response and regulates the transcription of numerous cytokines, is contained in the promoter region of the genes for IL-1ß, COX-2, and tissue factor [29
, 74
, 75
]. As BzATP can potently cause the degradation of I
B
and the nuclear translocation of the transcription factor NF-
B, it is likely that the P2X7 receptor can play a physiological role in modulating the expression of tissue factor and COX-2 via a NF-
B-dependent pathway.
|
|
|---|
B
, the enhanced nuclear translocation of the transcription factor NF-
B, and the increased production of COX-2, tissue factor, and IL-1ß. Because of the important role of the P2X7 receptor in immunomodulation of mediator release, the observation that there is a large population of monocytes expressing functional P2X7 receptors implicates this cell type as a potential key point of regulation and therapeutic control.
Received April 23, 2001; revised January 25, 2002; accepted January 25, 2002.
|
|
|---|
This article has been cited by other articles:
![]() |
S. D. Skaper, P. Debetto, and P. Giusti The P2X7 purinergic receptor: from physiology to neurological disorders FASEB J, February 1, 2010; 24(2): 337 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-C. Lin, W.-N. Lin, W.-J. Wang, C.-C. Sun, W.-H. Tung, H.-H. Wang, and C.-M. Yang Functional coupling expression of COX-2 and cPLA2 induced by ATP in rat vascular smooth muscle cells: role of ERK1/2, p38 MAPK, and NF-{kappa}B Cardiovasc Res, June 1, 2009; 82(3): 522 - 531. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Gavala, Z. A. Pfeiffer, and P. J. Bertics The nucleotide receptor P2RX7 mediates ATP-induced CREB activation in human and murine monocytic cells J. Leukoc. Biol., October 1, 2008; 84(4): 1159 - 1171. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-R. Woo, R. G. Barletta, and C. J. Czuprynski Extracellular ATP Is Cytotoxic to Mononuclear Phagocytes but Does Not Induce Killing of Intracellular Mycobacterium avium subsp. paratuberculosis Clin. Vaccine Immunol., September 1, 2007; 14(9): 1078 - 1083. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Kahlenberg and G. R. Dubyak Differing caspase-1 activation states in monocyte versus macrophage models of IL-1{beta} processing and release J. Leukoc. Biol., September 1, 2004; 76(3): 676 - 684. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. A. Pfeiffer, M. Aga, U. Prabhu, J. J. Watters, D. J. Hall, and P. J. Bertics The nucleotide receptor P2X7 mediates actin reorganization and membrane blebbing in RAW 264.7 macrophages via p38 MAP kinase and Rho J. Leukoc. Biol., June 1, 2004; 75(6): 1173 - 1182. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Aga, J. J. Watters, Z. A. Pfeiffer, G. J. Wiepz, J. A. Sommer, and P. J. Bertics Evidence for nucleotide receptor modulation of cross talk between MAP kinase and NF-{kappa}B signaling pathways in murine RAW 264.7 macrophages Am J Physiol Cell Physiol, April 1, 2004; 286(4): C923 - C930. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Donnelly-Roberts, M. T. Namovic, C. R. Faltynek, and M. F. Jarvis Mitogen-Activated Protein Kinase and Caspase Signaling Pathways Are Required for P2X7 Receptor (P2X7R)-Induced Pore Formation in Human THP-1 Cells J. Pharmacol. Exp. Ther., March 1, 2004; 308(3): 1053 - 1061. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Denlinger, J. A. Sommer, K. Parker, L. Gudipaty, P. L. Fisette, J. W. Watters, R. A. Proctor, G. R. Dubyak, and P. J. Bertics Mutation of a Dibasic Amino Acid Motif Within the C Terminus of the P2X7 Nucleotide Receptor Results in Trafficking Defects and Impaired Function J. Immunol., August 1, 2003; 171(3): 1304 - 1311. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. la Sala, D. Ferrari, F. Di Virgilio, M. Idzko, J. Norgauer, and G. Girolomoni Alerting and tuning the immune response by extracellular nucleotides J. Leukoc. Biol., March 1, 2003; 73(3): 339 - 343. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||