| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
cross-regulate antigen presentation to CD4 T cells by macrophages
* Departments of Rheumatology and
Neurology, The Medical School, University of Newcastle upon Tyne, United Kingdom
Correspondence: Dr. John H. Robinson, Department of Rheumatology, The Medical School, University of Newcastle, Framlington Place, Newcastle upon Tyne, NE2 4HH, U.K. E-mail: j.h.robinson{at}ncl.ac.uk
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONREFERENCES |
|---|
(IFN-) in regulating Ag presentation in macrophages. TGF-ß1 blocked, and IFN- enhanced Ag presentation of two T cell epitopes from the group A streptococcal M protein processed from viable Streptococcus pyogenes. Consistent with the functional data, TGF-ß1 reduced the constitutive expression of MHC class II transactivator (CIITA), MHC class II (MHC-II), invariant chain, and DO mRNA, whereas IFN- up-regulated the expression of CIITA and MHC-II mRNA without affecting invariant chain or DO mRNA. However, neither cytokine affected DM mRNA expression. Treatment of macrophages with the two cytokines in combination showed that TGF-ß1 down-regulated IFN--mediated enhancement of antigen presentation and inhibited IFN--inducible CIITA and MHC-II class II mRNA expression. The effect of TGF-ß1 on Ag presentation was shown to be independent of the surface expression of CD80, CD86, or CD40 costimulatory molecules by flow cytometry. Our results show that TGF-ß1 and IFN- cross-regulate Ag presentation by influencing the transcription of several genes associated with antigen presentation function, which may represent an important mechanism limiting T cell activation during an immune response.
Key Words: cytokines • MHC class II • chaperones • costimulation • Streptococcus pyogenes
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONREFERENCES |
|---|
(IFN-) has been described as enhancing MHC-II-restricted Ag presentation by up-regulating the expression of CIITA, MHC-II, Ii chain, and DM molecules [3
]. Evidence suggests that transforming growth factor-ß1 (TGF-ß1) down-regulates IFN--inducible expression of DR
[4
] and DRß [5
] via a CIITA-dependent mechanism. However, the effect of TGF-ß1 on Ag presentation has not been studied directly. In the present study, we show that TGF-ß1 and IFN- cross-regulate Ag presentation by the classical and recycling MHC-II processing pathways at the level of transcription of MHC-II and chaperone genes in macrophages.
To determine the effect of TGF-ß1 and IFN- on Ag presentation, the murine macrophage cell line J774A.1 (H-2d) was pretreated overnight with IFN- (Genzyme, Cambridge, MA) or TGF-ß1 (R&D Systems, Abingdon, UK) and was infected with Streptococcus pyogenes strain Manfredo expressing the type 5 M protein for different periods of time. J774A.1 cells were fixed with 1.0% paraformaldehyde, and type 5 M protein-specific T cell hybridomas HX17 (specific for epitope M517–31) and HY2 (M5308–319) [6
] were added as a readout of antigen presentation. Supernatants were collected following incubation for 24 h at 37°C, and interleukin (IL)-2 content was measured as the proliferative response of the IL-2-dependent CTLL-2 T cells in the presence of 14.8 kBq of [3H]-thymidine (Amersham, UK) for the last 16 h. All experiments were repeated at least three times. Pretreatment of APC with TGF-ß1 profoundly reduced Ag presentation of both epitopes from viable streptococci in a dose-dependent manner (Fig. 1A
and 1B
). This inhibition was obvious as a reduction in the magnitude and a delay in the kinetics of Ag presentation. As TGF-ß1 blocked Ag presentation of epitopes M5308–319 and M517–31, which were previously shown to engage newly synthesized or recycling MHC-II molecules for presentation, respectively [6
], the data suggest that TGF-ß1 inhibited classical and recycling MHC-II pathways.
|
enhanced presentation of both epitopes (Fig. 1C
and 1D)
. However, IFN- caused a significant delay in presentation of M5308–319, without changing the kinetics of M517–31 presentation (Fig. 1C
and 1D)
. The selective effect of IFN- on the classical pathway of Ag presentation may be attributed to the recently shown delay in progression from early to late phagosomes in macrophages treated with IFN- [7
]. Consistent with this interpretation, we previously showed that M5308–319 was processed in late endosomal compartments and M517–31, in early endosomal compartments of macrophages [6
]. Macrophages treated with a combination of TGF-ß1 and IFN- exhibited a dramatic reduction in the presentation of both epitopes (Fig. 1C
and 1D)
, suggesting that the effect of TGF-ß1 is dominant over IFN-. TGF-ß1 and IFN- also had a similar effect on the presentation of synthetic peptides 15–33 and 300–319, representing the M5-specific T cell epitopes (Fig. 1E
and 1F)
. These data demonstrate that TGF-ß1 and IFN- interact in cross-regulation of Ag presentation by macrophages.
We next investigated the effect of TGF-ß1 and IFN- on the expression of CIITA, MHC-II, and associated chaperones by reverse transcriptase-polymerase chain reaction (RT-PCR). RNA from J774A.1 macrophages was extracted with the RNeasy mini kit (Qiagen Ltd., West Sussex, UK) and was treated with RNase-free DNase (Qiagen) to remove contaminating DNA. RT-PCR was performed using a RT-PCR kit (OneStep, Qiagen), 200 ng RNA, and 0.6 µM primers, according to the manufacturer’s instructions. PCR was performed for 30 min at 50°C, and reaction tubes were preincubated at 95°C for 15 min to activate HotStarTaq DNA polymerase (Qiagen). Forty cycles of PCR were run each for 0.5 min at 94°C, 0.5 min at 55°C, 1 min at 72°C, and 5 min at 72°C. After PCR, one-tenth of PCR products was analyzed in 1.5% agarose gels by ethidium bromide staining. The following primers were used: A, gggggtcctcgccctgaac, ctgggtgtctggaggtgcca; Aß, cgcatacggctcgtgacca, cagcgcactttgatcttggct; E, gacattgaaaagtcagagacca, tgtcggcgttctacaacattg; Eß, ccagtggctttggtcagagac, tcaatgttgccagggtagaag; CIITA, gacctggatcgtctcgtgcag, ctcagccttaggagggacttg; Ii p41, gccccacagctgccaaacc, ttaaacctgccccgtctgtatcat; DM, gtgccccgactgcctgactttg, tcgacggctgagatggatgtgg; DMß, accgccatctgtccgagtagc, gccatctgaagaagccaacac; DO, agacttcgcccactcggactttca, cggatactgggcctgcgtgtg; ß-actin, caccctgtgctgctcaccgaggcc, ccacacagagtacttgcgctcagg.
Pretreatment with TGF-ß1 inhibited, and IFN- enhanced CIITA mRNA expression (Fig. 2A
). It is interesting that TGF-ß1 blocked IFN--induced enhancement of CIITA, consistent with a similar effect of TGF-ß1 observed previously in nonprofessional APC, such as microglial cells [8
]. Next, we analyzed the effect of cytokines on the expression of mRNA encoding all four MHC-II chains as well as the chaperones Ii, DM, and DO. TGF-ß1 inhibited expression of Aß, E, Eß, DO, and Ii chain mRNA, whereas IFN- up-regulated expression of Aß, E, and Eß with minimal effect on the Ii chain. No apparent effect of cytokine alone or in combination was observed on expression of A, DM, DMß, or the control ß-actin. Also, TGF-ß1 inhibited IFN--mediated enhancement of transcription of Aß and Eß mRNA with no effect on A, E, and DO mRNA expression. When macrophages were treated with a combination of the cytokines, TGF-ß1 blocked IFN--induced expression of the MHC-II ß-chain but not the -chain mRNA, unlike the described inhibitory effect of TGF-ß1 on IFN--inducible DR mRNA in human monocytes [4
] and E mRNA in microglial cells [8
]. Hence, the effects of TGF-ß1 may be cell type-specific and may differ between species. Similar effects of TGF-ß1 and IFN- were observed at the protein level by flow cytometry (Fig. 2B)
. We suggest that TGF-ß1-mediated down-regulation of MHC-II, Ii chain, and DO expression underlies at least some of the previously observed inhibitory effects of TGF-ß1 on the allostimulatory function of bone marrow-derived APC [9
]. Our data also indicate that TGF-ß1 and IFN- cross-regulated transcription of some, but not all, genes associated with Ag presentation function of macrophages.
|
significantly enhanced the percentage of cells expressing CD40 without affecting CD80 and CD86 expression (Fig. 2C
and 2D)
. In contrast, TGF-ß1 had no effect on expression of any of the costimulatory molecules studied, suggesting that the inhibitory effect of TGF-ß1 on Ag presentation was not mediated via down-regulation of costimulatory molecules. This conclusion is consistent with a previous study showing that TGF-ß1 had no effect on the expression of CD80 on human bone marrow APC [9
]. However, costimulatory molecules may be differentially regulated by different isoforms of TGF-ß, as TGF-ß2 has been shown to down-regulate CD40 expression on peritoneal exudate cells [10
].
Our data suggest that TGF-ß1 and IFN- cross-regulate MHC-II-restricted presentation of protein Ag in professional APC by affecting transcription of MHC-II molecules and molecular chaperones. Hence, the inhibitory effect of TGF-ß1 on Ag presentation by macrophages may contribute to regulation of the acquired immune response by limiting T cell activation at the level of transcription of several genes associated with Ag presentation function, in addition to the direct effects on T cell proliferation and subset differentiation shown by others [11
].
|
ACKNOWLEDGEMENTS |
|---|
Received August 29, 2001; revised April 3, 2002; accepted April 22, 2002.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONREFERENCES |
|---|
Annu. Rev. Immunol. 15,749-795[Medline]
action J. Immunol. 158,1095-1101[Abstract]
This article has been cited by other articles:
|
|
 |
|
  B. Zhu, Y. Bando, S. Xiao, K. Yang, A. C. Anderson, V. K. Kuchroo, and S. J. Khoury CD11b+Ly-6Chi Suppressive Monocytes in Experimental Autoimmune Encephalomyelitis J. Immunol., October 15, 2007; 179(8): 5228 - 5237. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Jelinek, V. Laszlo, E. Buzas, E. Pallinger, B. Hangya, Z. Horvath, and A. Falus Increased antigen presentation and Th1 polarization in genetically histamine-free mice Int. Immunol., January 1, 2007; 19(1): 51 - 58. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. C. Schweitzer, A. M. Reding, H. M. Patton, T. P. Sullivan, C. E. Stubbs, E. Villalobos-Menuey, S. A. Huber, and M. K. Newell Endogenous versus exogenous fatty acid availability affects lysosomal acidity and MHC class II expression J. Lipid Res., November 1, 2006; 47(11): 2525 - 2537. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. B. Arruda, D. Sim, P. R. Chikhlikar, M. Maciel Jr, K. Akasaki, J. T. August, and E. T. A. Marques Dendritic Cell-Lysosomal-Associated Membrane Protein (LAMP) and LAMP-1-HIV-1 Gag Chimeras Have Distinct Cellular Trafficking Pathways and Prime T and B Cell Responses to a Diverse Repertoire of Epitopes J. Immunol., August 15, 2006; 177(4): 2265 - 2275. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. T. Chang, J. J. Linderman, and D. E. Kirschner Multiple mechanisms allow Mycobacterium tuberculosis to continuously inhibit MHC class II-mediated antigen presentation by macrophages PNAS, March 22, 2005; 102(12): 4530 - 4535. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. L. Oleszak, J. R. Chang, H. Friedman, C. D. Katsetos, and C. D. Platsoucas Theiler's Virus Infection: a Model for Multiple Sclerosis Clin. Microbiol. Rev., January 1, 2004; 17(1): 174 - 207. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or in the presence of 1 ng/ml (
), 3 ng/ml (circles), or 10 ng/ml (diamonds) of TGF-ß1. After treatment, APC were incubated with viable S. pyogenes for different times (x-axis), fixed, and washed before adding M517–31 (A)- or M5308–319 (B)-specific T cell hybridomas. Alternatively, APC were pretreated with IFN-
), before adding M517–31 (C)- or M5308–319 (D)-specific T cell hybridomas. In control experiments, macrophages were pretreated with cytokines as above and treated with synthetic peptides 15–33 and 300–319 for 6 h, followed by an Ag presentation assay with M517–31 (E)- or M5308–319 (F)-specific T cell hybridomas.