Vancouver

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Delvig, A. A.
Right arrow Articles by Robinson, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Delvig, A. A.
Right arrow Articles by Robinson, J. H.
(Journal of Leukocyte Biology. 2002;72:163-166.)
© 2002 by Society for Leukocyte Biology

TGF-ß1 and IFN-{gamma} cross-regulate antigen presentation to CD4 T cells by macrophages

Alexei A. Delvig*, Jeong J. Lee*, Zosia M. A. Chrzanowska-Lightowlers{dagger} and John H. Robinson*

* Departments of Rheumatology and
{dagger} Neurology, The Medical School, University of Newcastle upon Tyne, United Kingdom

Correspondence: Dr. John H. Robinson, Department of Rheumatology, The Medical School, University of Newcastle, Framlington Place, Newcastle upon Tyne, NE2 4HH, U.K. E-mail: j.h.robinson{at}ncl.ac.uk


arrow
ABSTRACT
 
We studied the interaction of transforming growth factor-ß1 (TGF-ß1) and interferon-{gamma} (IFN-{gamma}) in regulating Ag presentation in macrophages. TGF-ß1 blocked, and IFN-{gamma} enhanced Ag presentation of two T cell epitopes from the group A streptococcal M protein processed from viable Streptococcus pyogenes. Consistent with the functional data, TGF-ß1 reduced the constitutive expression of MHC class II transactivator (CIITA), MHC class II (MHC-II), invariant chain, and DO mRNA, whereas IFN-{gamma} up-regulated the expression of CIITA and MHC-II mRNA without affecting invariant chain or DO mRNA. However, neither cytokine affected DM mRNA expression. Treatment of macrophages with the two cytokines in combination showed that TGF-ß1 down-regulated IFN-{gamma}-mediated enhancement of antigen presentation and inhibited IFN-{gamma}-inducible CIITA and MHC-II class II mRNA expression. The effect of TGF-ß1 on Ag presentation was shown to be independent of the surface expression of CD80, CD86, or CD40 costimulatory molecules by flow cytometry. Our results show that TGF-ß1 and IFN-{gamma} cross-regulate Ag presentation by influencing the transcription of several genes associated with antigen presentation function, which may represent an important mechanism limiting T cell activation during an immune response.

Key Words: cytokines • MHC class II • chaperones • costimulation • Streptococcus pyogenes


arrow
INTRODUCTION
 
Major histocompatibility class II (MHC-II) molecules present peptide epitopes to CD4+ T cells following uptake and proteolytic degradation of soluble and particulate antigen (Ag) in endocytic compartments of a variety of antigen-presenting cell (APC) types including macrophages. For the majority of epitopes, peptides are generated in late endosomes, where they are loaded onto newly synthesized MHC-II molecules under the control of several chaperones, including invariant (Ii) chain, human leukocyte antigen (HLA)-DM/H2-DM, and its co-chaperone HLA-DO/H-2DO. The Ii chain participates in the assembly and intracellular transport of MHC-II molecules, which remain associated with the class II invariant chain peptide (CLIP) until HLA-DM and HLA-DO catalyze the exchange of CLIP for exogenous peptide. MHC-II, HLA-DM, and Ii chain genes have been shown to share a common mechanism of regulation via the non-DNA binding factor class II transactivator (CIITA), which facilitates the assembly of transcription factor complexes on the promoters of this gene family [1 ]. In addition to this classical MHC-II pathway, many epitopes are generated in early endosomes and bind to MHC-II molecules recycled from the cell surface via the recycling MHC-II pathway [2 ]. Interferon-{gamma} (IFN-{gamma}) has been described as enhancing MHC-II-restricted Ag presentation by up-regulating the expression of CIITA, MHC-II, Ii chain, and DM molecules [3 ]. Evidence suggests that transforming growth factor-ß1 (TGF-ß1) down-regulates IFN-{gamma}-inducible expression of DR{alpha} [4 ] and DRß [5 ] via a CIITA-dependent mechanism. However, the effect of TGF-ß1 on Ag presentation has not been studied directly. In the present study, we show that TGF-ß1 and IFN-{gamma} cross-regulate Ag presentation by the classical and recycling MHC-II processing pathways at the level of transcription of MHC-II and chaperone genes in macrophages.

To determine the effect of TGF-ß1 and IFN-{gamma} on Ag presentation, the murine macrophage cell line J774A.1 (H-2d) was pretreated overnight with IFN-{gamma} (Genzyme, Cambridge, MA) or TGF-ß1 (R&D Systems, Abingdon, UK) and was infected with Streptococcus pyogenes strain Manfredo expressing the type 5 M protein for different periods of time. J774A.1 cells were fixed with 1.0% paraformaldehyde, and type 5 M protein-specific T cell hybridomas HX17 (specific for epitope M517–31) and HY2 (M5308–319) [6 ] were added as a readout of antigen presentation. Supernatants were collected following incubation for 24 h at 37°C, and interleukin (IL)-2 content was measured as the proliferative response of the IL-2-dependent CTLL-2 T cells in the presence of 14.8 kBq of [3H]-thymidine (Amersham, UK) for the last 16 h. All experiments were repeated at least three times. Pretreatment of APC with TGF-ß1 profoundly reduced Ag presentation of both epitopes from viable streptococci in a dose-dependent manner (Fig. 1A and 1B ). This inhibition was obvious as a reduction in the magnitude and a delay in the kinetics of Ag presentation. As TGF-ß1 blocked Ag presentation of epitopes M5308–319 and M517–31, which were previously shown to engage newly synthesized or recycling MHC-II molecules for presentation, respectively [6 ], the data suggest that TGF-ß1 inhibited classical and recycling MHC-II pathways.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 1. Effect of TGF-ß1 and IFN-{gamma} on Ag presentation to T cell hybridomas. J774 macrophages were incubated overnight in the absence of TGF-ß1 ({blacksquare}) or in the presence of 1 ng/ml ({square}), 3 ng/ml (circles), or 10 ng/ml (diamonds) of TGF-ß1. After treatment, APC were incubated with viable S. pyogenes for different times (x-axis), fixed, and washed before adding M517–31 (A)- or M5308–319 (B)-specific T cell hybridomas. Alternatively, APC were pretreated with IFN-{gamma} (10 U/ml) alone (•) or in combination with TGF-ß1 (10 ng/ml; {blacklozenge}), before adding M517–31 (C)- or M5308–319 (D)-specific T cell hybridomas. In control experiments, macrophages were pretreated with cytokines as above and treated with synthetic peptides 15–33 and 300–319 for 6 h, followed by an Ag presentation assay with M517–31 (E)- or M5308–319 (F)-specific T cell hybridomas.

In contrast to the inhibitory effect of TGF-ß, treatment of macrophages with IFN-{gamma} enhanced presentation of both epitopes (Fig. 1C and 1D) . However, IFN-{gamma} caused a significant delay in presentation of M5308–319, without changing the kinetics of M517–31 presentation (Fig. 1C and 1D) . The selective effect of IFN-{gamma} on the classical pathway of Ag presentation may be attributed to the recently shown delay in progression from early to late phagosomes in macrophages treated with IFN-{gamma} [7 ]. Consistent with this interpretation, we previously showed that M5308–319 was processed in late endosomal compartments and M517–31, in early endosomal compartments of macrophages [6 ]. Macrophages treated with a combination of TGF-ß1 and IFN-{gamma} exhibited a dramatic reduction in the presentation of both epitopes (Fig. 1C and 1D) , suggesting that the effect of TGF-ß1 is dominant over IFN-{gamma}. TGF-ß1 and IFN-{gamma} also had a similar effect on the presentation of synthetic peptides 15–33 and 300–319, representing the M5-specific T cell epitopes (Fig. 1E and 1F) . These data demonstrate that TGF-ß1 and IFN-{gamma} interact in cross-regulation of Ag presentation by macrophages.

We next investigated the effect of TGF-ß1 and IFN-{gamma} on the expression of CIITA, MHC-II, and associated chaperones by reverse transcriptase-polymerase chain reaction (RT-PCR). RNA from J774A.1 macrophages was extracted with the RNeasy mini kit (Qiagen Ltd., West Sussex, UK) and was treated with RNase-free DNase (Qiagen) to remove contaminating DNA. RT-PCR was performed using a RT-PCR kit (OneStep, Qiagen), 200 ng RNA, and 0.6 µM primers, according to the manufacturer’s instructions. PCR was performed for 30 min at 50°C, and reaction tubes were preincubated at 95°C for 15 min to activate HotStarTaq DNA polymerase (Qiagen). Forty cycles of PCR were run each for 0.5 min at 94°C, 0.5 min at 55°C, 1 min at 72°C, and 5 min at 72°C. After PCR, one-tenth of PCR products was analyzed in 1.5% agarose gels by ethidium bromide staining. The following primers were used: A{alpha}, gggggtcctcgccctgaac, ctgggtgtctggaggtgcca; Aß, cgcatacggctcgtgacca, cagcgcactttgatcttggct; E{alpha}, gacattgaaaagtcagagacca, tgtcggcgttctacaacattg; Eß, ccagtggctttggtcagagac, tcaatgttgccagggtagaag; CIITA, gacctggatcgtctcgtgcag, ctcagccttaggagggacttg; Ii p41, gccccacagctgccaaacc, ttaaacctgccccgtctgtatcat; DM{alpha}, gtgccccgactgcctgactttg, tcgacggctgagatggatgtgg; DMß, accgccatctgtccgagtagc, gccatctgaagaagccaacac; DO{alpha}, agacttcgcccactcggactttca, cggatactgggcctgcgtgtg; ß-actin, caccctgtgctgctcaccgaggcc, ccacacagagtacttgcgctcagg.

Pretreatment with TGF-ß1 inhibited, and IFN-{gamma} enhanced CIITA mRNA expression (Fig. 2A ). It is interesting that TGF-ß1 blocked IFN-{gamma}-induced enhancement of CIITA, consistent with a similar effect of TGF-ß1 observed previously in nonprofessional APC, such as microglial cells [8 ]. Next, we analyzed the effect of cytokines on the expression of mRNA encoding all four MHC-II chains as well as the chaperones Ii, DM, and DO. TGF-ß1 inhibited expression of Aß, E{alpha}, Eß, DO{alpha}, and Ii chain mRNA, whereas IFN-{gamma} up-regulated expression of Aß, E{alpha}, and Eß with minimal effect on the Ii chain. No apparent effect of cytokine alone or in combination was observed on expression of A{alpha}, DM{alpha}, DMß, or the control ß-actin. Also, TGF-ß1 inhibited IFN-{gamma}-mediated enhancement of transcription of Aß and Eß mRNA with no effect on A{alpha}, E{alpha}, and DO{alpha} mRNA expression. When macrophages were treated with a combination of the cytokines, TGF-ß1 blocked IFN-{gamma}-induced expression of the MHC-II ß-chain but not the {alpha}-chain mRNA, unlike the described inhibitory effect of TGF-ß1 on IFN-{gamma}-inducible DR{alpha} mRNA in human monocytes [4 ] and E{alpha} mRNA in microglial cells [8 ]. Hence, the effects of TGF-ß1 may be cell type-specific and may differ between species. Similar effects of TGF-ß1 and IFN-{gamma} were observed at the protein level by flow cytometry (Fig. 2B) . We suggest that TGF-ß1-mediated down-regulation of MHC-II, Ii chain, and DO expression underlies at least some of the previously observed inhibitory effects of TGF-ß1 on the allostimulatory function of bone marrow-derived APC [9 ]. Our data also indicate that TGF-ß1 and IFN-{gamma} cross-regulated transcription of some, but not all, genes associated with Ag presentation function of macrophages.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 2. Expression of MHC-II, chaperones, and costimulatory molecules by cytokine-treated macrophages. Cells were treated overnight with 10 U/ml IFN-{gamma} and 10 ng/ml TGF-ß1 in combination or incubated in the absence of cytokines. (A) PCR analysis performed using primers for the mouse A{alpha}, Aß, E{alpha}, Eß, DM{alpha}, DMß, DO{alpha}, Ii chain (p41 isoform, lower band), and CIITA gene, as well as for the cytoplasmic ß-actin gene as a positive control. The data shown are representative of two independent experiments. (B–D) Flow cytometry to detect cell surface expression. Mean and standard deviation of the mean from three to six independent experiments are shown. (B) The effect of TGF-ß1 (solid bars) or IFN-{gamma} (back-hatched bars) alone or in combination (hatched bars) on expression of AdEd, DM, DO, and Ii chain (CD74) as mean fluorescent intensity (MFI). Expression of CD40, CD80, and CD86 costimulatory molecules as MFI (C) or as percent of positive cells (D).

To determine whether the reduced T cell response after treatment with cytokines was a result of the influence of costimulatory molecules, we measured the expression of CD40, CD80, and CD86 on J774A.1 macrophages by flow cytometry. IFN-{gamma} significantly enhanced the percentage of cells expressing CD40 without affecting CD80 and CD86 expression (Fig. 2C and 2D) . In contrast, TGF-ß1 had no effect on expression of any of the costimulatory molecules studied, suggesting that the inhibitory effect of TGF-ß1 on Ag presentation was not mediated via down-regulation of costimulatory molecules. This conclusion is consistent with a previous study showing that TGF-ß1 had no effect on the expression of CD80 on human bone marrow APC [9 ]. However, costimulatory molecules may be differentially regulated by different isoforms of TGF-ß, as TGF-ß2 has been shown to down-regulate CD40 expression on peritoneal exudate cells [10 ].

Our data suggest that TGF-ß1 and IFN-{gamma} cross-regulate MHC-II-restricted presentation of protein Ag in professional APC by affecting transcription of MHC-II molecules and molecular chaperones. Hence, the inhibitory effect of TGF-ß1 on Ag presentation by macrophages may contribute to regulation of the acquired immune response by limiting T cell activation at the level of transcription of several genes associated with Ag presentation function, in addition to the direct effects on T cell proliferation and subset differentiation shown by others [11 ].


arrow
ACKNOWLEDGEMENTS
 
This project was supported by grant 058930/Z/99/Z from The Wellcome Trust. Z. M. A. C-L. is a Research Career Development Fellow funded by The Wellcome Trust.

Received August 29, 2001; revised April 3, 2002; accepted April 22, 2002.


arrow
REFERENCES
 
    1
  1. Watts, C. (2001) Antigen processing in the endocytic compartment Curr. Opin. Immunol. 13,26-31[Medline]
  2. 2
  3. Pinet, V. M., Vergelli, M., Martin, R., Bakke, O., Long, E. O. (1995) Antigen presentation mediated by recycling of surface HLA-DR molecules Nature 375,603-606[Medline]
  4. 3
  5. Boehm, U., Klamp, T., Groot, M., Howard, J. C. (1997) Cellular responses to interferon-{gamma} Annu. Rev. Immunol. 15,749-795[Medline]
  6. 4
  7. Nandan, D., Reiner, N. E. (1997) TGF-ß attenuates the class II transactivator and reveals an accessory pathway of IFN-{gamma} action J. Immunol. 158,1095-1101[Abstract]
  8. 5
  9. Navarrete Santos, A., Kehlen, A., Schutte, W., Langner, J., Riemann, D. (1998) Regulation by transforming growth factor-ß1 of class II mRNA and protein expression in fibroblast-like synoviocytes from patients with rheumatoid arthritis Int. Immunol. 10,601-607[Abstract/Free Full Text]
  10. 6
  11. Delvig, A. A., Robinson, J. H. (1998) Two T-cell epitopes from the M5 protein of viable Streptococcus pyogenes engage different pathways of bacterial antigen processing in mouse macrophages J. Immunol. 160,5267-5272[Abstract/Free Full Text]
  12. 7
  13. Tsang, A. W., Oestergaard, K., Myers, J. T., Swanson, J. A. (2000) Altered membrane trafficking in activated bone marrow-derived macrophages J. Leukoc. Biol. 68,487-494[Abstract/Free Full Text]
  14. 8
  15. O’Keefe, G. M., Nguyen, V. T., Benveniste, E. N. (1999) Class II transactivator and class II MHC gene expression in microglia: modulation by the cytokines TGF-ß, IL-4, IL-13 and IL-10 Eur. J. Immunol. 29,1275-1285[Medline]
  16. 9
  17. Bonham, C. A., Lu, L., Banas, R. A., Fontes, P., Rao, A. S., Starzl, T. E., Zeevi, A., Thompson, A. W. (1996) TGF-ß1 pretreatment impairs the allostimulatory function of human bone marrow-derived antigen-presenting cells for both naive and primed T cells Transpl. Immunol. 4,186-191[Medline]
  18. 10
  19. Takeuchi, M., Alard, P., Streilein, J. W. (1998) TGF-ß promotes immune deviation by altering accessory signals of antigen-presenting cells J. Immunol. 160,1589-1597[Abstract/Free Full Text]
  20. 11
  21. Letterio, J. J., Roberts, A. B. (1998) Regulation of immune responses by TGF-ß Annu. Rev. Immunol. 16,137-161[Medline]



This article has been cited by other articles:


Home page
BloodHome page
M. Francois, R. Romieu-Mourez, S. Stock-Martineau, M.-N. Boivin, J. L. Bramson, and J. Galipeau
Mesenchymal stromal cells cross-present soluble exogenous antigens as part of their antigen-presenting cell properties
Blood, September 24, 2009; 114(13): 2632 - 2638.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Zhu, Y. Bando, S. Xiao, K. Yang, A. C. Anderson, V. K. Kuchroo, and S. J. Khoury
CD11b+Ly-6Chi Suppressive Monocytes in Experimental Autoimmune Encephalomyelitis
J. Immunol., October 15, 2007; 179(8): 5228 - 5237.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
I. Jelinek, V. Laszlo, E. Buzas, E. Pallinger, B. Hangya, Z. Horvath, and A. Falus
Increased antigen presentation and Th1 polarization in genetically histamine-free mice
Int. Immunol., January 1, 2007; 19(1): 51 - 58.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. C. Schweitzer, A. M. Reding, H. M. Patton, T. P. Sullivan, C. E. Stubbs, E. Villalobos-Menuey, S. A. Huber, and M. K. Newell
Endogenous versus exogenous fatty acid availability affects lysosomal acidity and MHC class II expression
J. Lipid Res., November 1, 2006; 47(11): 2525 - 2537.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. B. Arruda, D. Sim, P. R. Chikhlikar, M. Maciel Jr, K. Akasaki, J. T. August, and E. T. A. Marques
Dendritic Cell-Lysosomal-Associated Membrane Protein (LAMP) and LAMP-1-HIV-1 Gag Chimeras Have Distinct Cellular Trafficking Pathways and Prime T and B Cell Responses to a Diverse Repertoire of Epitopes
J. Immunol., August 15, 2006; 177(4): 2265 - 2275.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. T. Chang, J. J. Linderman, and D. E. Kirschner
Multiple mechanisms allow Mycobacterium tuberculosis to continuously inhibit MHC class II-mediated antigen presentation by macrophages
PNAS, March 22, 2005; 102(12): 4530 - 4535.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
E. L. Oleszak, J. R. Chang, H. Friedman, C. D. Katsetos, and C. D. Platsoucas
Theiler's Virus Infection: a Model for Multiple Sclerosis
Clin. Microbiol. Rev., January 1, 2004; 17(1): 174 - 207.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Delvig, A. A.
Right arrow Articles by Robinson, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Delvig, A. A.
Right arrow Articles by Robinson, J. H.