science pharmaceutical expo biotech jobs

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vasselon, T.
Right arrow Articles by Detmers, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vasselon, T.
Right arrow Articles by Detmers, P. A.
(Journal of Leukocyte Biology. 2002;71:503-510.)
© 2002 by Society for Leukocyte Biology

Toll-like receptor 2 (TLR2) mediates activation of stress-activated MAP kinase p38

Thierry Vasselon, William A Hanlon, Samuel D Wright and Patricia A. Detmers

Merck Research Laboratories, Rahway, New Jersey

Correspondence: Dr. Patricia A. Detmers, Merck Research Laboratories, 126 East Lincoln Avenue, RY80W-250, Rahway, NJ 07065. E-mail: patricia_detmers{at}merck.com


arrow
ABSTRACT
 
Early events in the response of cells to lipopolysaccharide (LPS) include activation of NF-{kappa}B and stress-activated MAP kinase p38. Recent studies have shown that the human Toll-like receptor 2 (TLR2) mediates activation of NF-{kappa}B in response to commercial preparations of LPS (comLPS), membrane lipoproteins, and Gram-positive bacterial products. Here, we show that expression of TLR2 in human embryonic kidney 293 cells enabled p38 phosphorylation in response to comLPS, a synthetic bacterial lipoprotein, and B. subtilis. Activation of p38 was confirmed by an in vitro kinase assay using ATF2 as substrate and by an assay measuring activation of the downstream effector of p38, MAP kinase-activated protein kinase in cells. Thus, TLR2 initiated the signaling pathway for p38 in response to bacterial products.

Key Words: lipopolysaccharide • signal transduction • cell-surface molecules • protein kinases • infectious immunity bacteria


arrow
INTRODUCTION
 
Recognition by the innate-immune system of microbial determinants such as lipopolysaccharide (LPS), a lipid component of Gram-negative bacteria, sets in motion mechanisms of defense against pathogens. Innate-immune responses show wide phylogenetic distribution and conservation, with flies and humans using homologous components, such as Rel/nuclear factor {kappa}-B (NF-{kappa}B), to signal responses.

Recently, a family of transmembrane proteins with intracellular homology to the interleukin (IL)-1 receptor family has been identified and shown to transduce a signal for activation of NF-{kappa}B in response to infection (for a review, see ref. [1 ]). In Drosophila, Toll and a close homolog, 18-wheeler, mediate NF-{kappa}B activation in response to fungi and bacteria, leading to the synthesis of antimicrobial peptides [2 , 3 ]. Nine mammalian Toll-like receptors (TLRs) have been identified [4 5 6 7 ], and three TLRs have been shown to participate in responses to microbial determinants. TLR4 (hToll) was identified as the defective protein in two mouse strains that exhibit an impaired ability to respond to LPS [8 , 9 ]. In addition, TLR2 endows an otherwise unresponsive human cell line with the ability to activate NF-{kappa}B in response to a wide variety of bacterial agonists, including commercial preparations of LPS (comLPS), Gram-positive bacterial cell-wall components, and lipoproteins [10 11 12 13 14 15 ]. Thus, TLRs appear to be key in regulating one aspect of the innate-immune response.

Stress-activated mitogen-activated protein kinase (MAPK) p38 has also been identified as an important component of innate-immune responses to LPS. p38 is a highly conserved protein kinase that acts to regulate cell growth, differentiation, and stress responses. Cellular recognition of LPS causes phosphorylation and subsequent activation of p38 [16 ]. This, in turn, modulates activation of several transcription factors and other downstream kinases, such as the MAPK-activated protein (MAPKAP) kinases. Further, p38 activity also modulates the production of cytokines by monocytes in response to LPS, and specific inhibitors of p38 activity block this response [17 ]. In addition to regulating protein-synthetic pathways, p38 is required for adhesion and production of reactive oxygen intermediates by neutrophils in response to LPS, a very rapid innate-immune response [18 , 19 ].

We demonstrate here that TLR2 can mediate activation of p38 and its downstream effector MAPKAP kinase in 293 cells. Moreover, the observation that TLR2 activates p38 in response to a synthetic bacterial lipoprotein, a Gram-positive bacteria, and comLPS but not protein-free LPS suggests that TLR2 activates p38 with the same specificity that it activates NF-{kappa}B.


arrow
MATERIALS AND METHODS
 
Materials
The human embryonic kidney 293 cell line was obtained from American Type Culture Collection (ATCC; Manassas, VA) and maintained according to ATCC recommendations. Recombinant human soluble CD14 (sCD14) was purified from conditioned medium of Schneider-2 insect cells transfected with cDNA-encoding human CD14, as described previously [18 , 19 ]. comLPS from Escherichia coli K12-LCD25 were purchased from List Biological Laboratories (Campbell, CA). comLPS/sCD14 complexes were formed by incubating comLPS (20 µg/ml) with sCD14 (500 µg/ml) overnight at 37°C in Dulbecco’s phosphate-buffered saline (PBS; BioWhittaker, Walkersville, MD) with 0.5% pyrogen-free human serum albumin (HSA; Centeon, Armour and Berring Pharmaceutical Co., Kankakee, IL). Previous work has shown that under these conditions, all of the LPS forms stoichiometric complexes with monomeric sCD14 and that these complexes stimulate cells efficiently [20 ]. Re-extraction of LPS with phenol was performed following a published procedure [21 , 22 ]. The synthetic bacterial lipoprotein Pam3CysSerLys4 (sBLP) was purchased from Boehringer Mannheim (Mannheim, Germany). For some experiments, sBLP (5 µg/ml) was incubated with sCD14 (250 µg/ml) overnight at 37°C in Dulbecco’s PBS with 0.5% pyrogen-free HSA. Lyophilized Bacillus subtilis cells and cell culture-grade sorbitol were purchased from Sigma Chemical Co. (St. Louis, MO). Limulus amoebocyte lysate assay was performed using lysate from BioWhittaker according to the manufacturer’s recommendations. The very potent p38 inhibitor M39 [(S)-5-[2-(1-phenylethylamino)pyrimidin-4-yl]-1-methyl-4-[(3-trifluoromethyl)phenyl]-2-(4-piperidinyl)imidazole] [23 ] was stored in dimethyl sulfoxide (DMSO) at -20°C, and activity of the inhibitor was confirmed prior to use.

Plasmid preparation
The 3 x NF-{kappa}B-driven luciferase construct pNF-{kappa}B-luc was obtained from Stratagene (La Jolla, CA). The expression vector pcDNA3.1 was obtained from Invitrogen (Carlsbad, CA), and the plasmid pEGFP-N1, which constitutively expresses the enhanced green fluorescent protein (EGFP), was from Clontech (Palo Alto, CA). The coding region for TLR2 (accession number NM_003264) was amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) from human spleen mRNA (Clontech), cloned into pcDNA3.1, and sequenced. TLR2 was tagged with an NH2-terminal Flag epitope by inserting the sequence caaggaagactacaaggacgacgatgacaagtc at the EcoNI site of TLR2.

Stable transfectants
293 Cells were transfected using lipofectamine, according to the instructions of the manufacturer (Gibco-BRL, Grand Island, NY). Stable expression of TLR2 was obtained by transfection of pFlag-TLR2 into 293 cells. After selection with G418 (400 µg/ml), clonal cell lines expressing human TLR2 were tested for their ability to respond to comLPS using a NF-{kappa}B-dependent luciferase reporter gene assay.

Transient transfections
293 Cells were plated onto a 96-well plate at 0.3 x 105 cells/well the day before transfection. The semiconfluent cells were transfected with a DNA-lipofectamine mixture containing 25 ng luciferase reporter construct, 50 ng pEGFP-N1 plasmid, and 25 ng pTLR2 or control pcDNA3 per well. All transfections were performed in triplicate and were repeated at least two times.

NF-{kappa}B reporter assay
The cells were lysed using 100 µl/well cell-culture lysis reagent (Promega, Madison, WI). EGFP fluorescence was measured using a Spectrafluor Plus plate reader (TECAN, Durham, NC) to normalize for transfection efficiencies. Luciferase assay reagent (100 µl; Cat #E1483; Promega) was then added to each well, and the luminescence was measured immediately in an ML3000 microtiter plate luminometer (Dynatech Laboratories, Chantilly, VA). Relative luminescence units are expressed as (1000xluminescence)/EGFP fluorescence.

Anti-Flag immunoblotting
For each cell line, 106 cells were lysed by incubation on ice with 400 µl sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer. Lysates were centrifuged for 5 min at 12,000 g, and 20 µl of each supernatant were run on SDS-PAGE under reducing conditions. Proteins were electrotransferred to a nitrocellulose membrane and detected with a biotinylated anti-Flag murine monoclonal antibody (mAb; Sigma Chemical Co.). Horseradish peroxidase-conjugated antibiotin Ab (New England Biolabs, Beverly, MA) was used as the secondary antibody. Labeling was detected with a chemiluminescence-detection system (New England Biolabs).

Phosphorylation of p38 MAPK
Cells grown to semiconfluence in 96-well tissue-culture plates were washed once with PBS and lysed in SDS sample buffer (20 µl/well). Lysates from triplicate wells were pooled and boiled for 5 min. SDS-PAGE of the lysates was followed by Western blot analysis with an antibody recognizing p38 phosphorylated on thr180 and tyr182 (New England Biolabs). Labeling was detected with a chemiluminescence detection system (New England Biolabs). Blots were subsequently stripped and reprobed with an anti-p38 polyclonal antibody to control for variations in sample volumes.

Activating transcription factor 2 (ATF2) phosphorylation by p38
Phosphorylation of ATF2 by activated p38 MAPK was measured using a kit (New England Biolabs; Cat #9820) following the manufacturer’s instructions. Briefly, cells grown in 100 mm dishes to 75–80% confluence were washed once with PBS and lysed in cell-lysis buffer [20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM ethylenediaminetetraacetate (EDTA), 1 mM ethyleneglycol-bis(ß-aminoethylether)-N,N'-tetraacetic acid (EGTA), 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM ß-glycerolphosphate, 1 mM Na3VO4, 1 µg/ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride (PMSF)]. p38 from 200 µg of cleared lysate was immunoprecipitated using an antibody recognizing p38 phosphorylated on thr180 and tyr182. The resulting immunoprecipitate was incubated with 2 µg glutathione-S-transferase (GST)-ATF2 in kinase buffer [25 mM Tris, pH 7.5, 5 mM ß-glycerolphosphate, 2 mM dithiothreitol (DTT), 0.1 mM Na3VO4, and 10 mM MgCl2] in the presence of 200 µM adenosine 5'-triphosphate (ATP). Phosphorylation of ATF2 by active p38 was detected in Western blots of the assay mixture, using an antibody that recognizes ATF2 phosphorylated on thr71.

MAPKAP in vitro kinase assay
Phosphorylation of Hsp27 by MAPKAP kinase in cell lysates was measured as described previously [19 ], using recombinant-purified Hsp27, 33P-ATP, and autoradiography for detection of phosphorylated Hsp27 after PAGE. Phosphorylated protein was quantitated with a phosphorimager.


arrow
RESULTS
 
Expression of TLR2 endows 293 cells with the ability to activate NF-{kappa}B in response to various bacterial agonists
To examine the potential role of TLR2 in signaling p38 activation in response to bacterial products, human embryonic kidney 293 cell clones stably expressing TLR2 (293-TLR2) or empty vector (293-neo) were generated. Expression of TLR2 was confirmed by Western blot of lysates from two different stable clones. Anti-Flag antibody detected a protein of the correct molecular weight for TLR2 in clone 18 and clone 6 but not in 293-neo clone 1 (Fig. 1 ). Stable expression of TLR2 endowed 293 cells with the ability to respond to a comLPS with activation of NF-{kappa}B (Fig. 2 A ), consistent with results from previous studies [10 , 11 ]. Recently, it has been demonstrated that contaminating bacterial products contained in comLPS are responsible for stimulating responses through TLR2 [22 ], because responses to purified LPS depend on the presence of TLR4. Nevertheless, comLPS represents an easily available source of Gram-negative bacterial products that stimulate NF-{kappa}B through TLR2. TLR2 expression also enabled the cells to activate NF-{kappa}B in response to the synthetic bacterial lipopeptide sBLP and Gram-positive products (Fig. 2B ; and unpublished results), as has been shown previously [12 13 14 , 24 ]. Although addition of sCD14 along with sBLP slightly decreased the concentration of sBLP required to see a response, preincubation of sBLP with sCD14 greatly enhanced the sensitivity of NF-{kappa}B activation by sBLP (more than 100-fold). Thus, the TLR2 was shown to be expressed and active for generating signals in response to bacterial products.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. Expression of TLR2. Lysates from 293-neo clone 1 and 293-TLR2 clones 18 and 6 were run on SDS-PAGE and immunoblotted. TLR2 was detected with an anti-Flag antibody as described in Materials and Methods.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. TLR2-dependent activation of NF-{kappa}B by bacterial agonists. 293 Cells grown in 96-well plates were transiently transfected for the NF-{kappa}B reporter assay as described in Materials and Methods. Forty-eight hours later, cells were washed, resuspended in Dulbecco’s modified Eagle’s medium (DMEM)-HSA, and incubated with increasing concentrations of agonists for 6 h. Activation of NF-{kappa}B was measured by luminescence as described in Materials and Methods. Results are expressed as the mean of triplicate wells ± SE. (A) 293-neo and 293-TLR2 clones 18 and 6 were incubated with comLPS-sCD14 complexes. (B) 293-neo and 293-TLR2 were incubated with sBLP, sBLP preincubated with sCD14 (sBLP/sCD14), or added at the same time as sCD14 (sBLP+sCD14).

TLR2 stimulation by comLPS, B. subtilis, and sBLP induces p38 phosphorylation
To test for activation of p38, the 293 transfectants were exposed for increasing amounts of time to bacterial products, and cell lysates were analyzed by Western blot to assess phosphorylation of p38. Dual phosphorylation of p38 on thr180 and tyr182 confers enhanced enzymatic activity, and an antibody specific for the dually phosphorylated protein allowed detection of the activated form of p38 in Western blots. No phosphorylation of p38 was observed in 293-neo at times up to 4 h (Fig. 3A 3B 3C ). In contrast, p38 was phosphorylated in 293-TLR2 in response to comLPS, the Gram-positive bacteria B. subtilis, and sBLP, reaching a maximum after 30–60 min (Fig. 3A 3B 3C) .



View larger version (71K):
[in this window]
[in a new window]
 
Figure 3. TLR2-dependent phosphorylation of p38 in response to comLPS, sBLP, and B. subtilis but not to repurified LPS. Following stimulation with comLPS, B. subtilis, or sBLP, lysates of stable transfectants were Western blotted to assess phosphorylation of p38 (pp38). Blots were stripped and reprobed with anti-p38 (p38). (A) Time-dependent activation of p38 by comLPS. Cells were incubated with comLPS-sCD14 complexes (100 ng/ml LPS) for the indicated times. (B) Time-dependent activation of p38 by B. subtilis. Cells were incubated with bacteria (10 µg/ml lyophilized cells) for the indicated times. (C) Time-dependent activation of p38 by sBLP. Cells were incubated with sBLP/sCD14 (10 ng/ml sBLP) for the indicated times.

Cellular responses to low concentrations of LPS usually require the presence of CD14, a protein found soluble in serum and on the plasma membrane of leukocytes [20 , 25 , 26 ]. Similarly, responses to BLP depend on CD14, because anti-CD14 antibodies inhibit production of cytokines in responses to BLP by THP-1 cells [27 28 29 ], and the sensitivity of activation of NF-{kappa}B in response to sBLP can be enhanced by preincubating sCD14 and BLP (Fig. 2B) . To confirm that CD14 is required for p38 activation, we compared the responses of 293-TLR2 cells with comLPS and sBLP in the absence of sCD14 or after preincubation of the lipids with sCD14, as described in Materials and Methods. Phosphorylation of p38 was observed in the absence of sCD14, but the concentrations of comLPS and sBLP required for the response were at least 100-fold higher at 30 min than those required to stimulate p38 phosphorylation by comLPS-sCD14 or sBLP preincubated with sCD14 (Fig. 4A and B).



View larger version (79K):
[in this window]
[in a new window]
 
Figure 4. CD14-dependence of p38 activation by comLPS and sBLP. Cells were incubated with the indicated concentrations of bacterial product for 1 h at 37°C, and p38 phosphorylation was detected as described in Figure 3 . (A) Cells were incubated with comLPS micelles or comLPS-sCD14. (B) Cells were incubated with sBLP or sBLP/sCD14. (C) 293-TLR2 cells were incubated with re-extracted LPS micelles or re-extracted LPS-sCD14 complexes.

To confirm that p38 phosphorylation by our comLPS was in response to bacterial proteins contained in the preparation, we compared p38 activation by comLPS and LPS that had been re-extracted with phenol following published procedures [21 ] to remove proteins. Re-extracted, protein-free LPS did not induce phosphorylation of p38 in 293-TLR2 cells, even when it was incubated with sCD14 for up to 2 h (Fig. 4C) .

TLR2 stimulation activates p38
Activation of p38 kinase activity was confirmed by measuring the ability of p38 to phosphorylate ATF2. 293-TLR2 and 293-neo cells were exposed to 100 ng/ml LPS-sCD14 complexes or 100 ng/ml sBLP preincubated with sCD14 for increasing periods of time, and p38 was immunoprecipitated with an antibody that recognizes the dually phosphorylated form of the protein. An in vitro kinase assay measuring ATF2 phosphorylation demonstrated increasing p38 activity over a time course that paralleled p38 phosphorylation, reaching a maximum by 60 min (Figs. 3 and 5). Consistent with the lack of p38 phosphorylation in the 293-neo cells, there was no p38 enzymatic activity detected in these cells in response to LPS or sBLP up to 240 min.

Because activation of p38 leads to phosphorylation and activation of MAPKAP kinases, we measured MAPKAP kinase activity as an alternative way of assessing p38 activation. Stimulation of 293-TLR2 with LPS led to an increase in MAPKAP kinase activity, measured as phosphorylation of Hsp27, which was not observed in 293-neo cells. MAPKAP kinase activity was observed after 30 min and remained elevated for at least 90 min (Fig. 6A and B), consistent with the time course for activation of p38 in response to LPS. Further, MAPKAP kinase activity was inhibited when an inhibitor specific for p38 was added to the 293-TLR2 prior to stimulation with LPS (Fig. 6C) , demonstrating the dependence of this activity on p38.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 6. TLR2-dependent activation of MAPKAP kinase. Stable transfectants were incubated with comLPS-sCD14 complexes (100 ng/ml LPS) for the indicated times. Controls at 0 min received no comLPS. MAPKAP kinase activity was determined by measuring phosphorylation of exogenously added Hsp27 to the lysates using autoradiography (A) or phosphorimaging (B and C). (A and B) Time-dependent activation of MAPKAP kinase by LPS. (C) p38-dependent activation of MAPKAP kinase by LPS. Cells were preincubated for 1 h with or without the specific p38 inhibitor M39 (100 nM), before incubation with comLPS-sCD14 complexes for 2 h. The figure is representative of an experiment performed twice.


arrow
DISCUSSION
 
Microbial products may stimulate cells by directly or indirectly binding to TLR2 and TLR4. Binding comLPS to purified TLR2 has been demonstrated [10 , 30 ], although TLR2 apparently does not serve as a receptor for purified LPS [22 ]. In addition, two recent studies show that the species origin of TLR4 determines reactivity toward LPS partial structures known to be species-specific in their ability to stimulate cells [31 , 32 ]. These results suggest that LPS binds directly or indirectly to TLR4. However, further characterization is needed to understand how binding induces TLR-mediated signaling.

Upon recognition, bacterial agonists induce a cascade of intracellular signaling events that in turn modulate effectors of the innate-immune response, such as production of cytokines by monocytes and production of reactive-oxygen intermediates by neutrophils. Among the signaling molecules that have been identified as key to these responses are members of the MAPK family, and LPS and other bacterial products can cause MAPK activation [33 ]. Whether MAPK activation in response to bacterial products occurs via TLRs remains largely unexplored, and we have addressed this for TLR2 and p38 activation. In this study, we observed that TLR2 could endow otherwise unresponsive 293 cells with the ability to mediate activation of the p38 pathway in response to a variety of bacterial agonists. Moreover, our observation that lipoproteins, Gram-positive bacteria, and comLPS containing proteins but not protein-free LPS can induce TLR2-mediated p38 activation parallels the observation that these same products induce activation of NF-{kappa}B via TLR2. This suggests similarity in the initial events required for activation of p38 and NF-{kappa}B in response to microbial products with direct or indirect interaction with TLR2.

For NF-{kappa}B activation, the signal-transduction pathway triggered by TLR2 and TLR4 is similar to that described for the IL-1 receptor (R), involving the adaptor molecule MyD88, IL-1R-associated kinases (IRAK), the tumor necrosis factor receptor (TNFR)-activated factor (TRAF) 6, the NF-{kappa}B-inducing kinase (NIK), and the I{kappa}B kinase (IKK) complex [11 , 33 34 35 ] (see Fig. 7 ). For p38 activation, the pathway leading from IL-1 R is not defined completely, but a role for small GTP-binding proteins of the Ras superfamily has been suggested. Constitutively activated forms of Rac and cdc42 have been shown to induce p38 activation [36 ]. However, a study using toxins that inactivate Rac, cdc42, or Ras suggests that Ras is the essential protein for IL-1-mediated p38 activation [37 ]. Because our results suggest that TLR2 also functions as a signal transducer for activation of p38, it is likely that, given their structural homology, TLR2 may use a similar signaling pathway. The kinases that can directly activate p38 have been identified as MKK3 [38 ], MKK4 [39 ], and MKK6 [40 ] (see Fig. 7 ), but further work will be required to complete this pathway.



View larger version (94K):
[in this window]
[in a new window]
 
Figure 7. A model depicting signaling cascades for TLRs. Further details are given in the text.

Recently, the actin-binding protein filamin has been shown to be required for TLR4- and TRAF6-mediated activation of NF-{kappa}B [41 ]. Filamin interacts with Drosophila Toll and Tube [42 ], a protein that carries out functions partially analogous to MyD88, and with human TRAF2 [41 ], SEK-1 (MKK-4), and p38 [43 ]. In light of these results, Leonardi et al. [41 ] have proposed that filamin provides a scaffold upon which a TRAF-dependent NF-{kappa}B activation cascade can take place (see Fig. 7 ). Filamin may also provide a physical link between p38 and downstream effectors of TLRs, such as TRAF6.

Although none of the proteins that may link p38 to TLRs have been shown to be required for p38 activation by LPS, some have been implicated in p38 activation by other stimuli. For example, a TRAF6 dominant-negative mutant inhibits p38 activation by CD40 ligand in 293 cell lines [44 ], and IL-1-mediated p38 activation is reduced in IRAK-deficient fibroblasts [45 ]. Further studies will be required to assess the role of these proteins in activation of p38 by LPS. It is interesting that recent work has shown that monocytes from an MyD88 knockout (KO) mouse are still able to activate p38 in response to LPS [46 ], although they do so more slowly than wild-type cells, raising the possibility that TLRs can engage an as-yet uncharacterized pathway to activate p38.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 5. TLR2-dependent phosphorylation of ATF2 by p38 in response to LPS. Stable transfectants were incubated with 100 ng/ml comLPS-sCD14 complexes (A) or 100 ng/ml sBLP/sCD14 (B) for the indicated times. p38 activity was determined in an immune-complex kinase assay using GST-ATF2 as substrate. Phosphorylation of ATF2 was detected by Western blot using an antibody that recognizes phosphorylated ATF2 (see Materials and Methods).


arrow
ACKNOWLEDGEMENTS
 
We thank Rolf Thieringer for providing the recombinant sCD14, Elizabeth Somers for confirming that the p38 inhibitor was active, and Douglas Miller, Rolf Thieringer, and Norbert Lamping for critical reading of this manuscript.

Received May 18, 2001; revised September 27, 2001; accepted October 11, 2001.


arrow
REFERENCES
 
    1
  1. Kopp, E. B., Medzhitov, R. (1999) The Toll-receptor family and control of innate immunity Curr. Opin. Immunol. 11,13-18[Medline]
  2. 2
  3. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J. M., Hoffmann, J. A. (1996) The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults Cell 86,973-983[Medline]
  4. 3
  5. Williams, M. J., Rodriguez, A., Kimbrell, D. A., Eldon, E. D. (1997) The 18-wheeler mutation reveals complex antibacterial gene regulation in Drosophila host defense EMBO J 16,6120-6130[Medline]
  6. 4
  7. Medzhitov, R., Preston-Hurlburt, P., Janeway, C. A., Jr (1997) A human homologue of the Drosophila Toll protein signals activation of adaptive immunity Nature 388,394-397[Medline]
  8. 5
  9. Rock, F. L., Hardiman, G., Timans, J. C., Kastelein, R. A., Bazan, J. F. (1998) A family of human receptors structurally related to Drosophila Toll Proc. Natl. Acad. Sci. USA 95,588-593[Abstract/Free Full Text]
  10. 6
  11. Takeuchi, O., Kawai, T., Sanjo, H., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Takeda, K., Akira, S. (1999) TLR6: a novel member of an expanding Toll-like receptor family Gene 231,59-65[Medline]
  12. 7
  13. Du, X., Poltorak, A., Wei, Y., Beutler, B. (2000) Three novel mammalian Toll-like receptors: gene structure, expression, and evolution Eur. Cytokine Netw. 11,362-371[Medline]
  14. 8
  15. Qureshi, S. T., Lariviere, L., Leveque, G., Clermont, S., Moore, K. J., Gros, P., Malo, D. (1999) Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4) J. Exp. Med. 189,615-625[Abstract/Free Full Text]
  16. 9
  17. Poltorak, A., He, X., Smirnova, I., Liu, M. Y., Huffel, C. V., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M., Ricciardi-Castagnoli, P., Layton, B., Beutler, B. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene Science 282,2085-2085[Abstract/Free Full Text]
  18. 10
  19. Yang, R. B., Mark, M. R., Gray, A., Huang, A., Xie, M. H., Zang, M., Goddard, A., Wood, W. I., Gurney, A. L., Godowski, P. J. (1998) Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signalling Nature 395,284-288[Medline]
  20. 11
  21. Kirschning, C. J., Wesche, H., Merrill Ayres, T., Rothe, M. (1998) Human Toll-like receptor 2 confers responsiveness to bacterial lipopolysaccharide J. Exp. Med. 188,2091-2097[Abstract/Free Full Text]
  22. 12
  23. Yoshimura, A., Lien, E., Ingalls, R. R., Tuomanen, E., Dziarski, R., Golenbock, D. (1999) Recognition of Gram-positive bacterial cell wall components by the innate immune system occurs via Toll-like receptor 2 J. Immunol. 163,1-5[Abstract/Free Full Text]
  24. 13
  25. Schwandner, R., Dziarski, R., Wesche, H., Rothe, M., Kirschning, C. J. (1999) Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by Toll-like receptor 2 J. Biol. Chem. 274,17406-17409[Abstract/Free Full Text]
  26. 14
  27. Brightbill, H. D., Libraty, D. H., Krutzik, S. R., Yang, R. B., Belisle, J. T., Bleharski, J. R., Maitland, M., Norgard, M. V., Plevy, S. E., Smale, S. T., Brennan, P. J., Bloom, B. R., Godowski, P. J., Modlin, R. L. (1999) Host defense mechanisms triggered by microbial lipoproteins through Toll-like receptors Science 285,732-736[Abstract/Free Full Text]
  28. 15
  29. Hirschfeld, M., Kirschning, C. J., Schwandner, R., Wesche, H., Weis, J. H., Wooten, R. M., Weis, J. J. (1999) Cutting edge: inflammatory signaling by Borrelia burgdorferi lipoproteins is mediated by Toll-like receptor 2 J. Immunol. 163,2382-2386[Abstract/Free Full Text]
  30. 16
  31. Han, J., Lee, J. D., Bibbs, L., Ulevitch, R. J. (1994) A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells Science 265,808-811[Abstract/Free Full Text]
  32. 17
  33. Lee, J. C., Laydon, J. T., McDonnell, P. C., Gallagher, T. F., Kumar, S., Green, D., McNulty, D., Blumenthal, M. J., Heys, J. R., Landvatter, S. W., et al (1994) A protein kinase involved in the regulation of inflammatory cytokine biosynthesis Nature 372,739-746[Medline]
  34. 18
  35. Nick, J. A., Avdi, N. J., Gerwins, P., Johnson, G. L., Worthen, G. S. (1996) Activation of a p38 mitogen-activated protein kinase in human neutrophils by lipopolysaccharide J. Immunol. 156,4867-4875[Abstract]
  36. 19
  37. Detmers, P. A., Zhou, D., Polizzi, E., Thieringer, R., Hanlon, W. A., Vaidya, S., Bansal, V. (1998) Role of stress-activated mitogen-activated protein kinase (p38) in beta 2-integrin-dependent neutrophil adhesion and the adhesion-dependent oxidative burst J. Immunol. 161,1921-1929[Abstract/Free Full Text]
  38. 20
  39. Hailman, E., Vasselon, T., Kelley, M., Busse, L. A., Hu, M. C., Lichenstein, H. S., Detmers, P. A., Wright, S. D. (1996) Stimulation of macrophages and neutrophils by complexes of lipopolysaccharide and soluble CD14 J. Immunol. 156,4384-4390[Abstract]
  40. 21
  41. Manthey, C. L., Vogel, S. N. (1994) Elimination of trace endotoxin protein from rough chemotype LPS J. Endotoxin Res. 1,84-91
  42. 22
  43. Hirschfeld, M., Ma, Y., Weis, J. H., Vogel, S. N., Weis, J. J. (2000) Repurification of lipopolysaccharide eliminates signaling through both human and murine Toll-like receptor 2 J. Immunol. 165,618-622[Abstract/Free Full Text]
  44. 23
  45. Liverton, N. J., Butcher, J. W., Claiborne, C. F., Claremon, D. A., Libby, B. E., Nguyen, K. T., Pitzenberger, S. M., Selnick, H. G., Smith, G. R., Tebben, A., Vacca, J. P., Varga, S. L., Agarwal, L., Dancheck, K., Forsyth, A. J., Fletcher, D. S., Frantz, B., Hanlon, W. A., Harper, C. F., Hofsess, S. J., Kostura, M., Lin, J., Luell, S., O’Neill, E. A., O’Keefe, S. J., et al (1999) Design and synthesis of potent, selective, and orally bioavailable tetrasubstituted imidazole inhibitors of p38 mitogen-activated protein kinase J. Med. Chem. 42,2180-2190[Medline]
  46. 24
  47. Aliprantis, A. O., Yang, R. B., Mark, M. R., Suggett, S., Devaux, B., Radolf, J. D., Klimpel, G. R., Godowski, P., Zychlinsky, A. (1999) Cell activation and apoptosis by bacterial lipoproteins through Toll-like receptor-2 Science 285,736-739[Abstract/Free Full Text]
  48. 25
  49. Wright, S. D., Ramos, R. A., Tobias, P. S., Ulevitch, R. J., Mathison, J. C. (1990) CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein Science 249,1431-1433[Abstract/Free Full Text]
  50. 26
  51. Haziot, A., Ferrero, E., Kontgen, F., Hijiya, N., Yamamoto, S., Silver, J., Stewart, C. L., Goyert, S. M. (1996) Resistance to endotoxin shock and reduced dissemination of Gram-negative bacteria in CD14-deficient mice Immunity 4,407-414[Medline]
  52. 27
  53. Wooten, R. M., Morrison, T. B., Weis, J. H., Wright, S. D., Thieringer, R., Weis, J. J. (1998) The role of CD14 in signaling mediated by outer membrane lipoproteins of Borrelia burgdorferi J. Immunol. 160,5485-5492[Abstract/Free Full Text]
  54. 28
  55. Sellati, T. J., Bouis, D. A., Kitchens, R. L., Darveau, R. P., Pugin, J., Ulevitch, R. J., Gangloff, S. C., Goyert, S. M., Norgard, M. V., Radolf, J. D. (1998) Treponema pallidum and Borrelia burgdorferi lipoproteins and synthetic lipopeptides activate monocytic cells via a CD14-dependent pathway distinct from that used by lipopolysaccharide J. Immunol. 160,5455-5464[Abstract/Free Full Text]
  56. 29
  57. Giambartolomei, G. H., Dennis, V. A., Lasater, B. L., Philipp, M. T. (1999) Induction of pro- and anti-inflammatory cytokines by Borrelia burgdorferi lipoproteins in monocytes is mediated by CD14 Infect. Immun. 67,140-147[Abstract/Free Full Text]
  58. 30
  59. Yang, R. B., Mark, M. R., Gurney, A. L., Godowski, P. J. (1999) Signaling events induced by lipopolysaccharide-activated Toll-like receptor 2 J. Immunol. 163,639-643[Abstract/Free Full Text]
  60. 31
  61. Lien, E., Means, T. K., Heine, H., Yoshimura, A., Kusumoto, S., Fukase, K., Fenton, M. J., Oikawa, M., Qureshi, N., Monks, B., Finberg, R. W., Ingalls, R. R., Golenbock, D. T. (2000) Toll-like receptor 4 imparts ligand-specific recognition of bacterial lipopolysaccharide J. Clin. Investig. 105,497-504[Medline]
  62. 32
  63. Poltorak, A., Ricciardi-Castagnoli, P., Citterio, S., Beutler, B. (2000) Physical contact between lipopolysaccharide and Toll-like receptor 4 revealed by genetic complementation Proc. Natl. Acad. Sci. USA 97,2163-2167[Abstract/Free Full Text]
  64. 33
  65. Muzio, M., Natoli, G., Saccani, S., Levrero, M., Mantovani, A. (1998) The human Toll signaling pathway: divergence of nuclear factor kappaB and JNK/SAPK activation upstream of tumor necrosis factor receptor-associated factor 6 (TRAF6) J. Exp. Med. 187,2097-2101[Abstract/Free Full Text]
  66. 34
  67. Medzhitov, R., Preston-Hurlburt, P., Kopp, E., Stadlen, A., Chen, C., Ghosh, S., Janeway, C. A., Jr (1998) MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways Mol. Cell 2,253-258[Medline]
  68. 35
  69. Zhang, F. X., Kirschning, C. J., Mancinelli, R., Xu, X. P., Jin, Y., Faure, E., Mantovani, A., Rothe, M., Muzio, M., Arditi, M. (1999) Bacterial lipopolysaccharide activates nuclear factor-kappaB through interleukin-1 signaling mediators in cultured human dermal endothelial cells and mononuclear phagocytes J. Biol. Chem. 274,7611-7614[Abstract/Free Full Text]
  70. 36
  71. Minden, A., Lin, A., Claret, F. X., Abo, A., Karin, M. (1995) Selective activation of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs Cell 81,1147-1157[Medline]
  72. 37
  73. Palsson, E. M., Popoff, M., Thelestam, M., O’Neill, L. A. (2000) Divergent roles for Ras and Rap in the activation of p38 mitogen-activated protein kinase by interleukin-1 J. Biol. Chem. 275,7818-7825[Abstract/Free Full Text]
  74. 38
  75. Derijard, B., Raingeaud, J., Barrett, T., Wu, I. H., Han, J., Ulevitch, R. J., Davis, R. J. (1995) Independent human MAP-kinase signal transduction pathways defined by MEK and MKK isoforms Science 267,682-685[Abstract/Free Full Text]
  76. 39
  77. Guan, Z., Buckman, S. Y., Miller, B. W., Springer, L. D., Morrison, A. R. (1998) Interleukin-1beta-induced cyclooxygenase-2 expression requires activation of both c-Jun NH2-terminal kinase and p38 MAPK signal pathways in rat renal mesangial cells J. Biol. Chem. 273,28670-28676[Abstract/Free Full Text]
  78. 40
  79. Cuenda, A., Alonso, G., Morrice, N., Jones, M., Meier, R., Cohen, P., Nebreda, A. R. (1996) Purification and cDNA cloning of SAPKK3, the major activator of RK/p38 in stress- and cytokine-stimulated monocytes and epithelial cells EMBO J 15,4156-4164[Medline]
  80. 41
  81. Leonardi, A., Ellinger-Ziegelbauer, H., Franzoso, G., Brown, K., Siebenlist, U. (2000) Physical and functional interaction of filamin (actin-binding protein-280) and tumor necrosis factor receptor-associated factor 2 J. Biol. Chem. 275,271-278[Abstract/Free Full Text]
  82. 42
  83. Edwards, D. N., Towb, P., Wasserman, S. A. (1997) An activity-dependent network of interactions links the Rel protein Dorsal with its cytoplasmic regulators Development 124,3855-3864[Abstract]
  84. 43
  85. Marti, A., Luo, Z., Cunningham, C., Ohta, Y., Hartwig, J., Stossel, T. P., Kyriakis, J. M., Avruch, J. (1997) Actin-binding protein-280 binds the stress-activated protein kinase (SAPK) activator SEK-1 and is required for tumor necrosis factor-alpha activation of SAPK in melanoma cells J. Biol. Chem. 272,2620-2628[Abstract/Free Full Text]
  86. 44
  87. Pullen, S. S., Dang, T. T., Crute, J. J., Kehry, M. R. (1999) CD40 signaling through tumor necrosis factor receptor-associated factors (TRAFs). Binding site specificity and activation of downstream pathways by distinct TRAFs J. Biol. Chem. 274,14246-14254[Abstract/Free Full Text]
  88. 45
  89. Kanakaraj, P., Schafer, P. H., Cavender, D. E., Wu, Y., Ngo, K., Grealish, P. F., Wadsworth, S. A., Peterson, P. A., Siekierka, J. J., Harris, C. A., Fung-Leung, W. P. (1998) Interleukin (IL)-1 receptor-associated kinase (IRAK) requirement for optimal induction of multiple IL-1 signaling pathways and IL-6 production J. Exp. Med. 187,2073-2079[Abstract/Free Full Text]
  90. 46
  91. Kawai, T., Adachi, O., Ogawa, T., Takeda, K., Akira, S. (1999) Unresponsiveness of MyD88-deficient mice to endotoxin Immunity 11,115-122[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
J. Nigou, T. Vasselon, A. Ray, P. Constant, M. Gilleron, G. S. Besra, I. Sutcliffe, G. Tiraby, and G. Puzo
Mannan Chain Length Controls Lipoglycans Signaling via and Binding to TLR2
J. Immunol., May 15, 2008; 180(10): 6696 - 6702.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Vasselon, P. A. Detmers, D. Charron, and A. Haziot
TLR2 Recognizes a Bacterial Lipopeptide through Direct Binding
J. Immunol., December 15, 2004; 173(12): 7401 - 7405.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Aleman, P. Schierloh, S. S. de la Barrera, R. M. Musella, M. A. Saab, M. Baldini, E. Abbate, and M. C. Sasiain
Mycobacterium tuberculosis Triggers Apoptosis in Peripheral Neutrophils Involving Toll-Like Receptor 2 and p38 Mitogen Protein Kinase in Tuberculosis Patients
Infect. Immun., September 1, 2004; 72(9): 5150 - 5158.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Siedlar, M. Frankenberger, E. Benkhart, T. Espevik, M. Quirling, K. Brand, M. Zembala, and L. Ziegler-Heitbrock
Tolerance Induced by the Lipopeptide Pam3Cys Is Due to Ablation of IL-1R-Associated Kinase-1
J. Immunol., August 15, 2004; 173(4): 2736 - 2745.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Fernandez, P. Jose, M. G. Avdiushko, A. M. Kaplan, and D. A. Cohen
Inhibition of IL-10 Receptor Function in Alveolar Macrophages by Toll-Like Receptor Agonists
J. Immunol., February 15, 2004; 172(4): 2613 - 2620.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. J. Gehring, R. E. Rojas, D. H. Canaday, D. L. Lakey, C. V. Harding, and W. H. Boom
The Mycobacterium tuberculosis 19-Kilodalton Lipoprotein Inhibits Gamma Interferon-Regulated HLA-DR and Fc{gamma}R1 on Human Macrophages through Toll-Like Receptor 2
Infect. Immun., August 1, 2003; 71(8): 4487 - 4497.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Compton, E. A. Kurt-Jones, K. W. Boehme, J. Belko, E. Latz, D. T. Golenbock, and R. W. Finberg
Human Cytomegalovirus Activates Inflammatory Cytokine Responses via CD14 and Toll-Like Receptor 2
J. Virol., April 15, 2003; 77(8): 4588 - 4596.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vasselon, T.
Right arrow Articles by Detmers, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vasselon, T.
Right arrow Articles by Detmers, P. A.