Merck Research Laboratories, Rahway, New Jersey
Correspondence: Dr. Patricia A. Detmers, Merck Research Laboratories, 126 East Lincoln Avenue, RY80W-250, Rahway, NJ 07065. E-mail: patricia_detmers{at}merck.com
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B and stress-activated MAP kinase
p38. Recent studies have shown that the human Toll-like receptor 2
(TLR2) mediates activation of NF-B in response to commercial
preparations of LPS (comLPS), membrane lipoproteins, and Gram-positive
bacterial products. Here, we show that expression of TLR2 in human
embryonic kidney 293 cells enabled p38 phosphorylation in response to
comLPS, a synthetic bacterial lipoprotein, and B. subtilis.
Activation of p38 was confirmed by an in vitro kinase assay using ATF2
as substrate and by an assay measuring activation of the downstream
effector of p38, MAP kinase-activated protein kinase in cells. Thus,
TLR2 initiated the signaling pathway for p38 in response to
bacterial products.
Key Words: lipopolysaccharide • signal transduction • cell-surface molecules • protein kinases • infectious immunity bacteria
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-B (NF-B), to signal responses.
Recently, a family of transmembrane proteins with intracellular
homology to the interleukin (IL)-1 receptor family has been identified
and shown to transduce a signal for activation of NF-B in response
to infection (for a review, see ref. [1
]). In
Drosophila, Toll and a close homolog, 18-wheeler, mediate
NF-B activation in response to fungi and bacteria, leading to the
synthesis of antimicrobial peptides [2
, 3
].
Nine mammalian Toll-like receptors (TLRs) have been identified
[4
5
6
7
], and three TLRs have been shown to participate in
responses to microbial determinants. TLR4 (hToll) was identified as the
defective protein in two mouse strains that exhibit an impaired ability
to respond to LPS [8
, 9
]. In addition, TLR2
endows an otherwise unresponsive human cell line with the ability to
activate NF-B in response to a wide variety of bacterial agonists,
including commercial preparations of LPS (comLPS), Gram-positive
bacterial cell-wall components, and lipoproteins
[10
11
12
13
14
15
]. Thus, TLRs appear to be key in regulating one
aspect of the innate-immune response.
Stress-activated mitogen-activated protein kinase (MAPK) p38 has also been identified as an important component of innate-immune responses to LPS. p38 is a highly conserved protein kinase that acts to regulate cell growth, differentiation, and stress responses. Cellular recognition of LPS causes phosphorylation and subsequent activation of p38 [16 ]. This, in turn, modulates activation of several transcription factors and other downstream kinases, such as the MAPK-activated protein (MAPKAP) kinases. Further, p38 activity also modulates the production of cytokines by monocytes in response to LPS, and specific inhibitors of p38 activity block this response [17 ]. In addition to regulating protein-synthetic pathways, p38 is required for adhesion and production of reactive oxygen intermediates by neutrophils in response to LPS, a very rapid innate-immune response [18 , 19 ].
We demonstrate here that TLR2 can mediate activation of p38 and its
downstream effector MAPKAP kinase in 293 cells. Moreover, the
observation that TLR2 activates p38 in response to a synthetic
bacterial lipoprotein, a Gram-positive bacteria, and comLPS but not
protein-free LPS suggests that TLR2 activates p38 with the same
specificity that it activates NF-B.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Plasmid preparation
The 3 x NF-B-driven luciferase construct pNF-B-luc
was obtained from Stratagene (La Jolla, CA). The expression vector
pcDNA3.1 was obtained from Invitrogen (Carlsbad, CA), and the plasmid
pEGFP-N1, which constitutively expresses the enhanced green fluorescent
protein (EGFP), was from Clontech (Palo Alto, CA). The coding region
for TLR2 (accession number NM_003264) was amplified by reverse
transcriptase-polymerase chain reaction (RT-PCR) from human spleen mRNA
(Clontech), cloned into pcDNA3.1, and sequenced. TLR2 was tagged with
an NH2-terminal Flag epitope by inserting the sequence
caaggaagactacaaggacgacgatgacaagtc at the EcoNI site of TLR2.
Stable transfectants
293 Cells were transfected using lipofectamine, according to the
instructions of the manufacturer (Gibco-BRL, Grand Island, NY). Stable
expression of TLR2 was obtained by transfection of pFlag-TLR2 into 293
cells. After selection with G418 (400 µg/ml), clonal cell lines
expressing human TLR2 were tested for their ability to respond to
comLPS using a NF-B-dependent luciferase reporter gene assay.
Transient transfections
293 Cells were plated onto a 96-well plate at 0.3 x
105 cells/well the day before transfection. The
semiconfluent cells were transfected with a DNA-lipofectamine mixture
containing 25 ng luciferase reporter construct, 50 ng pEGFP-N1 plasmid,
and 25 ng pTLR2 or control pcDNA3 per well. All transfections were
performed in triplicate and were repeated at least two times.
NF-B reporter assay
The cells were lysed using 100 µl/well cell-culture lysis
reagent (Promega, Madison, WI). EGFP fluorescence was measured using a
Spectrafluor Plus plate reader (TECAN, Durham, NC) to normalize for
transfection efficiencies. Luciferase assay reagent (100 µl; Cat
#E1483; Promega) was then added to each well, and the luminescence was
measured immediately in an ML3000 microtiter plate luminometer
(Dynatech Laboratories, Chantilly, VA). Relative luminescence units are
expressed as (1000xluminescence)/EGFP fluorescence.
Anti-Flag immunoblotting
For each cell line, 106 cells were lysed by
incubation on ice with 400 µl sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE) sample buffer. Lysates were centrifuged
for 5 min at 12,000 g, and 20 µl of each supernatant were
run on SDS-PAGE under reducing conditions. Proteins were
electrotransferred to a nitrocellulose membrane and detected with a
biotinylated anti-Flag murine monoclonal antibody (mAb; Sigma Chemical
Co.). Horseradish peroxidase-conjugated antibiotin Ab (New England
Biolabs, Beverly, MA) was used as the secondary antibody. Labeling was
detected with a chemiluminescence-detection system (New England
Biolabs).
Phosphorylation of p38 MAPK
Cells grown to semiconfluence in 96-well tissue-culture plates
were washed once with PBS and lysed in SDS sample buffer (20
µl/well). Lysates from triplicate wells were pooled and boiled for 5
min. SDS-PAGE of the lysates was followed by Western blot analysis with
an antibody recognizing p38 phosphorylated on thr180 and
tyr182 (New England Biolabs). Labeling was detected with a
chemiluminescence detection system (New England Biolabs). Blots were
subsequently stripped and reprobed with an anti-p38 polyclonal antibody
to control for variations in sample volumes.
Activating transcription factor 2 (ATF2) phosphorylation by p38
Phosphorylation of ATF2 by activated p38 MAPK was measured using
a kit (New England Biolabs; Cat #9820) following the manufacturer’s
instructions. Briefly, cells grown in 100 mm dishes to 75–80%
confluence were washed once with PBS and lysed in cell-lysis buffer
[20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM ethylenediaminetetraacetate
(EDTA), 1 mM
ethyleneglycol-bis(ß-aminoethylether)-N,N'-tetraacetic
acid (EGTA), 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM
ß-glycerolphosphate, 1 mM Na3VO4, 1 µg/ml
leupeptin, and 1 mM phenylmethylsulfonyl fluoride (PMSF)]. p38 from
200 µg of cleared lysate was immunoprecipitated using an antibody
recognizing p38 phosphorylated on thr180 and
tyr182. The resulting immunoprecipitate was incubated with
2 µg glutathione-S-transferase (GST)-ATF2 in kinase buffer
[25 mM Tris, pH 7.5, 5 mM ß-glycerolphosphate, 2 mM dithiothreitol
(DTT), 0.1 mM Na3VO4, and 10 mM
MgCl2] in the presence of 200 µM adenosine
5'-triphosphate (ATP). Phosphorylation of ATF2 by active p38 was
detected in Western blots of the assay mixture, using an antibody that
recognizes ATF2 phosphorylated on thr71.
MAPKAP in vitro kinase assay
Phosphorylation of Hsp27 by MAPKAP kinase in cell lysates was
measured as described previously [19
], using
recombinant-purified Hsp27, 33P-ATP, and autoradiography
for detection of phosphorylated Hsp27 after PAGE. Phosphorylated
protein was quantitated with a phosphorimager.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B in response to various bacterial agonistsB (Fig. 2 A
), consistent with results from previous studies
[10
, 11
]. Recently, it has been
demonstrated that contaminating bacterial products contained in comLPS
are responsible for stimulating responses through TLR2
[22
], because responses to purified LPS depend on the
presence of TLR4. Nevertheless, comLPS represents an easily available
source of Gram-negative bacterial products that stimulate NF-B
through TLR2. TLR2 expression also enabled the cells to activate
NF-B in response to the synthetic bacterial lipopeptide sBLP and
Gram-positive products (Fig. 2B
; and unpublished results), as has been
shown previously [12
13
14
, 24
]. Although
addition of sCD14 along with sBLP slightly decreased the concentration
of sBLP required to see a response, preincubation of sBLP with sCD14
greatly enhanced the sensitivity of NF-B activation by sBLP (more
than 100-fold). Thus, the TLR2 was shown to be expressed and active for
generating signals in response to bacterial products.
 View larger version (33K): [in a new window] |
Figure 1. Expression of TLR2. Lysates from 293-neo clone 1 and 293-TLR2 clones 18
and 6 were run on SDS-PAGE and immunoblotted. TLR2 was detected with an
anti-Flag antibody as described in Materials and Methods.
|
 View larger version (21K): [in a new window] |
Figure 2. TLR2-dependent activation of NF-B by bacterial agonists. 293 Cells
grown in 96-well plates were transiently transfected for the NF-B
reporter assay as described in Materials and Methods. Forty-eight hours
later, cells were washed, resuspended in Dulbecco’s modified Eagle’s
medium (DMEM)-HSA, and incubated with increasing concentrations of
agonists for 6 h. Activation of NF-B was measured by
luminescence as described in Materials and Methods. Results are
expressed as the mean of triplicate wells ± SE. (A)
293-neo and 293-TLR2 clones 18 and 6 were incubated with comLPS-sCD14
complexes. (B) 293-neo and 293-TLR2 were incubated with sBLP, sBLP
preincubated with sCD14 (sBLP/sCD14), or added at the same time as
sCD14 (sBLP+sCD14).
|
 View larger version (71K): [in a new window] |
Figure 3. TLR2-dependent phosphorylation of p38 in response to comLPS, sBLP, and
B. subtilis but not to repurified LPS. Following stimulation
with comLPS, B. subtilis, or sBLP, lysates of stable
transfectants were Western blotted to assess phosphorylation of p38
(pp38). Blots were stripped and reprobed with anti-p38 (p38). (A)
Time-dependent activation of p38 by comLPS. Cells were incubated with
comLPS-sCD14 complexes (100 ng/ml LPS) for the indicated times. (B)
Time-dependent activation of p38 by B. subtilis. Cells were
incubated with bacteria (10 µg/ml lyophilized cells) for the
indicated times. (C) Time-dependent activation of p38 by sBLP. Cells
were incubated with sBLP/sCD14 (10 ng/ml sBLP) for the
indicated times.
|
B in response to sBLP can be enhanced by
preincubating sCD14 and BLP (Fig. 2B)
. To confirm that CD14 is required
for p38 activation, we compared the responses of 293-TLR2 cells with
comLPS and sBLP in the absence of sCD14 or after preincubation of the
lipids with sCD14, as described in Materials and Methods.
Phosphorylation of p38 was observed in the absence of sCD14, but the
concentrations of comLPS and sBLP required for the response were at
least 100-fold higher at 30 min than those required to stimulate p38
phosphorylation by comLPS-sCD14 or sBLP preincubated with sCD14
(Fig. 4A
and B).
 View larger version (79K): [in a new window] |
Figure 4. CD14-dependence of p38 activation by comLPS and sBLP. Cells were
incubated with the indicated concentrations of bacterial product for
1 h at 37°C, and p38 phosphorylation was detected as described
in Figure 3
. (A) Cells were incubated with comLPS micelles or
comLPS-sCD14. (B) Cells were incubated with sBLP or sBLP/sCD14. (C)
293-TLR2 cells were incubated with re-extracted LPS micelles or
re-extracted LPS-sCD14 complexes.
|
TLR2 stimulation activates p38
Activation of p38 kinase activity was confirmed by measuring the
ability of p38 to phosphorylate ATF2. 293-TLR2 and 293-neo cells were
exposed to 100 ng/ml LPS-sCD14 complexes or 100 ng/ml sBLP preincubated
with sCD14 for increasing periods of time, and p38 was
immunoprecipitated with an antibody that recognizes the dually
phosphorylated form of the protein. An in vitro kinase assay measuring
ATF2 phosphorylation demonstrated increasing p38 activity over a time
course that paralleled p38 phosphorylation, reaching a maximum by 60
min (Figs. 3 and 5).
Consistent with the lack of p38 phosphorylation in the 293-neo cells,
there was no p38 enzymatic activity detected in these cells in response
to LPS or sBLP up to 240 min.
Because activation of p38 leads to phosphorylation and activation of MAPKAP kinases, we measured MAPKAP kinase activity as an alternative way of assessing p38 activation. Stimulation of 293-TLR2 with LPS led to an increase in MAPKAP kinase activity, measured as phosphorylation of Hsp27, which was not observed in 293-neo cells. MAPKAP kinase activity was observed after 30 min and remained elevated for at least 90 min (Fig. 6A and B), consistent with the time course for activation of p38 in response to LPS. Further, MAPKAP kinase activity was inhibited when an inhibitor specific for p38 was added to the 293-TLR2 prior to stimulation with LPS (Fig. 6C) , demonstrating the dependence of this activity on p38.
 View larger version (23K): [in a new window] |
Figure 6. TLR2-dependent activation of MAPKAP kinase. Stable transfectants were
incubated with comLPS-sCD14 complexes (100 ng/ml LPS) for the indicated
times. Controls at 0 min received no comLPS. MAPKAP kinase activity was
determined by measuring phosphorylation of exogenously added Hsp27 to
the lysates using autoradiography (A) or phosphorimaging (B and C). (A
and B) Time-dependent activation of MAPKAP kinase by LPS. (C)
p38-dependent activation of MAPKAP kinase by LPS. Cells were
preincubated for 1 h with or without the specific p38 inhibitor
M39 (100 nM), before incubation with comLPS-sCD14 complexes for 2 h. The figure is representative of an experiment performed twice.
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Upon recognition, bacterial agonists induce a cascade of intracellular
signaling events that in turn modulate effectors of the innate-immune
response, such as production of cytokines by monocytes and production
of reactive-oxygen intermediates by neutrophils. Among the signaling
molecules that have been identified as key to these responses are
members of the MAPK family, and LPS and other bacterial products can
cause MAPK activation [33
]. Whether MAPK activation in
response to bacterial products occurs via TLRs remains largely
unexplored, and we have addressed this for TLR2 and p38 activation. In
this study, we observed that TLR2 could endow otherwise unresponsive
293 cells with the ability to mediate activation of the p38 pathway in
response to a variety of bacterial agonists. Moreover, our observation
that lipoproteins, Gram-positive bacteria, and comLPS containing
proteins but not protein-free LPS can induce TLR2-mediated p38
activation parallels the observation that these same products induce
activation of NF-B via TLR2. This suggests similarity in the initial
events required for activation of p38 and NF-B in response to
microbial products with direct or indirect interaction with TLR2.
For NF-B activation, the signal-transduction pathway triggered by
TLR2 and TLR4 is similar to that described for the IL-1 receptor (R),
involving the adaptor molecule MyD88, IL-1R-associated kinases (IRAK),
the tumor necrosis factor receptor (TNFR)-activated factor (TRAF) 6,
the NF-B-inducing kinase (NIK), and the IB kinase (IKK) complex
[11
, 33
34
35
] (see Fig. 7
). For p38 activation, the pathway leading from IL-1 R is not defined
completely, but a role for small GTP-binding proteins of the Ras
superfamily has been suggested. Constitutively activated forms of Rac
and cdc42 have been shown to induce p38 activation [36
].
However, a study using toxins that inactivate Rac, cdc42, or Ras
suggests that Ras is the essential protein for IL-1-mediated p38
activation [37
]. Because our results suggest that TLR2
also functions as a signal transducer for activation of p38, it is
likely that, given their structural homology, TLR2 may use a similar
signaling pathway. The kinases that can directly activate p38 have been
identified as MKK3 [38
], MKK4 [39
], and
MKK6 [40
] (see Fig. 7
), but further work will be
required to complete this pathway.
 View larger version (94K): [in a new window] |
Figure 7. A model depicting signaling cascades for TLRs. Further details are
given in the text.
|
B
[41
]. Filamin interacts with Drosophila Toll
and Tube [42
], a protein that carries out functions
partially analogous to MyD88, and with human TRAF2 [41
],
SEK-1 (MKK-4), and p38 [43
]. In light of these results,
Leonardi et al. [41
] have proposed that filamin provides
a scaffold upon which a TRAF-dependent NF-B activation cascade can
take place (see Fig. 7
). Filamin may also provide a physical link
between p38 and downstream effectors of TLRs, such as TRAF6. Although none of the proteins that may link p38 to TLRs have been shown to be required for p38 activation by LPS, some have been implicated in p38 activation by other stimuli. For example, a TRAF6 dominant-negative mutant inhibits p38 activation by CD40 ligand in 293 cell lines [44 ], and IL-1-mediated p38 activation is reduced in IRAK-deficient fibroblasts [45 ]. Further studies will be required to assess the role of these proteins in activation of p38 by LPS. It is interesting that recent work has shown that monocytes from an MyD88 knockout (KO) mouse are still able to activate p38 in response to LPS [46 ], although they do so more slowly than wild-type cells, raising the possibility that TLRs can engage an as-yet uncharacterized pathway to activate p38.
 View larger version (51K): [in a new window] |
Figure 5. TLR2-dependent phosphorylation of ATF2 by p38 in response to LPS.
Stable transfectants were incubated with 100 ng/ml comLPS-sCD14
complexes (A) or 100 ng/ml sBLP/sCD14 (B) for the indicated times. p38
activity was determined in an immune-complex kinase assay using
GST-ATF2 as substrate. Phosphorylation of ATF2 was detected by Western
blot using an antibody that recognizes phosphorylated ATF2 (see
Materials and Methods).
|
Received May 18, 2001; revised September 27, 2001; accepted October 11, 2001.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
 |
|
 |
|
  J. Nigou, T. Vasselon, A. Ray, P. Constant, M. Gilleron, G. S. Besra, I. Sutcliffe, G. Tiraby, and G. Puzo Mannan Chain Length Controls Lipoglycans Signaling via and Binding to TLR2 J. Immunol., May 15, 2008; 180(10): 6696 - 6702. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Vasselon, P. A. Detmers, D. Charron, and A. Haziot TLR2 Recognizes a Bacterial Lipopeptide through Direct Binding J. Immunol., December 15, 2004; 173(12): 7401 - 7405. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Aleman, P. Schierloh, S. S. de la Barrera, R. M. Musella, M. A. Saab, M. Baldini, E. Abbate, and M. C. Sasiain Mycobacterium tuberculosis Triggers Apoptosis in Peripheral Neutrophils Involving Toll-Like Receptor 2 and p38 Mitogen Protein Kinase in Tuberculosis Patients Infect. Immun., September 1, 2004; 72(9): 5150 - 5158. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Siedlar, M. Frankenberger, E. Benkhart, T. Espevik, M. Quirling, K. Brand, M. Zembala, and L. Ziegler-Heitbrock Tolerance Induced by the Lipopeptide Pam3Cys Is Due to Ablation of IL-1R-Associated Kinase-1 J. Immunol., August 15, 2004; 173(4): 2736 - 2745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Fernandez, P. Jose, M. G. Avdiushko, A. M. Kaplan, and D. A. Cohen Inhibition of IL-10 Receptor Function in Alveolar Macrophages by Toll-Like Receptor Agonists J. Immunol., February 15, 2004; 172(4): 2613 - 2620. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Gehring, R. E. Rojas, D. H. Canaday, D. L. Lakey, C. V. Harding, and W. H. Boom The Mycobacterium tuberculosis 19-Kilodalton Lipoprotein Inhibits Gamma Interferon-Regulated HLA-DR and Fc{gamma}R1 on Human Macrophages through Toll-Like Receptor 2 Infect. Immun., August 1, 2003; 71(8): 4487 - 4497. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Compton, E. A. Kurt-Jones, K. W. Boehme, J. Belko, E. Latz, D. T. Golenbock, and R. W. Finberg Human Cytomegalovirus Activates Inflammatory Cytokine Responses via CD14 and Toll-Like Receptor 2 J. Virol., April 15, 2003; 77(8): 4588 - 4596. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
