* Department of Molecular Genetics, Ohio State University Columbus;
Department of Hematology and Oncology, University of Regensburg, Germany; and
Departments of Microbiology and Biochemistry and the Centre for Molecular and Cellular Biology, University of Queensland, Brisbane, Australia
Correspondence: Michael C. Ostrowski, Department of Molecular Genetics, Ohio State University, 484 W. 12th Ave., Columbus, OH 43210. E-mail: ostrowski.4{at}osu.edu
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: myeloid differentiation • protein dimerization
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Osteoclasts differentiate from a precursor of myeloid origin to become mature, multinuclear cells capable of resorbing bone [10 ]. Mice homozygous for the mutant mi allele develop severe osteopetrosis as a result of a failure of mononuclear precursors to mature into multinuclear osteoclasts capable of bone resorption, but macrophage differentiation is not grossly affected in mi mice [11 12 13 ]. Therefore, MITF action also appears important in distinguishing among the closely related myeloid cell types, the macrophage and the osteoclast. Understanding how MITF regulates gene expression in osteoclasts may provide unique insights into the molecular mechanisms that control terminal differentiation of this specialized cell type.
Recently, the structure of the MITF gene has been shown to be complex, encoding multiple isoforms [9 ]. For example, at least four different, alternate first exons, MITF-M, MITF-H, MITF-A, and MITF-C, have been identified. Each of these first exons is associated with a distinct promoter, and each is included in functional mRNAs by alternative splicing events, leading to the expression of proteins with different amino termini. In addition, alternative splicing of internal exons occurs [9 ]. The biological significance of the multiple isoforms is not clear.
The MITF protein can bind to a conserved E-box-related sequence found in the promoters and enhancers of melanocyte targets of MITF such as tyrosinase [1 , 14 ]. We have demonstrated recently that the proximal promoter region for the tartrate-resistant acid phosphatase (TRAP) gene contains a sequence closely related to the canonical E-box defined in melanocyte promoters that can mediate MITF regulation of TRAP during terminal differentiation of osteoclasts [13 ]. Recombinant MITF can bind to the E-box-type sequences found in melanocyte- or osteoclast-specific promoters as a homodimer [1 , 13 ]. Additionally, MITF can bind to this sequence as a heterodimer with other family members such as TFE3 [1 ]. This leads to the hypothesis that the coexpression of different sets of TFE partners may dictate whether MITF regulates melanocyte-specific or osteoclast-specific genes [1 , 9 ].
TFE3 is expressed in osteoclast-like cells (OCLs), derived by coculture experiments, and can be coimmunoprecipitated with MITF [15 ]. However, TFE3 has also been found to be expressed in melanoma cell lines and can transactivate the melanocyte genes tyrosinase and tyrP1 [16 ]. TFEB is also expressed in melanocytes and osteoclasts [17 ]. In contrast, the expression of TFEC has recently been shown to be restricted to osteoclasts and macrophages [4 ]. TFEC was described originally as a negatively acting factor, capable of repressing the activity of TFE3 [18 ].
In the present work, we investigated whether osteoclast-specific expression of specific MITF isoforms or of the related factors TFE3 and TFEC could contribute to the regulation of target genes such as TRAP by MITF. Evidence for expression of two mRNA isoforms, MITF-A and MITF-M, is presented. However, in transfection assays, both isoforms worked equally well to activate the TRAP promoter. In contrast, TFE3 and TFEC were shown to collaborate with MITF in TRAP activation. Additionally, both TFE factors could be isolated in a complex with MITF from OCLs cultured in vitro. The results indicate that related TFE factors can collaborate with MITF to activate the expression of osteoclast target genes during terminal differentiation of this cell type.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B (NF-B) ligand (RANKL; PeproTech, Rocky Hill,
NJ), 20 ng/ml tumor necrosis factor-
(TNF-; R&D Systems,
Minneapolis, MN), and 200 U/ml colony-stimulating factor-1 (CSF-1) and
were fed every 3 days. Cells were maintained in culture for 7 or 10
days as indicated. Mice heterozygous for the mi mutation
(B6C3Fe background) were obtained originally from Jackson Labs (Bar
Harbor ME), and mice of appropriate genotypes were used for the
experiments.
DNA constructs and DNA transfections
The melanocyte form of the MITF cDNA has been described
previously [1
, 9
]. The A form of MITF was
generated by polymerase chain reaction (PCR) from bone marrow-derived
macrophage (BMM) cDNA and then cloned into the same plasmid background
as the M form of MITF. The TFEC cDNA was described previously
[4
] and was placed in the same SV40-based expression
vector as the MITF cDNA [13
]. The SV40-based TFE3
expression vector was described previously [19
].
DNA transfections of RAW264.7 cells have been described previously [13 ]. Cells were harvested 24 h after transfection, and luciferase activity was determined as described [13 , 20 ]. Data for all transfections were subjected to analysis of variance (ANOVA) comparison using SAS software to determine statistically significant differences in the data.
Immunological reagents and analysis
The peptide EKEAFYKFEEQSRAE [corresponding to amino acids (aa)
85–99 of the melanocyte form of MITF] [1
], was used to
make specific antibody against MITF in rabbits (Biosynthesis,
Lewisville, TX). The MITF antibody was affinity-purified using a
recombinant 6-HisX-tagged protein corresponding to aa 1–139 of the
melanocyte form of MITF [1
]. The C-terminal portion of
TFEC from aa 199–317 [4
] was used to generate the
anti-TFEC antibody. This portion of the protein was expressed in
Escherichia coli, purified, and used to raise polyclonal
antibodies in rabbits. Antibodies against glutathione
S-transferase (GST) were removed from the antiserum by
chromatography over GST-Sepharose. TFEC antibodies were
affinity-purified by chromatography using GST-TFEC immobilized on
normal human serum (NHS)-Sepharose (Pharmacia, Piscataway, NJ). The
specificity of MITF and TFEC antibodies was confirmed in a Western blot
using recombinant and in vitro-translated proteins (unpublished
results). The TFE3 antibody was obtained from BD Pharmigen (San Diego,
CA). Western analysis was performed as described previously
[21
]. Immunoprecipitation was performed on OCLs
following 7 days of culture as above. The cells were lysed in buffer
containing 150 mM NaCl, 150 mM Tris, pH 7.6, 1% Triton X-100, 10
µg/ml each of the protease inhibitors leupeptin, aprotinin, and
antipain (ICN Biochemicals, Aurora, OH), and 100 µg/ml
phenylmethylsulfonyl fluoride (PMSF; Sigma Chemical Co., St. Louis,
MO). The MITF serum and protein G beads (Pharmacia) were added to the
cellular lysate, and the mixture was incubated for 16 h at 4°C.
The beads were washed three times after incubation with
phosphate-buffered saline (50 mM sodium phosphate, pH 7.0, 150 mM
NaCl), and the immune complex was released by boiling and analyzed by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
and Western blotting.
Immunohistochemistry was performed with OCLs that had been cultured on glass coverslips for 7 or 10 days. Cells were washed in Tris-buffered saline (TBS; 50 mM Tris, pH 7.5, 150 mM NaCl), fixed for 30 min at 4°C in 4% paraformaldehyde prepared in TBS, washed three times with TBS, and permeabilized for 5 min with TBS containing 1% Triton-X 100. Endogenous peroxide activity was blocked by incubation with 0.1% hydrogen peroxide and 10% methanol in TBS. Cells were washed and treated with 2% normal goat serum (Sigma Chemical Co.) in TBS for 1 h at room temperature. The affinity-purified MITF antibody (1:1000 dilution) was added and incubated overnight at 4°C. In control experiments, cells were incubated without primary antibody or with MITF antibody and 10 µg/ml of the peptide EKEAFYKFEEQSRAE (see above). Following this incubation, the cells were washed three times with TBS containing 0.2% Nonidet P-40 (NP-40). Anti-rabbit immunoglobulin G (IgG)-biotin (Boehringer Mannheim, Indianapolis, IN) was incubated for 1 h at a 1:200 dilution and washed as above. A 1:2000 dilution of streptavidin-peroxidase (Boehringer Mannheim) was added for 1 h, followed by three washes with TBS. Antibody binding was detected with the metal-enhanced 3'-diaminobenzidine tetrahydrochloride (DAB) substrate kit (Pierce Biochemicals, Rockford, IL).
Analysis of MITF isoforms reverse transcriptase-polymerase chain
reaction (RT-PCR)
RNA was isolated from cultured osteoclasts (procedure used to
culture osteoclasts described above) or indicated cell lines with
Trizol (Boehringer Mannheim). RNA (1 µg) was used to generate cDNA
using the Access RT-PCR kit (Promega, Madison, WI) following the
standard procedure supplied by the manufacturer. For RT-PCR, primers in
exon 1M (CTGGAAATGCTAGAATACAG) or exon 1A (CGGGTTCTGGTCCAAGTCCCAAGCAG)
were used, along with a common 3' primer from exon 7
(TCTTCTTCTTCGTTCAATCA) to amplify the MITF-M or MITF-A isoform mRNAs,
respectively [7
, 17
]. For the MITF-A cDNA,
a second round of PCR was done using a nested primer set that annealed
to exon 1a (GGCGGGCAAGAGGGAGTCATGCAGTCC) and exon 7
(TTCAATCAAGTTGTGATTGTCCTTTTTCTG). PCR products were resolved on a 2%
agarose gel and transferred to nitrocellulose. The Southern blot was
hybridized with a probe spanning exons 2–6 of the MITF gene
[7
, 17
].
Yeast one-hybrid assay and ß-galactosidase assay
To generate fusion constructs with the DNA-binding domain of
Gal4, cDNAs for full-length TFEC, the bHLH-ZIP region, and C-terminal
regions were amplified by PCR and subcloned into the yeast shuttle
vector AS2.1 (Clontech, Palo Alto, CA). Yeast transformation and
ß-galactosidase quantitative assay were performed according to the
manufacturer’s recommendations (Clontech).
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, and CSF-1
[22
23
24
25
]. These factors induce the differentiation of
immature osteoclast precursors into multinuclear OCLs capable of bone
resorption [22
23
24
25
]. Differentiation was evident
following 7 days in culture, because small, multinuclear cells that
stained strongly for TRAP were evident (Fig. 1A
). Following 10 days in culture, large, multinuclear OCLs that
were also TRAP-positive were observed (Fig. 1A)
.
 View larger version (94K): [in a new window] |
Figure 1. Expression of MITF proteins during differentiation of OCLs. (A) OCLs
were cultured in the presence of 80 ng/ml RANKL, 20 ng/ml TNF-, and
200 U/ml CSF-1 for 7 (upper panels) or 10 days (lower panels). TRAP
activity was detected in OCLs by histochemical staining, or MITF
expression was determined by immunohistochemical staining, as
indicated. In control experiments, the peptide used to produce the MITF
antibody was included in the antibody incubation (MITF+P). Original
magnification was 40x for top panels and 10x for bottom panels. (B)
Western blot of cell extracts from NIH 3T3 (lane 1), OCL (10-day
culture; lane 2), or B16 (lane 3) cells. The blot was probed with an
MITF-specific antibody.
|
, MITF expression was
high and was observed in the nucleus and the cytoplasm of
differentiating OCLs (Fig. 1A)
. After 10 days in culture when
differentiation is completed, MITF expression appeared lower but was
restricted to the nucleus (Fig. 1A)
. Inclusion of the peptide used to
generate the MITF antibody (see Materials and Methods) blocked the
specific signal at both time points (Fig. 1A
, panels labeled MITF+P). The expression of MITF in OCLs was also examined by Western blotting (Fig. 1B) . As previously shown for human and rat OCLs [15 ], MITF is expressed in mouse OCLs (Fig. 1B , lane 2). However, our anti-MITF antibody detected two distinct bands in OCL-derived extracts of apparent molecular weights 68 kDa and 82 kDa, present in approximately equal concentrations, and the previous study showed a single band similar in size to the larger band detected here [15 ]. When the melanoma cell line B16 was examined, the same two MITF protein species observed in the OCLs were detected (Fig. 1B , lane 3 vs. lane 2). In the B16 cell extract, the lower band was the more abundant of the two, accounting for approximately 70% of the MITF present. In NIH 3T3 fibroblast extracts, MITF expression was not detected (Fig. 1B , lane 1). The faster migrating 68-kDa MITF species comigrated with recombinant protein produced using the melanocyte form of the cDNA in COS cell transfections ([1 ]; unpublished results).
MITF-M and MITF-A isoforms are expressed in OCLs, and both isoforms
can activate the TRAP promoter
To determine which MITF mRNA isoforms were expressed in OCLs,
RT-PCR was performed using primers specific for the different MITF
isoforms. These experiments demonstrated that the MITF-M form (the
melanocyte-specific form) and the MITF-A form (first detected in the
eye; [26
]) were expressed in OCLs (Fig. 2A
, lanes 5 and 10). These same forms were also expressed in the
osteoclast/macrophage cell line RAW264.7 (Fig. 2A
, lanes 4 and 9) and
in B16 melanoma cells (Fig. 2A
, lanes 3 and 8). Expression of MITF mRNA
was not detected in NIH 3T3 cells (Fig. 2A
, lanes 2 and 7). Other
N-terminal isoforms were not detected (unpublished results).
 View larger version (49K): [in a new window] |
Figure 2. MITF-M and MITF-A isoforms are expressed in OCLs and are able to
activate the TRAP promoter equivalently. (A) Southern blot of RT-PCR
products produced using MITF-M- or MITF-A-specific primers as labeled.
Blot was probed with a labeled MITF cDNA corresponding to exons 2–6.
RNA was isolated from OCLs (lanes 5 and 10) and RAW264.7 cells (lanes 4
and 9), B16 melanoma cells (lanes 3 and 8), and NIH 3T3 cells
(lanes 2 and 7). Lanes 1 and 6 contained an MITF-M or MITF-A plasmid,
respectively. The arrows indicate the position of MITF-M and MITF-A PCR
product. (B) Transient transfection of the TRAP luciferase reporter in
RAW264.7 cells. For these experiments, 5 µg TRAP reporter genes were
cotransfected with 2 µg or 4 µg expression vectors encoding MITF-M
or MITF-A expression vectors alone or 2 µg or 4 µg of a
combination of MITF-M and MTIF-A, as indicated. The empty MITF (2 µg)
expression vector was included in the reporter-only assay (first bar
graph in each panel). Reporter activity is expressed as relative
luciferase activity. For all transfections, results are from three
independent transfections performed in duplicate, and error bars
indicate standard deviation.
|
TFE3 is in a complex with MITF in OCLs and B16 melanoma cells and
can collaborate with MITF in activation of the TRAP promoter
To begin addressing whether the related TFE bHLH-zip factors could
play a role in regulation of MITF target genes in osteoclasts, the
relative expression of TFE3 in OCLs was studied by Western blotting
(Fig. 3A
). As shown previously for human and rat OCLs [15
],
TFE3 was expressed in mouse OCLs (Fig. 3A
, lane 3). TFE3 expression was
also detected in mouse NIH 3T3 fibroblasts and in B16 melanoma cells
(Fig. 3A
, lanes 1 and 2, respectively).
 View larger version (38K): [in a new window] |
Figure 3. TFE3 was expressed in OCLs and B16 cells and could be found in a
complex with MITF. (A) Western blot of cell extracts from NIH 3T3 (lane
1), B16 (lane 2), or OCL (lane 3) cells. The blot was probed with a
TFE3-specific antibody. The arrowhead indicates the position and size
of TFE3. (B) Immunoprecipitation of proteins from OCL (lane 2), NIH 3T3
(lane 3), and B16 cells (lane 4) with an affinity-purified,
MITF-specific antibody. Samples were analyzed by Western blotting using
a TFE3-specific antibody. Lane 1 contains OCLs extract that was
incubated without primary MITF antibody. B16 whole-cell extracts are in
lane 5. Arrowhead indicates position of TFE3 (70 kDa). In both panels,
the positions of molecular weight markers are indicated on the left.
IgG indicates the position of the IgG heavy chain (detected by the
secondary antibody).
|
To test whether the MITF and TFE3 complexes in OCLs could have any functional consequences, the effect of the combination of TFE3 and MITF on TRAP promoter activity was studied in transient transfection assays. The experiments were conducted in RAW 264.7 cells. Cotransfection of an MITF-M expression vector with the TRAP promoter resulted in an approximate 12-fold increase in promoter activity, and TFE3 activated the TRAP promoter ninefold (Fig. 4 , left panel). However, when MITF-M and TFE3 expression vectors were cotransfected with the TRAP promoter, an increase of 36-fold was measured (Fig. 4 , left panel), an effect that was more than additive of the activation observed for either factor alone. Cotransfection of the MITF-M expression vector with a TRAP promoter containing a mutation in the E-box defined as a binding site for MITF [13 ] abrogated activation by MITF and TFE-3, singly or in combination (Fig. 4 , hatched bars).
 View larger version (21K): [in a new window] |
Figure 4. TFE3 can collaborate with MITF in transactivation of the TRAP promoter.
(Left panel) Transient transfection of TRAP luciferase reporter genes
in RAW264.7 cells. For these experiments, 5 µg of the TRAP reporter
was cotransfected with 2 µg expression vectors encoding MITF-M or
TFE3 alone or 1 µg each MITF-M and TFE3 vectors together (total of 2
µg), as indicated. Empty MITF/TFE3 expression vector (2 µg) was
included in the reporter-only assay (first bar graph in each panel). In
separate experiments, a TRAP promoter (5 µg) containing a mutation in
the conserved E-box was used (hatched bars). (Right panel) Same as in
other panel, however the expression vector encoding the MITF-A isoform
was substituted for MITF-M. Activity in both panels is expressed as
relative luciferase activity. For all transfections, results are from
three independent transfections performed in duplicate, and error bars
indicate standard deviation.
|
TFEC is in a complex with MITF in OCLs and RAW264.7 cells and can
also collaborate with MITF in activation of the TRAP promoter
TFEC RNA expression has been demonstrated previously to be
restricted to macrophages and osteoclasts [4
]. Using an
anti-TFEC antibody that we developed, TFEC protein was detected in OCLs
(Fig. 5A
, lane 3). In contrast to TFE3, TFEC protein expression was not
detected in NIH 3T3 or B16 cells (Fig. 5A
, lanes 1 and 2,
respectively). In control experiments, use of rabbit preimmune serum or
secondary antibody alone failed to detect the TFEC band (unpublished
results).
 View larger version (53K): [in a new window] |
Figure 5. TFEC is found in a complex with MITF and can collaborate with MITF in
transactivation of the TRAP promoter. (A) TFEC immunoprecipitates
prepared from NIH 3T3 (lane 1), B16 (lane 2), or OCLs (lane 3) were
analyzed by Western blotting. The blot was probed with TFEC-specific
antibody, the same antibody used for immunoprecipitation. (B)
Immunoprecipitation of proteins from NIH 3T3 (lane 1), B16 (lane 2),
RAW264.7 (lane 3), and OCLs (lane 4) with an affinity-purified,
MITF-specific antibody. Samples were analyzed by Western blotting using
a TFEC-specific antibody. Arrowhead indicates position of TFEC. In both
panels, the positions of molecular weight markers are indicated on the
left. IgG indicates the position of the IgG heavy chain (detected by
the secondary antibody). (C) Transient transfection in RAW264.7 cells.
TRAP luciferase reporters (5 µg) were cotransfected with 2 µg
expression vectors encoding MITF-M or TFEC alone or 1 µg each MITF
and TFEC together (total of 2 µg), as indicated. Empty MITF/TFEC
expression vector (2 µg) was included in the reporter-only assay
(first bar graph in each panel). In separate experiments, a TRAP
promoter (5 µg) containing a mutation in the conserved E-box was used
(hatched bars). Reporter activity is expressed as relative luciferase
activity. For all transfections, results are from three independent
transfections performed in duplicate, and error bars indicate standard
deviation.
|
TFEC has been shown to be a negative-acting family member [18 ]. Transient transfection assays were used to study the ability of TFEC to regulate the TRAP promoter (Fig. 5C) . Surprisingly, TFEC activated the TRAP promoter about fourfold, and MITF activated the TRAP promoter sevenfold in this series of experiments. In addition, the combination of MITF and TFEC resulted in 12-fold activation of promoter activity (Fig. 5C) . Thus, TFEC behaved as an activator and can collaborate with MITF in target gene activation, although the effect is closer to being additive for these two factors. As for TFE3, mutation of the E-box in the proximal TRAP promoter blocked the ability of MITF and TFEC, singly or in combination, to activate the TRAP promoter (Fig. 5C , hatched bars).
TFEC-gal4 fusion proteins can transactivate a ß-galactosidase
reporter gene in yeast cells
Because TFEC was shown previously to be able to repress TFE3
activity and does not contain an acidic activation domain conserved in
other family members [17
, 18
], a second
assay to confirm that TFEC contained an activation domain(s) was
undertaken. Fusion constructs of TFEC with the Gal4-DNA- binding domain
were assayed for their ability to activate transcription in a yeast
one-hybrid assay (Fig. 6
). ß-Galactosidase reporter gene activity was detected initially
for the fusion protein containing full-length TFEC, but the bHLH-zip
construct lacked N-terminal and C-terminal amino acid activity in this
assay (unpublished results). ß-Galactosidase quantitative assays were
then performed using the original constructs and three additional
constructs containing C-terminal truncations of TFEC. Truncation of the
serine-rich region and an adjacent region that is moderately conserved
in all MITF-related proteins [17
] reduced
transactivation activity. Further truncation of the C-terminal region
yielded transcriptional, inactive fusion proteins. However, we have not
confirmed that all of these truncated proteins are produced in the
yeast cells.
 View larger version (18K): [in a new window] |
Figure 6. TFEC contains an activation domain in the C-terminal region.
MEL1 reporter gene activity, induced by Gal4 or by TFEC gene
segments fused in-frame to the Gal4-DNA-binding domain, was measured
using a ß-galactosidase quantitative assay. Reporter gene activity is
expressed in arbitrary units. Results are from two independent
transformations of yeast strain Y190 and are the mean values obtained
from six individual yeast colonies for each experiment. Error bars
indicate standard deviation.
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
One factor that may contribute to the cell-type specificity of MITF is interaction with the highly related TFE bHLH-zip proteins. Cell-type differences in the expression of TFE factors could result in MITF/TFE heterodimers that have distinct DNA-binding and/or transactivation properties [1 , 8 ]. Biochemical data presented here confirmed a previous study that MITF and TFE3 were present in a complex in osteoclasts [15 ]. Extending these published results, functional evidence for an interaction of the two factors was revealed, because the combination of factors could activate the TRAP promoter more efficiently than either factor alone. However, TFE3 was also expressed in the pigmented melanoma cell line B16 and could be coimmunoprecipitated with MITF from these cells as well. In addition, TFE3 has been shown to activate melanocyte target promoters such as tyrosinase [16 ]. These findings indicate that TFE3 may collaborate with MITF to increase expression of target genes such as TRAP in osteoclasts but that this interaction may not be important in determining cell-type-specific expression of target genes.
Unexpectedly, the related factor TFEC was also found to be an activator of osteoclast target genes and could collaborate with MITF to increase TRAP promoter activity. TFEC was described originally as a negative-acting family member able to block the action of TFE3 [18 ]. In addition, TFEC does not contain the acidic activation domain conserved in the other three family members that appear to be a binding site for the coactivator CREB-binding protein [17 , 28 ]. In a yeast one-hybrid assay, a TFEC-gal4 fusion protein has activator activity, consistent with the results obtained with the wild-type protein. A preliminary analysis indicates that the TFEC C-terminal region might contain an activation domain. However, additional experiments will be required to precisely map the location of potential activation domains in TFEC, which could also be detected in a complex with MITF in OCLs. TFEC expression appears to be more limited than TFE3 or TFEB and, in particular, restricted to the myeloid lineage, including macrophages and osteoclasts [4 ]. Thus, TFEC is a better candidate for contributing to the osteoclast-specific functions of MITF. Future experiments using mice null for the TFEC gene should help to determine the role of this gene in MITF function.
Recently, the structure of the MITF gene has been shown to be very complex with multiple first exons containing coding sequences that can be expressed in a tissue-specific fashion [26 , 29 ]. Our previous work in describing TRAP as a target of MITF depended on using the MITF-M cDNA and protein, the major form shown to be present in melanocytes [13 ]. Thus, it was important to determine what MITF N-terminal isoforms were expressed in osteoclasts and whether functional differences existed between these isoforms.
The M form and A form MITF mRNA species could be detected in primary OCLs and RAW264.7 cells by RT-PCR. Additionally, two protein species of apparent molecular weights 82 kDa and 68 kDA were present in cultured cells. The protein results are different than demonstrated in a previous study, which only identified a single band that was larger than the putative MITF-M form of the protein, and this other study did not look at isoform mRNA expression [15 ]. The method of culture or the difference in MITF antibody used could account for the difference in our result and the previous study [15 ]. Because of the complex structure of the MITF gene, it is difficult to make firm conclusions at this time regarding the identity of the protein species detected in these different studies. Direct sequencing of the MITF protein isoforms detected in OCLs will be required to definitively confirm their identity.
No difference in the ability of MITF-M or MITF-A forms to activate the TRAP reporter was detected, singly or in combination. In addition, both MITF isoforms collaborated equally well with TFE3 in TRAP promoter activation. Recently, another study indicated that MITF-M and -A isoforms activated the melanocyte target gene tyrosinase equally, a result consistent with our findings for TRAP [26 ]. Small differences were detected between isoforms when another target gene, trp2, was used [26 ]. However, taken together, the data indicate that these isoforms probably do not account for the ability of MITF to activate distinct sets of the target genes in the two cell types.
Immunohistochemical localization of MITF indicated that the localization and expression of the protein changed during osteoclast differentiation. In particular, MITF was localized in cytoplasm and nucleus at the earlier stages of differentiation but was mainly located in the nucleus in BMM and immature osteoclasts (unpublished results) and in multinuclear OCLs. It has been shown that in nonmyeloid cells, the protein encoded by the mutant mi allele is defective in nuclear localization [30 ]. Thus, subcellular localization of MITF may be a critical regulatory mechanism during osteoclast differentiation. It is conceivable that TEF3 and TFEC are involved in the movement of MITF to the nucleus during the first stages of terminal differentiation. Further experimental evidence will be needed to show whether this hypothesis is valid.
The MITF system provides an attractive model to study gene regulation during the terminal differentiation of osteoclasts. Understanding how genes are regulated in mature osteoclasts has the potential to help define transcriptional mechanisms of regulation that are likely involved in human disorders such as osteoporosis in post-menopausal women or the osteolytic bone destruction and hypercalcemia that occur in patients with multiple myeloma [10 ]. In particular, our studies indicate that related bHLH-zip factors can likely contribute to MITF action of target genes and present a focus for further studies to define how MITF regulates genes in osteoclasts.
Received April 30, 2001; revised August 18, 2001; accepted August 20, 2001.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
 |
|
 |
|
  R. Hu, S. M. Sharma, A. Bronisz, R. Srinivasan, U. Sankar, and M. C. Ostrowski Eos, MITF, and PU.1 Recruit Corepressors to Osteoclast-Specific Genes in Committed Myeloid Progenitors Mol. Cell. Biol., June 1, 2007; 27(11): 4018 - 4027. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Esumi, S. Kachi, P. A. Campochiaro, and D. J. Zack VMD2 Promoter Requires Two Proximal E-box Sites for Its Activity in Vivo and Is Regulated by the MITF-TFE Family J. Biol. Chem., January 19, 2007; 282(3): 1838 - 1850. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Meadows, S. M. Sharma, G. J. Faulkner, M. C. Ostrowski, D. A. Hume, and A. I. Cassady The Expression of Clcn7 and Ostm1 in Osteoclasts Is Coregulated by Microphthalmia Transcription Factor J. Biol. Chem., January 19, 2007; 282(3): 1891 - 1904. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Rehli{section}, S. Sulzbacher, S. Pape, T. Ravasi, C. A. Wells, S. Heinz, L. Sollner, C. El Chartouni, S. W. Krause, E. Steingrimsson, et al. Transcription Factor Tfec Contributes to the IL-4-Inducible Expression of a Small Group of Genes in Mouse Macrophages Including the Granulocyte Colony-Stimulating Factor Receptor J. Immunol., June 1, 2005; 174(11): 7111 - 7122. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Pan, W. Mathews, J. M. Donohue, M. L. Ramnaraine, C. Lynch, D. J. Selski, N. Walsh, A. I. Cassady, and D. R. Clohisy Analysis of Distinct Tartrate-resistant Acid Phosphatase Promoter Regions in Transgenic Mice J. Biol. Chem., February 11, 2005; 280(6): 4888 - 4893. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Miller, C. Levy, I. J. Davis, E. Razin, and D. E. Fisher Sumoylation of MITF and Its Related Family Members TFE3 and TFEB J. Biol. Chem., January 7, 2005; 280(1): 146 - 155. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. P. Kuiper, M. Schepens, J. Thijssen, E. F. P. M. Schoenmakers, and A. G. van Kessel Regulation of the MiTF/TFE bHLH-LZ transcription factors through restricted spatial expression and alternative splicing of functional domains Nucleic Acids Res., April 26, 2004; 32(8): 2315 - 2322. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Liu, Z. Shi, A. Silveira, J. Liu, M. Sawadogo, H. Yang, and X. Feng Involvement of Upstream Stimulatory Factors 1 and 2 in RANKL-induced Transcription of Tartrate-resistant Acid Phosphatase Gene during Osteoclast Differentiation J. Biol. Chem., May 30, 2003; 278(23): 20603 - 20611. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
