PeproTech Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mansky, K. C.
Right arrow Articles by Ostrowski, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mansky, K. C.
Right arrow Articles by Ostrowski, M. C.
(Journal of Leukocyte Biology. 2002;71:295-303.)
© 2002 by Society for Leukocyte Biology

The microphthalmia transcription factor (MITF) contains two N-terminal domains required for transactivation of osteoclast target promoters and rescue of mi mutant osteoclasts

Kim C. Mansky1, Kavita Marfatia1, Georgia H. Purdom1, Alex Luchin1, David A. Hume{dagger} and Michael C. Ostrowski1

Department of Molecular Genetics and the Comprehensive Cancer Center, Ohio State University, Columbus; and
{dagger} Departments of Microbiology and Biochemistry and the Centre for Molecular and Cellular Biology, University of Queensland, Brisbane, Australia

Correspondence: Michael C. Ostrowski, Department of Molecular Genetics, Ohio State University, 484 W. 12th Ave., Columbus, OH 43210. E-mail: ostrowski.4{at}osu.edu


arrow
ABSTRACT
 
The microphthalmia transcription factor (MITF) regulates gene expression during differentiation of several distinct cell types, including osteoclasts. A structure/function analysis was performed to determine whether transcription activation domains were important for MITF action in osteoclasts. In addition to a previously characterized acidic activation necessary for melanocyte differentiation, the analysis defined a second potential activation domain located between amino acids 140 and 185. This second domain is required for MITF transactivation of two probable targets, the E-cadherin promoter and the tartrate-resistant acid phosphatase promoter, in transient transfection assays. An intact MITF gene rescued differentiation when introduced into osteoclasts derived from mi/mi mice using a retrovirus vector. In parallel experiments, an MITF gene lacking the acidic-activation domain rescued differentiation twofold less efficiently than wild type, and a gene lacking the region between amino acid residues 140 and 185 rescued differentiation tenfold less efficiently than wild type. The results indicate that the N-terminal region of MITF is necessary for activation of gene expression in osteoclasts and provides one mechanism by which this factor regulates distinct target genes in different cell types.

Key Words: transcriptional regulation • myeloid differentiation • E-cadherin


arrow
INTRODUCTION
 
The microphthalmia (mi) transcription factor (MITF) gene encodes a basic helix-loop-helix zipper (bHLH-zip) protein closely related to the bHLH-zip factors TFE3, TFEB, and TFEC [1 2 3 ]. Mutations in the human homolog of MITF result in the genetic diseases, Waardenburg’s syndrome 2A and Tietz syndrome [4 , 5 ]. At least 21 different mutant alleles at the MITF locus have been characterized in the mouse [6 7 8 ]. The mouse MITF alleles can affect, to varying extent, differentiation of melanocytes, pigmented retinal epithelial cells, mast cells, and osteoclasts [6 7 8 ]. These data suggest that MITF can selectively affect gene expression and differentiation of developmentally unrelated types of cells, for example, melanocytes and osteoclasts. Further, MITF action also appears important in distinguishing between two closely related myeloid cell types, the macrophage and the osteoclast.

MITF regulates expression of genes in melanocytes through recognition of conserved E-box-related sequences found in the promoters and enhancers of target genes such as tyrosinase [9 ]. The core sequences TCATGTG or CATGTGA present in these E-boxes are crucial for high-affinity DNA recognition by MITF [10 ]. Recently, we have demonstrated that the proximal promoter region for the tartrate-resistant acid phosphatase (TRAP) gene, which serves as a marker for terminal osteoclast differentiation, contains a sequence closely related to the E-boxes defined in melanocyte promoters. This cis-element can mediate MITF regulation of TRAP during terminal differentiation of osteoclast-like cells (OCLs) [11 ].

The N-terminal region of the MITF protein contains an acidic domain, encoded by exon 4 of the MITF gene, necessary for transactivation of melanocyte target genes [6 , 12 ]. This region is conserved among MITF, TFEB, and TFE3 and is believed to be a binding site for the co-activator CBP/p300 [12 ]. Interaction of the acidic-activation domain with CBP/p300 is shown to be regulated by c-kit/mitogen-activated protein (MAP) kinase signaling through phosphorylation of serine residue 73 encoded by exon 2B [13 ].

Two previously described semi-dominant mutant alleles of MITF, white spot (ws) and x-38, have deletions of exons 2–4 and exon 4, respectively, and thus encode proteins lacking the acidic-activation domain [6 ]. Mice containing these alleles have defects in coat and eye pigmentation in heterozygous and homozygous combinations, and ws shows the more-severe phenotype, providing strong genetic evidence for the role of the N-terminal acidic-activation domain of MITF in melanocyte gene expression and differentiation [6 ]. However, despite the effects on melanocyte gene expression and differentiation, neither of these alleles leads to developmental defects in bone. One hypothesis to explain these results is that the acidic-activation domain is redundant for MITF action in osteoclasts.

To address this hypothesis, we set out to define transactivation domains in the MITF protein important for activation of osteoclast-expressed genes. We have defined a distinct region in MITF that behaves as an activation domain in transient transfection assays using two potential osteoclast targets, the E-cadherin promoter and the TRAP promoter. In addition, we show that this region of MITF is required for rescue of the defect in mi/mi osteoclasts by wild-type MITF.


arrow
MATERIALS AND METHODS
 
Culture and analysis of OCLs
Hematopoietic precursors were obtained from the spleens of mi/mi and wild-type mice. OCLs were grown in the presence of 80 ng/ml receptor activator of nuclear factor-{kappa}B (NF-{kappa}B) ligand (RANKL; PeproTech, Rocky Hill, NJ), 20 ng/ml tumor necrosis factor-{alpha} (TNF-{alpha}; R&D Systems, Minneapolis, MN), and 5 ng/ml colony stimulating factor-1 (CSF-1). Cells were maintained in culture for 7 or 10 days. Mice heterozygous for the mi mutation (B6C3Fe background) were originally obtained from Jackson Labs (Bar Harbor, ME), and mice of appropriate genotypes were used for the experiments. Procedures for TRAP histochemical staining of cells and RNA extraction and analysis by Northern blotting have been described previously [11 ].

The procedure for preparation of thin sections from embryonic forelimbs and TRAP histochemical staining has been described previously [11 ].

Electrophoretic mobility gel shift assays (EMSAs)
Recombinant, 6X histidine (6Xhis) MITF (wild type) was produced using the pET15b expression vector system and purified by nickel-agarose chromatography as described previously [11 ]. Purified protein was used in EMSAs using standard conditions as described previously [11 ]. The sequences of the E-cadherin oligonucleotides used were (sense strand in each case): TTGGCTGCCACCTGCAGGTGCGTCCC (E-Pal), TGCGGGCTCACCTGGCGGCCGC (E-Prox), and TGCGGGCTCTCGAGGCGGCCGC (mutated E-Prox).

DNA constructs and DNA transfections
For all experiments presented here, the so-called melanocyte form of the MITF cDNA containing the additional six codons encoded by alternate exon 6a was used [2 , 8 ]. The melanocyte-form mRNA is an MITF isoform expressed in cultured mouse osteoclasts (unpublished results). MITF N-terminal deletions, termed MITF {triangleup}109 or {triangleup}140, were made by deleting nucleotides 455–546 or 546–683, respectively, in the MITF cDNA [2 ]. These deletions correspond to amino acid residues 109–140 or 140–185, respectively. Full-length or N-terminal deletions were cloned into a vector providing the influenza hemagglutinin (HA) tag or into a retroviral vector containing a 6Xhis tag. N-terminal point mutations within the region defined by MITF {triangleup}140 were made by replacing the conserved amino acid residues with alanine residues. Three mutations, corresponding to amino acid residues 148–151 (mut1), 171–174 (mut2), and 181–184 (mut3), were constructed. All deletion mutants and point mutants were verified by sequencing.

A fragment of the E-cadherin promoter between nucleotides -178 and +92 relative to the transcriptional start site [14 ] was placed into pGL2-Basic vector (Promega Biotech, Madison, WI). The E-Pal (palindromic) or E-Prox (proximal) E-box sequence was mutated to the sequence of an XhoI site (CTCGAG) by site-directed mutagenesis, as above. The TRAP reporter construct was described previously [11 ].

DNA transfections of RAW 264.7 cells have been described previously [11 ]. Data for all transfections were subjected to analysis of variance (ANOVA) comparison using SAS software to determine statistically significant differences in the data.

Immunological reagents and analysis
For 35S-methionine-labeling experiments, cells were grown in media lacking methionine overnight. 35S methionine (90 µCi; ICN Pharmaceuticals, Costa Mesa, CA) was added to the cells, and the cells were labeled for 3 h. Cells were lysed in radioimmunoprecipitation assay [50 mM Tris-HCl, pH 7.6, 125 mM NaCl, 1% Nonidet P-40 (NP-40), 0.5% deoxycholate, and 6 mM MgCl2], which included 10 µg/ml antipain, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 100 µg/ml phenylmethylsulfonyl fluoride (PMSF), and 1 mM sodium vanadate. Cells were incubated in RIPA at 4°C for 20 min and then centrifuged at 25,000 rpm for 20 min. Protein G beads (Pharmacia, Upsala, Sweden) were added to the lysate, and the appropriate antibody [anti-6Xhis from Santa Cruz (Santa Cruz Biotechnology, CA); HA from BabCo, Berkeley, CA] was added. The immunoprecipitate was incubated at 4°C overnight. The immunoprecipitate was washed three times in RIPA and run on 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

Immunohistochemistry was performed with OCLs that had been cultured on plastic coverslips for 7 days. Cells were washed in Tris-buffered saline (TBS; 50 mM Tris, pH 7.5, 150 mM NaCl), fixed for 30 min at 4°C in 4% paraformaldehyde prepared in TBS, washed three times with TBS, and permeabilized for 5 min with TBS containing 1% Triton X-100. Endogenous peroxide activity was blocked by incubation with 0.1% hydrogen peroxide and 10% methanol in TBS. Cells were washed and treated with 2% normal goat serum (Sigma Chemical Co., St. Louis, MO) in TBS for 1 h at room temperature. The commercial His antibody (1:500) was added and incubated overnight at 4°C. In control experiments, cells were incubated without primary antibody. Following incubation with primary antibody, the cells were washed three times with TBS containing 0.2% NP-40. Anti-rabbit immunoglobulin (Ig)G-biotin (Boehringer Mannheim, Mannheim, Germany) was added for 1 h, followed by three washes with TBS. Antibody binding was detected with the metal-enhanced 3'-diaminobenzidine tetrahydrochloride (DAB) substrate kit (Pierce Biochemicals, Rockford, IL).

Production of retroviruses and infection of OCLs
The retroviral DNA constructs were transfected into the PA317 packaging cell line [15 ]. The PA317-infected cells were selected with puromycin, and individual clones were picked. The titer of the virus was determined by infecting Rat-1 cells with various dilutions of supernatant from PA317 cells. Because the titers for viruses used were quite variable, a co-culture procedure was used to insure efficient infection of osteoclast precursors. For this purpose, PA137 cells producing virus were treated with 2 µg/ml mitomycin C for 16 h prior to use with OCLs [16 ]. Producer cells treated in this fashion can no longer replicate but are still competent for virus production.

For retrovirus infection of OCLs, 1.8 x 107 cells obtained from spleens of mi/mi mice were mixed with 1.5 x 105 mitomycin C-treated PA317 cells that produced the various viruses and were tested in triplicate. The mixture of cells was cultured in Dulbecco’s modified Eagles medium (DMEM) containing 10% fetal bovine serum and 50 ng/ml CSF-1 on tissue culture-treated plastic coverslips placed in 24-well tissue-culture dishes. After 3 days, nonadherent spleen cells were removed by washing with TBS, and the cultures were treated briefly with 0.1% trypsin. This treatment removed the mitomycin C-treated fibroblasts, but the mononuclear osteoclast precursors remained adherent. DMEM containing 10% fetal bovine serum, 80 ng/ml RANKL, 20 ng/ml TNF-{alpha}, and 5 ng/ml CSF-1 was added, and cells were cultured for an additional 7 days.

After the 7-day incubation, cells were fixed, and expression of the 6Xhis-tagged MITF proteins was determined by immunohistochemistry as described above. The cell nuclei were stained with bis-benzamide (1 µg/ml), and cells positive for expression of exogenous 6Xhis-tagged MITF were counted and scored as mononuclear or multinuclear. The ratio of multinuclear, 6Xhis-tagged-positive cells over the total number of 6Xhis-tagged-positive cells (mononuclear and multinuclear) was used as a measure of the rescue of differentiation of mi/mi OCLs. Some cultures were subjected to TRAP histochemical staining instead of immunohistochemistry, revealing that multinuclear cells were strongly positive for TRAP expression as well (unpublished results).


arrow
RESULTS
 
Decreased expression of E-cadherin mRNA in OCLs derived from mutant mi/mi mice
Mice homozygous for the MITF mi mutation have very severe phenotypes in all cell types that express MITF, including osteoclasts. In mi/mi mice, mononuclear osteoclasts can be isolated, but these cells are incapable of fusing to form multinuclear cells and are defective in bone resorption [17 18 19 ]. To extend our knowledge of the precise effect of the mi allele in vivo, we examined the earliest stages of bone development in mi/mi mice (Fig. 1 A ). Longitudinal sections of forelimbs at 16.5 days of embryonic development of wild-type mice demonstrated that multinuclear cells staining strongly for TRAP activity can be detected in the emerging bone-marrow cavity of the radius (Fig. 1A , bottom panels, indicated by arrows). Sections from mi/mi mice at the same stage of development show numerous cells that are positive for TRAP histochemical activity, but these cells are usually small, mononuclear cells (Fig. 1A , top panels). The sections from mi/mi mice also reveal that osteopetrosis can be detected during the earliest stages of long bone mineralization, with less remodeling evident compared with wild-type mice (Fig. 1A) .



View larger version (67K):
[in this window]
[in a new window]
 
Figure 1. E-cadherin RNA expression is diminished in OCLs derived from mi/mi mice. (A) Comparison of radial sections from wild type (bottom panels) and mi mutant (top panels) mice that were 16.5 days old. TRAP activity was detected by histochemical staining. Arrows indicate TRAP-positive cells. Original magnification was 400x (left panels), and regions of the original micrographs were increased fourfold (right panels). (B) Comparison of OCLs cultured from wild type (bottom panel) and mi mutant (top panel) mice. OCLs were cultured in the presence of 80 ng/ml RANKL, 20 ng/ml TNF-{alpha}, and 200 U/ml CSF-1 for 10 days. The entire culture was fixed in 3.7% paraformaldehyde and TRAP activity detected by histochemical staining (100x original magnification). (C) RNA was prepared from OCLs derived from wild-type and mi/mi mice. After Northern transfer, the blot was hybridized first to a probe specific for E-cadherin and then stripped and hybridized with a probe specific for TRAP and subsequently for the CTR.

The effect of the mi/mi mutation on OCL terminal differentiation was confirmed using an in vitro culture system that depends on the addition of specific cytokines (Fig. 1B) . Culture of precursors in spleen from wild-type mice with RANKL, TNF-{alpha}, and CSF-1 (see Materials and Methods) resulted in the formation of multinuclear cells, sometimes containing several dozen nuclei. These OCLs exhibit high levels of TRAP activity as determined by histochemical staining (Fig. 1B , bottom panel). The cultures prepared from mi/mi mice were composed nearly entirely of mononuclear cells that stain weakly for TRAP activity (Fig. 1B , top panel). The mi cells fail to fuse to form multinuclear cells even after 2 weeks in culture (unpublished results). Thus, the in vitro culture system accurately reflects the differentiation of OCLs observed in vivo.

The transmembrane cell-adhesion molecule E-cadherin is expressed in cultured OCLs as cell fusion occurs, and neutralizing antibodies to E-cadherin reduced the number of multinuclear, TRAP-positive OCLs obtained during in vitro differentiation [20 ]. Because of the obvious fusion defect in mi/mi OCLs (Fig. 1A and 1B) , experiments to test the hypothesis that MITF might regulate E-cadherin expression were undertaken. As a first step, the expression of E-cadherin mRNA in OCLs derived from mi/mi mice was determined using Northern analysis (Fig. 1C) . Expression of E-cadherin mRNA was detected in cells derived from wild-type mice but was expressed at an approximate 12-fold lower level in cells derived from mi/mi mutant mice (Fig. 1C) . As we demonstrated previously in an osteoclast/osteoblast co-culture in vitro system [11 ], two genes considered as definitive marker for osteoclasts, TRAP and calcitonin receptor (CTR), are expressed in the cultured OCLs. However, TRAP expression is six- to eightfold lower in the mi/mi cells versus wild-type cells, and CTR is expressed in both cell populations at equivalent levels and thus serves as a convenient RNA loading control (Fig. 1C) .

MITF transactivates the E-cadherin promoter through a conserved E-box-like sequence
Targets for MITF in melanocytes and osteoclasts contain a conserved E-box sequence motif in their promoters [9 , 11 ]. Inspection of the published sequence for the E-cadherin promoter for two species (human and mouse) revealed two conserved E-box-related sequences (Fig. 2 A ). One of these E-box sequences, located at approximately position -78 relative to the mRNA initiation site, has been described previously to act as a negative element in mesenchymal cells [14 ]. This site consists of palindromic E-boxes in the mouse sequence (termed E-Pal), but only one of these E-boxes is conserved in the human promoter (Fig. 2A) . The second conserved site is located at position -18 in a GC-rich region of the promoter (termed E-Prox in Fig. 2 ). Two types of assays were used to determine the functional significance of these conserved E-boxes.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 2. E-cadherin is a target of MITF. (A) Alignment of the two potential E-box sequences of E-cadherin from mouse and human. Sequences are displayed from the 5' to 3' end and were obtained from Genbank (accession numbers M81449 and L34545 for mouse and human, respectively). (B) EMSA using E-cadherin proximal E-box sequence (E-Prox) with recombinant MITF protein. The radioactively labeled E-cadherin oligonucleotide incubated with 0.1 µg his-tagged MITF protein (lane 1). Unlabeled oligonucleotide representing the E-Prox sequence (lanes 4 and 5; five- and tenfold molar excess, respectively), but not unlabeled oligonucleotide representing the mutated E-Prox sequence (CACCTG to CTCGAG, lanes 6 and 7; five- and tenfold molar excess, respectively) or the E-Pal sequence (lanes 2 and 3; five- and tenfold molar excess, respectively), could specifically compete MITF complex formation. (C) Activity of E-cadherin luciferase-promoter constructs in RAW 264.7 cells. The -178 to +92 (wild-type) E-cadherin promoter was compared with promoters containing the mutation in the E-Pal or E-Prox E-box sequences (E-boxes highlighted in panel A mutated to CTCGAG). In each experiment, 5 µg E-cadherin reporter plasmid was co-transfected with 2 µg MITF expression vector (or empty expression vector for basal activity). Reporter activity is expressed as relative luciferase activity. The average of three independent experiments performed in duplicate is shown, and the error bars indicate standard deviation.

EMSAs were performed using recombinant MITF protein expressed in bacteria and the E-cadherin E-box-like sequences (Fig. 2B) . These experiments revealed that MITF could form a complex with the proximal E-cadherin sequence (Fig. 2B , lane1), and formation of this complex could be specifically competed with an unlabeled oligonucleotide containing the homologous sequence (Fig. 2B , lanes 4 and 5). However, the E-cadherin promoter-distal E-Pal sequence could not compete for formation of this complex (Fig. 2B , lanes 2 and 3) and did not form a stable complex with recombinant MITF protein (unpublished results). In addition, an oligonucleotide based on the proximal E-cadherin sequence, but containing mutations that alter the E-box-like sequence (CACCTG to CTCGAG), was not able to compete for formation of the MITF complex with wild-type sequence (Fig. 2B , lanes 6 and 7).

To further test the functional significance of the conserved E-box sequences in the E-cadherin promoter, reporter genes composed of the mouse E-cadherin promoter fused to the firefly luciferase gene were constructed. Reporters representing the wild-type E-cadherin promoter sequences from -178 to +72 bp relative to the E-cadherin transcription initiation site or versions in which the distal or proximal E-box sequence was mutated (E-Pal and E-Prox in Fig. 2C , respectively) were constructed. The activity of the E-cadherin constructs was assayed in RAW 264.7 cells, a macrophage/osteoclast cell line [21 ] (Fig. 2C) .

There was no significant difference in the basal level activity of the wild type and mutant (E-Pal and E-Prox, Fig. 2C ). Co-transfection of the MITF expression vector along with wild-type E-cadherin promoter or the promoter mutated at the upstream E-Pal sequence resulted in a 10- to 12-fold increase in promoter activity. In contrast, co-transfection of the MITF expression vector with the promoter containing the mutated E-Prox sequence did not stimulate the promoter above the basal level (Fig. 2C) . The proximal conserved E-box is defined as a target for MITF action by EMSA and transient transfection assays.

Structure/function analysis of MITF transactivation using TRAP and E-cadherin reporters
To determine the regions of MITF that were necessary for transactivation of the osteoclast target promoters, a series of deletion mutations in the N-terminal and C-terminal regions of MITF were constructed. Three deletion mutations that represent the three types of transactivation results observed in our studies are represented in Figure 3 A . The mutation {triangleup}109 has an in-frame deletion of the region of MITF between amino acids 109 and 140 that represents a previously defined acidic-activation domain and potential CBP/p300 binding site [12 ]. Mutation {triangleup}140 contains a deletion of the region adjacent to the acidic-activation domain that has previously been shown to be dispensable for MITF activation in a melanocyte cell line [12 ]. Lastly, {triangleup}367 truncates a C-terminal region of MITF that contains a proline-rich region. A similar proline-rich region in the C-terminal of the related factor TFE3 has previously been shown to function as a transactivation domain [22 ].



View larger version (56K):
[in this window]
[in a new window]
 
Figure 3. MITF contains two transactivation domains in the N-terminal region. (A) Position of deletion mutations in MITF. Numbers indicate position of amino acids in the melanocyte form of MITF. AD is the acidic-activation domain that was mapped previously to amino acids 114–132 in MITF [12 ], B is the basic domain, HLH is the helix-loop-helix domain, and LZ is the leucine zipper domain as described previously [2 , 3 ]. (B) Activation of E-cadherin (left panel) or TRAP-luciferase (right panel) promoter constructs by MITF proteins in RAW 264.7 cells. Transient transfection assays were used to compare transactivation of wild-type MITF with various MITF deletion mutations. For each experiment, E-cadherin or TRAP reporter construct (5 µg) was transfected along with MITF expression vector (2 µg) or expression vector for the MITF deletion mutations, as indicated. The empty MITF expression vector (2 µg) was included in the basal promoter assay (first bar graph in each panel). Activity is expressed as relative luciferase activity. The average of three independent experiments performed in duplicate is shown, and the error bars indicate standard deviation. (C) MITF deletion mutations can act in a dominant negative fashion. Transient transfection assays were performed in RAW 264.7 cells. The wild-type E-cadherin or TRAP construct (5 µg) was co-transfected with 2 µg MITF expression vector alone or 1 µg each of expression vectors for wild-type MITF and MITF deletion mutation, as indicated (total of 2 µg expression vector). MITF empty expression vector (2 µg) was included in the basal reporter assay (first bar graph in each panel). Activity is expressed as relative luciferase activity. The average of three independent experiments performed in duplicate is shown, and the error bars indicate standard deviation.

The MITF deletion mutations were co-transfected with TRAP or E-cadherin promoter-luciferase reporters into RAW264.7 cells (Fig. 3B) . In this set of experiments, wild-type MITF transactivated E-cadherin or TRAP promoters 20- or 30-fold, respectively (Fig. 3B , left or right panel). The {triangleup}109 MITF transactivated the E-cadherin promoter just as well as wild-type MITF but exhibited five- to sixfold lower transactivation of the TRAP promoter than wild-type (a significant decrease; P<0.0001 by ANOVA multiple comparison test). The {triangleup}140 MITF transactivated E-cadherin and TRAP reporters eight- to tenfold less efficiently than wild-type MITF (Fig. 3B ; P<0.0001). The {triangleup}367 MITF protein activated both reporters to the same extent as wild-type MITF, indicating that the C-terminal proline-rich sequence was not necessary for transactivation of the OCL reporter genes (Fig. 3B) .

To gain some insight into the normal bone phenotype in ws and x-38 MITF mutant mice, the {triangleup}109 and {triangleup}140 expression vectors were co-transfected along with wild-type MITF to determine if they could act in a dominant negative fashion (Fig. 3C) . For these experiments, equal amounts (1 µg each) of expression vectors encoding mutated or wild-type proteins were co-transfected along with the two reporter genes. Consistent with the results of the transactivation assay, {triangleup}109 and {triangleup}140 mutations were able to decrease transactivation by MITF approximately threefold when the TRAP reporter was tested (Fig. 3C , left panel). However, only the {triangleup}140 mutation inhibited MITF activation of the E-cadherin promoter (by fivefold, Fig. 3C , right panel). This result is consistent with the results of the transactivation assays presented above.

Fine mapping of sequences contained within the {triangleup}140 mutation necessary for activation of target promoters
We reasoned that comparison of the sequences defined by the {triangleup}140 mutation to the other members of the MITF bHLHzip family might reveal conserved sequences necessary for activation of target genes. This comparison revealed blocks of homology between MITF and TFE3 and to a lesser extent, TFEB (Fig. 4A ). TFEC lacks the acidic-activation domain present in the other MITF family members [23 ] and had limited homology in the residues most conserved in the 140–185 region of MITF (Fig. 4A) . Based on these comparisons, point mutations were constructed by substituting stretches of four conserved amino acids with alanine in three different regions of homology (highlighted in Fig. 4A ).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 4. Detailed mapping of the activation domain defined by the {triangleup}140 mutation. (A) Alignment of MITF, TFE3, TFEB, or TFEC in the region of MITF amino acids 140–185. The conserved sequences mutated to alanine residues are indicated in large bold letters (mut1, mut2, and mut 3, respectively). (B) Activity of the point mutations measured in transient transfection assays in RAW264.7 cells. E-cadherin (left panel) or TRAP (right panel) luciferase reporter constructs (5 µg) were co-transfected with 2 µg expression vector for wild-type MITF or MITF containing the indicated point mutant. MITF empty expression vector (2 µg) was included in the basal reporter assay (first bar graph in each panel). Activity is expressed as relative luciferase activity. The average of three independent experiments performed in duplicate is shown, and the error bars indicate standard deviation. *, Statistically significant differences in activity of the MITF point mutations compared with wild-type MITF, as determined by ANOVA using pair-wise comparison.

The alanine substitution mutations in MITF (referred to as mut1, mut2, and mut3) all reduced transactivation potential compared with the wild-type MITF protein when tested in transient transfections in RAW264 cells. In particular, MITF-mut1 and MITF-mut3 were found to have significantly lower activity on E-cadherin (15-fold and 4-fold lower activity, respectively) and TRAP (5-fold and 8-fold, respectively) reporters when compared with wild-type protein displayed (ANOVA using pair-wise comparison; P<0.0001). The smaller apparent effect of MITF mut-2 (two- to threefold) was not statistically significant.

The {triangleup}109 and {triangleup}140 mutations are stably expressed and localized to the nucleus of OCLs
The expression of proteins containing the {triangleup}109 and {triangleup}140 mutations was compared with wild type to insure that the alteration of transactivation potential was not a result of lower protein stability. In one set of experiments, expression of influenza HA-tagged versions of wild-type MITF and the {triangleup}109 and {triangleup}140 MITF mutations was studied in COS cells following transient transfection (Fig. 5A , left panel). In another set of experiments, retrovirus vectors were used to express 6Xhis-tagged versions of these three proteins as well as a protein encoded by the mi allele in Rat1 cells (Fig. 5A , right panel). In both types of experiments, no major differences in the level of 35S-labeled MITF proteins were observed (Fig. 5A ; see Materials and Methods), indicating that protein stabilities are not grossly altered by the deletion mutations. In both cell types, the MITF wild type, {triangleup}109, and {triangleup}140 proteins appeared as a doublet (Fig. 5A) . The band with lower electrophoretic mobility has been shown previously to be a version of MITF phosphorylated at position ser73 [24 ]. For unknown reasons, the MITF-mi protein appears as only a single band, presumably the unphosphorylated version of the protein.



View larger version (74K):
[in this window]
[in a new window]
 
Figure 5. MITF deletion mutations are stably expressed and localized to the nucleus. (A) MITF proteins were expressed transiently in COS cells or were stably expressed in Rat1 cells using retrovirus vectors. Immunoprecipitation of 35S-labeled cell extracts for COS (left panel) or Rat-1 cells (right panel) with an HA-specific antibody (left panel) or a 6Xhis tag- specific antibody (right panel). In the left panel, HA vector (lane 1), HA-tagged wild-type MITF (lane 2), HA-tagged MITF {triangleup}109 (lane 3), and HA-tagged MITF {triangleup}140 (lane 4). Right panel, cells infected with control retrovirus vector (lane 1), infection with retrovirus vector expressing his-tagged MITF (lane 2), infection with retrovirus vector expressing his-tagged MITF mi mutation (lane 3), infection with retrovirus vector expressing his-tagged MITF {triangleup}109 (lane 4), and infection with retrovirus vector expressing his-tagged MITF {triangleup}140 (lane 5). The upper arrow indicates the position of the wild-type, presumed-unphosphorylated MITF protein; the lower arrow indicates the position of the presumed-unphosphorylated MITF-mutated proteins in each panel. The specific MITF bands present with lower electrophoretic mobility likely represent the protein phosphorylated at position ser 73 (see text for details; [24 ]). (B). Expression of MITF proteins in OCLs following infection with retrovirus-expression vectors (as indicated). OCLs were stained by immunohistochemistry using 6Xhis-tag-specific antibody. Original magnification, 400x.

Spleen cells from mice homozygous for the mi mutation were infected with the retroviruses expressing 6Xhis-tagged MITF wild-type and mutated proteins (see Materials and Methods for details). Following treatment with RANKL and CSF-1 for 7 days, cells were fixed, and expression of MITF proteins in OCLs was detected by immunohistochemistry using an antibody that recognizes the 6Xhis-tag (Fig. 5B) . This analysis revealed that all four versions of the MITF protein studied are located predominantly in the nucleus of the OCLs. Previous work had indicated that the MITF-mi protein might be localized predominantly to the cell cytoplasm [25 ], but our analysis in primary OCLs indicated that the 6Xhis-tagged (Fig. 5B) or endogenous MITF-mi (unpublished results) protein was located predominantly in the nucleus.

Expression of the {triangleup}140 mutation in mi/mi OCLs fails to rescue differentiation
The results presented above suggested that the {triangleup}140 mutation defines a region of MITF necessary for transactivation of OCL target genes and by extension, is important for OCL differentiation. To test directly the biological role of this putative activation domain in OCL differentiation, the ability of the {triangleup}140 mutation to rescue differentiation of mi/mi OCLs was compared with wild-type MITF and the {triangleup}109 mutation. The MITF genes were introduced into spleen cells obtained from mi/mi mice using retrovirus vectors as above. Following treatment of transduced OCLs with RANKL and CSF-1 for 7 days, expression of 6Xhis-tagged proteins was determined by immunohistochemistry. Multinuclearity of cells positive for expression of tagged proteins was used to score differentiation. The average of three experiments (each performed in triplicate) is represented in graphical form in Figure 6. Table 1 contains a more complete summary of the data. These experiments demonstrated that expression of the wild-type MITF protein could rescue differentiation in approximately 60% of the infected mi/mi mononuclear OCLs. In contrast, <5% of cells infected with virus encoding the mi allele or with viral vector alone was multinuclear. Expression of the {triangleup}109 mutation resulted in rescue of 35% of mi/mi OCLs, about 60% the level of rescue seen with wild type—a difference that is significant (ANOVA with pair-wise comparison; P<0.0001). However, the {triangleup}140 mutation is more seriously impaired, with only 7% of cells rescued. This is a statistically significant difference from wild type or {triangleup}109 mutation (P<0.0001 for either) but is not different from rescue observed in the mi/mi or viral vector controls (P=0.012). The majority of cells rescued by {triangleup}109 or {triangleup}140 mutations was predominantly bi- or tri-nuclear, in contrast to wild-type MITF, in which cells with four to six nuclei were encountered frequently (see Fig. 5B ).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 6. The {triangleup}140 mutation fails to rescue differentiation of mi/mi OCLs. Primary OCLs were infected with retroviruses expressing the different MITF genes as indicated. Expression of 6Xhis-tagged MITF proteins determined by immunohistochemistry using an anti-6Xhis-tag antibody. Cell nuclei were stained with bis-benzamide, and 6Xhis-posistve cells were scored as mononuclear or multinuclear. Each experiment was performed in triplicate, and 200 cells were counted in each replicate (total of 600 cells per experiment). For viral vector only and no virus controls, a random population of cells was counted. Represented is the average of three independent experiments, with the bar indicating standard deviation.


View this table:
[in this window]
[in a new window]
 
Table 1. Rescue of mi/mi OCLs by Retrovirus Vectors Expressing MITF Activation Domain Mutations


arrow
DISCUSSION
 
MITF affects the differentiation of several cell types arising from distinct developmental lineages by regulating different sets of target genes in, for example, melanocytes and osteoclasts. Additionally, MITF action may also be involved in distinguishing between more closely related cell types, macrophages and osteoclasts. This raises the interesting question as to how the same transcription factor targets different sets of genes in distinct cell types. A unique resource available for addressing this question is the large collection of MITF alleles, many of which have been characterized extensively at the phenotypic and molecular level [6 7 8 ]. The MITF semi-dominant allele, mi, has a mutation that results in deletion of one of four arginine residues within the basic domain of the factor, resulting in protein that completely lacks DNA binding activity [1 , 11 ]. Mice homozygous for mi allele exhibit defective osteoclast maturation and terminal differentiation, but macrophage differentiation is not obviously altered [17 18 19 ]. This phenotype is distinct from that observed when other transcription factors expressed in macrophages and osteoclasts, such as NF-{kappa}B, PU.1, or c-fos, are mutated by targeted deletion because such mutations affect earlier stages of myeloid differentiation, and they result in an absence or defects in macrophages and osteoclasts in mutant mice [26 27 28 ]. In this study, we have confirmed that osteoclast maturation appears to halt at the mononuclear cell stage in vivo during early bone development in mi/mi embryos, as well as in vitro using a cell-culture system that depends on the addition of defined factors for OCL differentiation. Therefore, studying MITF action in osteoclasts may provide a unique window into understanding how cell-cycle exit, cell fusion, and expression of genes necessary for bone resorption are coordinated during the terminal differentiation of this cell type.

Two semi-dominant MITF alleles, ws and x-38, encoding proteins that lack an acidic-activation domain, show no obvious osteoclast phenotype [6 ]. These data led us to consider that MITF might contain an additional activation domain that could compensate for the loss of the acidic-activation domain in osteoclasts. This hypothesis was confirmed by experiments demonstrating that a second N-terminal activation domain, located between amino acid residues 140 and 185, was required for transactivation of potential OCL target genes. Analysis of point mutations within this region highlighted the role of specific amino acid residues conserved with other closely related bHLH-zip family members, in particular with TFE3. A biological role for this N-terminal region of MITF was established in rescue experiments performed using the differentiation-defective mi/mi OCLs. Wild-type MITF or a version lacking the acidic-activation domain could effectively rescue differentiation of mi/mi OCLs, but a protein lacking the 140–185 activation domain could not.

Because of technical difficulties with the experiments, we could not obtain sufficient numbers of rescued cells to perform western blots to insure that the mutated forms of MITF were expressed at equivalent levels in retrovirus-transduced cells. Experiments performed in two heterologous cell types showed no gross differences in protein stability between wild-type and mutated MITF proteins. In addition, immunohistochemical analysis of infected OCLs demonstrated that all MITF protein versions were expressed and located in the nucleus. Although immunohistochemistry is not strictly quantitative, the levels of staining were equivalent for all MITF genes transduced into the OCLs, suggesting that protein levels did not vary widely. Although we believe the sum of our data makes the trivial explanation of our results unlikely, we cannot rule out the possibility that variable levels of protein expression between wild-type and mutated versions of MITF account for our results.

In the course of analysis of MITF function, the E-cadherin promoter was identified as a potential target of MITF. The gene was chosen as a candidate because, like TRAP, its expression greatly increases during OCL maturation, and more importantly, it has been causally linked to the formation of multinucleated giant cells [20 ], a process that does not occur in OCL-derived mi/mi mice. As in the TRAP gene [11 ], we have identified a conserved E-box that could be bound specifically by MITF and was necessary for promoter transactivation by this factor. Recent work has demonstrated that another potential target of MITF in osteoclasts, the human cathepsin K gene, contains similar cis-acting elements [29 ]. Although the data presented here are consistent with the proposal that E-cadherin is a target for MITF, additional types of experiments will have to be performed to confirm that this is the case. For example, experiments in transgenic mice, such as were performed with the TRAP promoter [11 ], would provide in vivo evidence supporting the hypothesis that E-cadherin is a target of TRAP.

The MITF-target E-box in E-cadherin is located close to the site where transcription initiates, at position -18, in contrast to other osteoclast target genes TRAP and cathepsin K, in which the MITF binding site is more distal, at a position ~100 nucleotides 5' to the major transcriptional start sites [11 , 29 ]. This difference correlates with a differential requirement for MITF activation domains: The E-cadherin promoter required only the 140–185 activation domain defined by our experiments, and the acidic-activation domain between 109 and 140 and the 140–185 element were required for maximal TRAP activation. One explanation for this result is that distinct types of activation domains are known to function differently depending on their distance from core promoter elements such as TATA boxes and initiator (Inr) elements [30 , 31 ]. In this regard, MITF transactivation may be very similar to the example provided by upstream regulatory factor-2 (USF-2), a distantly related bHLHzip factor. USF-2 has two N-terminal activation domains that function differently depending on whether the USF binding site is promoter-proximal or -distal [32 ]. It is interesting that the USF-2 activation domain, termed USR, which functions in a promoter-proximal, Inr-dependent manner, may be important for cell type-specific activation of target genes [33 ].

In conclusion, results presented here likely identify an additional activation domain in the transcription factor MITF that may partly account for the ability of this factor to regulate different sets of genes in osteoclasts and melanocytes. The results suggest the hypothesis that MITF might recruit different co-activator molecules in melanocytes and osteoclasts. Identification and characterization of such putative co-activators will be required to determine their role in the molecular mechanisms underlying osteoclast-specific gene regulation.


arrow
ACKNOWLEDGEMENTS
 
K. C. M. is supported by a NIH NRSA award (F32-AR08568). This work was supported by NIAMS grant AR-44719 (M. C. O.) and by the National Health and Medical Research Council of Australia (D. A. H.). We thank Lori Nelsen for expert technical assistance. We acknowledge the role of the Keck Genetic facility in maintaining the mi mouse colony used for the work.


arrow
FOOTNOTES
 
Current address of Kavita Marfatia: Program in Genetics, Emory University, Atlanta, GA 30322.

Current address of Georgia H. Purdom: Department of Biology, Mt. Vernon Nazarene College, Mt. Vernon, OH 43050.

Received April 30, 2001; revised August 18, 2001; accepted August 20, 2001.


arrow
REFERENCES
 
    1
  1. Hemesath, T. J., Steingrimsson, E., McGill, G., Hansen, M. J., Vaught, J., Hodgkinson, C. A., Arnheiter, H., Copeland, N. G., Jenkins, N. A., Fisher, D. E. (1994) Microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family Genes Dev 8,2770-2780[Abstract/Free Full Text]
  2. 2
  3. Hodgkinson, C. A., Moore, K. J., Nakayama, A., Steingrimsson, E., Copeland, N. G., Jenkins, N. A., Arnheiter, H. (1993) Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic helix-loop-helix zipper protein Cell 74,395-404[Medline]
  4. 3
  5. Hughes, M. J., Lingrel, J. B., Krakowsky, J. M., Anderson, K. P. (1993) A helix-loop-helix transcription factor-like gene is located at the mi locus J. Biol. Chem. 268,20687-20690[Abstract/Free Full Text]
  6. 4
  7. Amiel, J., Watkin, P. M., Tassabehji, M., Read, A. P., Winter, R. M. (1998) Mutation of the MITF gene in albinism-deafness syndrome (Tietz syndrome) Clin. Dysmorphol. 7,17-20[Medline]
  8. 5
  9. Tassabehji, M., Newton, V. E., Read, A. P. (1994) Waardenburg syndrome type 2 caused by mutation in the human microphthalmia (MITF) gene Nat. Genet. 8,251-255[Medline]
  10. 6
  11. Hallson, J. H., Favor, J., Hodgkinson, C., Glaser, T., Lamoreux, M. L., Magnusdottir, R., Gunnarsson, G. J., Sweet, H. O., Copeland, N. G., Jenkins, N. A., Stiengrimsson, E. (2000) Genomic, transcriptional and mutational analysis of the mouse microphthalmia locus Genetics 155,291-300[Abstract/Free Full Text]
  12. 7
  13. Moore, K. J. (1995) Insight into the micropthalmia gene Trends Genet 11,442-448[Medline]
  14. 8
  15. Steingrimsson, E., Moore, K. J., Lamoreux, M. L., Rerre-D’Amare, A. R., Burley, S. K., Zimring, D. C. S., Skow, L. C., Hodgkinson, C. A., Arnheiter, H., Copeland, N. G., Jenkins, N. A. (1994) Molecular basis of mouse microphthalmia (mi) mutations helps explain their developmental and phenotypic consequences Nat. Genet. 8,256-263[Medline]
  16. 9
  17. Bentley, N. J., Eisen, T., Goding, C. R. (1994) Melanocyte-specific expression of the human tyrosinase promoter: activation by the microphthalmia gene product and role of the initiator Mol. Cell. Biol. 14,7996-8006[Abstract/Free Full Text]
  18. 10
  19. Aksan, I., Goding, C. R. (1998) Targeting the microphthalmia basic helix-loop-helix-leucine zipper transcription factor to a subset of E-box elements in vitro and in vivo Mol. Cell. Biol. 18,6930-6938[Abstract/Free Full Text]
  20. 11
  21. Luchin, A., Purdom, G., Murphy, K., Clark, M-Y., Angel, N., Cassady, A. I., Hume, D. A., Ostrowski, M. C. (2000) The microphthalmia transcription factor regulates expression of the tartrate-resistant acid phosphatase gene during terminal differentiation of osteoclasts J. Bone Min. Res. 15,451-460[Medline]
  22. 12
  23. Sato, S., Roberts, K., Gambino, G., Cook, A., Kouzarides, T., Goding, C. R. (1997) CBP/p300 as a co-factor for the microphthalmia transcription factor Oncogene 14,3083-3092[Medline]
  24. 13
  25. Price, E. R., Ding, H-F., Badalian, T., Bhattacharya, S., Takemoto, C., Yao, T-P., Hemesath, T. J., Fisher, D. E. (1998) Lineage-specific signaling in melanocytes: c-kit stimulation recruits p300/CBP to microphthalmia J. Biol. Chem. 273,17983-17986[Abstract/Free Full Text]
  26. 14
  27. Hennig, G., Lowrick, O., Birchmeier, W., Behrens, J. (1996) Mechanisms identified in the transcriptional control of epithelial gene expression J. Biol. Chem. 271,595-602[Abstract/Free Full Text]
  28. 15
  29. Miller, A. D., Buttimore, C. (1986) Redesign of retovirus packaging cell lines to avoid recombination leading to helper virus production Mol. Cell. Biol. 6,2895-2902[Abstract/Free Full Text]
  30. 16
  31. de la Pompa, J. L., Zeller, R. (1993) Ectopic expression of genes during chicken limb pattern formation using replication defective retroviral vectors Mech. Dev. 43,187-198[Medline]
  32. 17
  33. Green, P. M., Marshall, M. J., Nisbet, N. W. (1986) A study of osteoclasts on calvaria of normal and osteopetrotic (mi/mi) mice by vital staining with acridine orange Br. J. Exp. Pathol. 67,85-93[Medline]
  34. 18
  35. Holtrop, M. E., Cox, K. A., Elion, G., Simmons, H. A., Raisz, L. G. (1981) The ultrastructure of osteoclasts in microphthalmic mice Metab. Bone Dis. Relat. Res. 3,123-129[Medline]
  36. 19
  37. Thesingh, C. W., Scherft, J. P. (1985) Fusion disability of embryonic osteoclast precursor cells and macrophages in the microphthalmic osteopetrotic mouse Bone 6,43-52[Medline]
  38. 20
  39. Mbalaviele, G., Chen, H., Boyce, B. F., Mundy, G. R., Yoneda, T. (1995) The role of cadherin in the generation of multinucleated osteoclasts from mononuclear precursors in murine marrow J. Clin. Investig. 6,2757-2765
  40. 21
  41. Matsumoto, M., Sudo, T., Saito, H., Osada, H., Susujimoto, M. (2000) Involvement of p38 mitogen-activated protein kinase signaling pathway in osteoclastogenesis mediated by receptor activator of NF-kappa B ligand (RANKL) J. Biol. Chem. 275,31155-31161[Abstract/Free Full Text]
  42. 22
  43. Artandi, S. E., Merrell, K., Avitahl, N., Wong, K-K., Calame, K. (1995) TFE3 contains two activation domains, one acidic and the other proline-rich, that synergistically activate transcription Nucleic Acids Res 23,3865-3871[Abstract/Free Full Text]
  44. 23
  45. Rehli, M., Elzen, N. D., Cassady, A. I., Ostrowski, M. C., Hume, D. A. (1999) Cloning and characterization of the murine genes for bHLH-ZIP transcription factors TFEC and TFEB reveal a common gene organization for all MiT subfamily members Genomics 56,111-120[Medline]
  46. 24
  47. Hemesath, T. J., Price, E. R., Takemoto, C., Badalian, T., Fisher, D. E. (1998) MAP kinase links the transcription factor microphthalmia to c-kit signalling in melanocytes Nature 391,298-301[Medline]
  48. 25
  49. Takebayashi, K., Chida, K., Tsukamoto, I., Morii, E., Munakata, H., Arnheiter, H., Kuroki, T., Kitamura, Y., Nomura, S. (1996) The recessive phenotype displayed by a dominant negative microphthalmia-associated transcription factor mutant is a result of impaired nucleation potential Mol. Cell. Biol. 16,1203-1211[Abstract]
  50. 26
  51. Franzoso, G., Carlson, L., Xing, L., Poljak, L., Shores, E. W., Brown, K. D., Leonardi, A., Tran, T., Boyce, B. F., Siebenlist, U. (1997) Requirement for NF-{kappa}B in osteoclast and B-cell development Genes Dev 11,3482-3496[Abstract/Free Full Text]
  52. 27
  53. Tondravi, M. M., McKercher, S. R., Anderson, K., Quiroz, M., Maki, R., Teitelbaum, S. L. (1997) Osteopetrosis in mice lacking haematopoietic transcription factor PU.1 Nature 386,81-84[Medline]
  54. 28
  55. Wang, Z-Q., Ovitt, C., Grigoriadis, A. E., Mohle-Steinlein, U., Ruther, U., Wagner, E. F. (1992) Bone and haematopoietic defects in mice lacking c-fos Nature 360,741-745[Medline]
  56. 29
  57. Motyckova, G., Weilbaecher, K. N., Horstmann, M., Rieman, D. J., Fisher, D. Z., Fisher, D. E. (2001) Linking osteopetrosis and pycnodysostosis: regulation of cathepsin K expression by the microphthalmia transcription factor family Proc. Natl. Acad. Sci. USA 98,5798-5803[Abstract/Free Full Text]
  58. 30
  59. Das, G., Hinkley, C. S., Herr, W. (1995) Basal promoter elements as a selective determinant of transcriptional activator functions Nature 374,657-660[Medline]
  60. 31
  61. Seipel, K., Georgiev, O., Schaffner, W. (1992) Different activation domains stimulate transcription from remote (‘enhancer’) and proximal (‘promoter’) positions EMBO J 11,4961-4968[Medline]
  62. 32
  63. Luo, X., Sawadogo, M. (1996) Functional domains of the transcription factor USF2: atypical nuclear localization signals and context-dependent transcriptional activation domains Mol. Cell. Biol. 16,1367-1375[Abstract]
  64. 33
  65. Qyang, Y., Luo, X., Lu, T., Ismail, P. M., Krylov, C., Vinson, C., Sawadogo, M. (1999) Cell-type-dependent activity of the ubiquitous transcription factor USF in cellular proliferation and transcriptional activation Mol. Cell. Biol. 19,1508-1517[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
R. Hu, S. M. Sharma, A. Bronisz, R. Srinivasan, U. Sankar, and M. C. Ostrowski
Eos, MITF, and PU.1 Recruit Corepressors to Osteoclast-Specific Genes in Committed Myeloid Progenitors
Mol. Cell. Biol., June 1, 2007; 27(11): 4018 - 4027.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. M. Sharma, A. Bronisz, R. Hu, K. Patel, K. C. Mansky, S. Sif, and M. C. Ostrowski
MITF and PU.1 Recruit p38 MAPK and NFATc1 to Target Genes during Osteoclast Differentiation
J. Biol. Chem., May 25, 2007; 282(21): 15921 - 15929.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. A. Meadows, S. M. Sharma, G. J. Faulkner, M. C. Ostrowski, D. A. Hume, and A. I. Cassady
The Expression of Clcn7 and Ostm1 in Osteoclasts Is Coregulated by Microphthalmia Transcription Factor
J. Biol. Chem., January 19, 2007; 282(3): 1891 - 1904.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
G. Mbalaviele, G. Anderson, A. Jones, P. De Ciechi, S. Settle, S. Mnich, M. Thiede, Y. Abu-Amer, J. Portanova, and J. Monahan
Inhibition of p38 Mitogen-Activated Protein Kinase Prevents Inflammatory Bone Destruction
J. Pharmacol. Exp. Ther., June 1, 2006; 317(3): 1044 - 1053.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
K. M. Roundy, G. Spangrude, J. J. Weis, and J. H. Weis
Partial rescue of B cells in microphthalmic osteopetrotic marrow by loss of response to type I IFNs
Int. Immunol., November 1, 2005; 17(11): 1495 - 1503.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Huan, D. Sashital, T. Hailemariam, M. L. Kelly, and C. A. J. Roman
Renal Carcinoma-associated Transcription Factors TFE3 and TFEB Are Leukemia Inhibitory Factor-responsive Transcription Activators of E-cadherin
J. Biol. Chem., August 26, 2005; 280(34): 30225 - 30235.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. C. Mansky, U. Sankar, J. Han, and M. C. Ostrowski
Microphthalmia Transcription Factor Is a Target of the p38 MAPK Pathway in Response to Receptor Activator of NF-kappa B Ligand Signaling
J. Biol. Chem., March 22, 2002; 277(13): 11077 - 11083.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mansky, K. C.
Right arrow Articles by Ostrowski, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mansky, K. C.
Right arrow Articles by Ostrowski, M. C.