Pepro Tech

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wardrop, S. L.
Right arrow Articles by Richardson, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wardrop, S. L.
Right arrow Articles by Richardson, D. R.
(Journal of Leukocyte Biology. 2002;71:99-106.)
© 2002 by Society for Leukocyte Biology

Induction of Nramp2 in activated mouse macrophages is dissociated from regulation of the Nramp1, classical inflammatory genes, and genes involved in iron metabolism

S. L. Wardrop*, C. Wells*, T. Ravasi*, D. A. Hume* and D. R. Richardson{dagger}

* Institute of Molecular Biosciences and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, Brisbane, Australia; and
{dagger} The Heart Research Institute, Camperdown, Sydney, Australia

Correspondence: Professor D. A. Hume, Institute of Molecular Biosciences, University of Queensland, Brisbane 4072, Australia. E-mail: d.hume{at}imb.uq.edu.au


arrow
ABSTRACT
 
Nramp2 is a widely expressed metal-ion transporter that is involved in dietary iron absorption in the duodenum and iron uptake from transferrin in peripheral tissues. Nramp1 is a related gene involved in regulation of host pathogen interaction. Nramp2 has at least two alternatively spliced isoforms, one of which contains an iron-responsive element in its 3'-untranslated region. In this study, we investigated the regulation of both isoforms of Nramp2 in activated primary macrophages from mouse strains with wild-type (Bcgr) or mutant (Bcgs) alleles. The Nramp2-IRE and/or -nonIRE transcripts were up-regulated in all mouse strains analyzed after treatment with interferon-{gamma} and lipopolysaccharide. cDNA microarray analysis revealed that Nramp2 regulation is controlled discordantly from other iron-regulated genes and classical macrophage-activation genes in different mouse strains. We suggest that Nramp2 is regulated independently of known iron-responsive genes in macrophages, and its function in host defense is unrelated to Nramp1.

Key Words: transferrin receptorferritin • 3'UTR • iNOS


arrow
INTRODUCTION
 
In mice, natural resistance to infection with intracellular pathogens such as Salmonella, Mycobacterium, and Leishmania is controlled by the Nramp1 (natural resistance-associated macrophage protein 1) gene [1 2 3 ]. Polymorphisms in Nramp1 have also been associated with disease susceptibility in humans [4 5 6 ]. Nramp1 (also known as Bcg/Lsh/Ity) mRNA is expressed primarily in macrophages and polymorphonuclear leukocytes [1 , 7 ] and is up-regulated by exposure to inflammatory stimuli [7 ]. In inbred mouse strains, Nramp1 is present in two allelic forms: the Bcgr dominant allele, which confers resistance to infection, and the Bcgs recessive allele, which has a single G169D mutation in the fourth transmembrane domain of the protein that abrogates Nramp1 function [3 , 8 ]. Nramp1 has been localized to the late endosomal/lysosomal compartment in macrophages and is rapidly recruited to the membrane of phagosomes containing engulfed pathogens [9 , 10 ]. These findings suggest that it may act as a transporter at the phagosomal membrane. Clues on the mechanism of action and substrate transported by Nramp1 have come from the discovery and characterization of a second mammalian Nramp gene.

The Nramp2 (also known as DMT1 or DCT1) gene encodes a protein that is highly homologous to Nramp1 (78%) but is more widely expressed [11 12 13 ]. Nramp2 encodes an H+-dependent symporter of Fe2+, Mn2+, Zn2+, and other divalent metals [12 ] localized to the plasma membrane and recycling endosomes [14 , 15 ]. Nramp2 is probably the iron transporter responsible for apical entry of iron into enterocytes and the endosomal transporter in transferrin/transferrin receptor-containing endosomes. Cloning and sequencing of Nramp2 cDNA have shown at least two splice variants generated by alternative use of two 3' exons encoding distinct C-termini of the protein and 3'-untranslated regions (UTRs) [16 ]. One of the 3'UTRs contains a putative iron-responsive element (IRE), similar to IREs found in the 3'UTR of the transferrin receptor (TfR) mRNA and 5'UTR of the ferritin mRNA [12 , 16 ]. The IRE in Nramp2 could possibly contribute to regulation by iron and iron regulatory protein (IRP) in intestinal cells [12 , 17 , 18 ]. The role and regulation of the nonIRE transcript of Nramp2 have not been defined.

Jabado et al. [19 ] have provided the first direct evidence that Nramp1 is a metal-ion transporter and mediates H+-dependent transport of Mn2+ from the macrophage intraphagosomal space. These studies suggest that Nramp1 contributes to defense against infection by extrusion of divalent cations from the phagosome. Conversely, Zwilling et al. [20 ] and Kuhn et al. [21 ] suggest that Nramp1 transports divalent cations into the phagosome, inhibiting pathogen growth by generating toxic hydroxyl radicals. These proposals may not be exclusive because Nramp1 may actually be capable of transport of different cations in both directions against a proton gradient [22 , 23 ].

Unlike other cell types, macrophages express Nramp1 and Nramp2. At present, very little is known about the role of Nramp2 in macrophage iron metabolism, especially after exposure to inflammatory mediators. Preliminary experiments using the mouse macrophage cell line RAW264.7, which lacks a functional Nramp1 protein [24 ], revealed a differential regulation of Nramp2 mRNA expression after activation with bacterial lipopolysaccharide (LPS), with or without the macrophage-activating lymphokine interferon-{gamma} (IFN-{gamma}) [25 ]. The putative Nramp2-IRE transcript was selectively up-regulated, whereas the putative Nramp2-nonIRE transcript was unaffected. Treatment with LPS and IFN-{gamma}/LPS also increased 59Fe uptake from 59Fe-nitrilotriacetic acid, but the TfR mRNA levels and 59Fe uptake from 59Fe-Tf were decreased [25 ]. The fact that the Nramp2-IRE mRNA expression was not regulated in parallel with the TfR mRNA or IRP1 RNA-binding activity suggests multiple regulatory mechanisms in these cells.

Because RAW264.7 cells lack a functional Nramp1, we considered the possibility that induction of Nramp2 may partially compensate for the Nramp1 deficiency. In the current study, we have examined the regulation of Nramp1 and Nramp2 mRNA in primary macrophages from a range of mouse strains that are Bcgs (Nramp1D169) or Bcgr (Nramp1G169). The regulation of these two transcripts was then compared with other iron-responsive and macrophage-activation genes, and the results were discussed in terms of macrophage activation and iron homeostasis.


arrow
MATERIALS AND METHODS
 
Mice
Inbred mouse strains BALB/cJ, DBA1/J, and C57BL/6J, which are Bcgs (Nramp1D169), and DBA2/J, SJL/J, and C3H/HeJ, which are Bcgr (Nramp1G169), were purchased from the Animal Resource Center, Canning Vale, Western Australia, and maintained in our animal facility.

Cell culture and treatments
Mouse bone marrow-derived macrophages (BMMs) were differentiated in culture with colony-stimulating factor (CSF)-1, as previously described [26 ]. Cells were used for experiments on days 6–8. All BMMs were cultured in RPMI-1640 containing 10% heat-inactivated Serum Supreme (Biowhittaker, Walkersville, MD), 2 mM glutamine (Gibco BRL, Sydney, Australia), 30 µg/L penicillin (Gibco BRL), and 100 µg/L streptomycin (Gibco BRL). Activation of the BMMs was achieved by incubating with 20 U/ml murine interferon-{gamma} (IFN-{gamma}; Gibco BRL) and 100 ng/mL LPS (from Salmonella Minnesota Re 595; Sigma Chemical Co., St. Louis, MO). All cell cultures were done at 37°C in humidified air with 5% CO2. Cellular viability was monitored by phase-contrast microscopy.

RNase protection assays
All experiments were performed using the Ribonuclease Protection Assay kit (RPA IITM; Ambion Inc., Austin, TX), as specified by the manufacturer. Briefly, 32P-labeled RNA probes were synthesized complementary to the target RNA. The probes used were generated by polymerase chain reaction (PCR) using the following primers: Nramp1 (5'GTCTGCCATCTCTACTACC3', 5'GGCAGTGGGCATCGTCGGT3'), Nramp2-nonIRE (5'GGACCTTTCTGACGATGAAC TTC3', 5'GCTAGCCAGCCAGTAAGTTC3'), Nramp2-IRE (5'GGATCAGTCTGTCTGTCTTTGC3', 5'CCTGTAGCATTAGGCAGCAC3'), and ß-actin (5'CCTGTATGCCTCTGGTCGTA3', 5'CATGAAGATCCTGACCGAGC3'). The corresponding T7 or SP6 RNA polymerase was then used to generate anti-sense RNA transcripts using an in vitro transcription kit (Promega, Madison, WI). Total RNA (30 µg) and excess labeled probes (~2x105 cpm) were incubated at 42°C overnight to hybridize probe to its complement in the sample RNA. After hybridization, the mixtures were treated with a 1:100 dilution of the ribonuclease A/T1 mix at 37°C for 30 min to degrade unhybridized probe. The protected fragments were run on 8 M/5% polyacrylamide gels at 200V for 2 h and visualized by autoradiography. Gels were dried and exposed to Kodak XAR films for 2 h to 2 days, quantified by scanning densitometry, and analyzed using Molecular Analyst software (Bio-Rad, Hercules, CA).

Cloning the Nramp2 allele from BALB/cJ mice
Total RNA from BALB/cJ strain BMMs (1–5 µg) was reverse-transcribed (RT) in a 20 µl reaction with NRP5 dT primer (kindly provided by David Frazer, Queensland Institute of Medical Research, Australia; Table 1 ) using Superscript II (Gibco BRL), according to the manufacturer’s instructions. Initial PCRs to amplify the BALB/cJ Nramp2-nonIRE and -IRE fragments used primers NRP1/NRP2 and NRP3/NRP4, respectively. Amplification was performed on 2.5 µl cDNA in a 50 µl volume using the Advantage cDNA PCR kit (Clontech, Palo Alto, CA). The PCR cycles were performed on a PTC-200 DNA Engine (M.J. Research, Watertown, MA) and consisted of a 2-min denaturation at 94°C, followed by 35 cycles at 94°C (30 s), 65°C (30 s), and 72°C (1 min) and a single, final extension period of 7 min at 72°C. The 3' end of the BALB/cJ Nramp2-nonIRE transcript was amplified by a first-round PCR using primers NRP6 (kindly provided by David Frazer, Queensland Institute of Medical Research, Australia) and NRP1, followed by a second nested PCR using primers NRP6 and NRP7. Amplification conditions were the same as above except for the PCR cycles, which were 94°C (30 s), 62°C (30 s), and 72°C (2 min). The BALB/cJ Nramp2-nonIRE 5' end was cloned by first treating the initial cDNA with terminal transferase (New England Biolabs, Beverly, MA) as per the manufacturer’s instructions and then performing a second RT using Superscript II and the NRP5 dT primer. The transcript was then amplified by a first-round PCR using primers NRP6 and NRP9, followed by a second nested PCR using primers NRP6 and NRP8. The PCR cycles for this reaction were 94°C (30 s), 55°C (30 s), and 72°C (4 min). All PCR products were cloned into the pGEM-T vector (Promega) and sequenced by the Australian Genome Research Facility, University of Queensland.


View this table:
[in this window]
[in a new window]
 
Table 1. Primers Used for RT-PCR and RACE

cDNA microarray analysis
Hybridizations were performed on a cDNA microarray chip containing 4000 cDNA sequences. The spots included a 1700 element Unigene set, approximately 2000 cDNAs isolated from a PCR select (Clontech)-subtracted library from LPS-stimulated RAW264.7 cells and 200 known macrophage-expressed genes (unpublished results). Glass slide arrays were produced in the Microarray Facility of the Queensland Institute of Medical Research (QIMR; Brisbane, Australia). Total RNA was extracted from control C57BL/6J 17-day whole embryo (used as a reference control) or treated BMMs using RNAeasy (Qiagen, Valencia, CA) and concentrated by Amicon columns (Millipore, Milford, MA). For each experiment, 50 µg total RNA was labeled using a modified Superscript II RT-reaction (Gibco BRL) incorporating Cy5 (embryo)- or Cy3 (BMMs)-labeled dinucleotide. The reaction was quenched by the addition of 0.5 M ethylenediaminetetraacetic (EDTA) and 2 M NaOH, heating to 65°C for 10 min and then adding 1 M HCl and 1 M Tris, pH 8.0. The Cy5 and Cy3 reactions were then combined and resuspended in 50 µl hybridization solution [6x saline sodium citrate (SSC), 0.2% sodium dodecyl sulfate (SDS), 50% formamide, 1 mg/ml Cot1 DNA (Life Technologies, Carlsbad, CA), and 8 mg/ml poly(dA) (Pharmacia, Upsala, Sweden)]. The RNA was denatured at 80°C for 10 min and preincubated at 45°C for 1 h prior to placing onto the array slides. The RNA was then applied to each array slide, covered with a glass coverslip, sealed into a hybridization chamber (Telechem, Atlanta, GA), and incubated at 45°C for 14–24 h. After hybridization, the slides were washed once in 0.2x SSC, 0.05% SDS for 3 min at room temperature, followed by a final wash in 0.2x SSC for 3 min. The slides were dried by centrifugation at 100 g for 3 min, then scanned with a GMS 418 scanner (Affimetrix/Millenium Science, The University of Sydney, Australia), and analyzed using ImaGene 4.1 (Biodiscovery/Millenium Science) and GeneSpring (Silicon Genetics/Geneworks, Redwood City, CA) software.

Reflecting the source of cDNAs on the arrays, predominantly from macrophage libraries, the reference samples (embryos labeled with Cy5) hybridized to less then 20% of the chip, and less then 1% of library and control genes was represented. For this reason, Cy3/Cy5 ratios were not informative, and internal normalization of the Cy3 signal was performed. Initially, the local background surrounding each spot was subtracted from the pixel values. A series of elements that did not contain DNA were also arranged across the chip and used as negative controls for a background subtraction. Raw data from each hybridization were then put through a series of normalizations. Population normalization was as follows: The median value was subtracted from the raw values for each gene before anything else was done. The 50th percentile of all measurements was used as a positive control for each sample; each measurement for each gene was then divided by this synthetic positive control. The bottom 10th percentile was used as a test for correct background subtraction. This was never less than the negative of the synthetic positive control. Each series was normalized back to the zero time point by dividing the measurement for each gene in each sample by the corresponding average value at time zero, assuming that it was at least 0.01. Lastly, normalized values below 0 were set to 0.


arrow
RESULTS
 
The regulation of Nramp1 and Nramp2 mRNA in Bcgs and Bcgr primary macrophages
RPAs were used to simultaneously examine the effect of IFN-{gamma} and LPS treatment on Nramp1 and Nramp2 mRNA expression in BMMs derived from Bcgs and Bcgr mice strains. The differentiated cells were unstimulated (control) or incubated with 20 U/ml IFN-{gamma} for 2 h followed by 100 ng/ml LPS for 6 or 20 h, respectively (Fig. 1 ). Like the classical macrophage-activation marker, inducible nitric oxide synthase (iNOS) [27 , 28 ], maximal induction of Nramp2 mRNA required IFN-{gamma} and LPS treatment. Treatment of BMMs with IFN-{gamma} alone had no effect on mRNA expression, whereas LPS alone was a weaker stimulus (unpublished results). The results showed that Nramp1 and Nramp2 mRNAs are co-expressed in the BMMs derived from all six mouse strains (Fig. 1) . The Nramp1 mRNA levels were up-regulated only after a 20-h incubation with IFN-{gamma} plus LPS, and there was no significant difference among the strains of mice. Previous studies have also shown a similar Nramp1 induction using these treatment conditions [7 , 29 ] and indicate that there is no feedback regulation of Nramp1 or Nramp2 expression by the functional product of the Nramp1 gene. These data also confirmed the presence and regulation of the putative Nramp2-IRE and -nonIRE transcripts in primary macrophages. By comparison to Nramp1, Nramp2 mRNA levels were up-regulated more rapidly and peaked at 6 h of stimulation for five of the six mouse strains and 20 h for the BALB/cJ strain (Fig. 1) . Time course experiments showed this induction began after only 2 h of LPS activation (unpublished results).



View larger version (75K):
[in this window]
[in a new window]
 
Figure 1. (A) Detection of Nramp1, Nramp2-IRE, Nramp2-nonIRE, and ß-actin mRNA from Bcgs and Bcgr BMMs by RNase protection assay and (B) densitometry analysis. BMMs were treated with IFN-{gamma} (20 U/ml) for 2 h followed by LPS (100 ng/ml) for 6 or 20 h. Total RNA (30 µg) was hybridized with specific 32P-labeled anti-sense RNA probes, RNase digested and resolved on a 8 M/5% polyacrylamide gel. Blots were exposed to film for 2 h (Nramp1, ß-actin) or 2 days (Nramp2). The blots are representative of three different sets of experiments. (B) Data are expressed as the ratio of the mRNA level to that of ß-actin mRNA measured in the same sample.

An unexpected feature these initial experiments is the altered expression of the putative Nramp2-IRE and -nonIRE transcripts in the BALB/cJ strain macrophages. In this strain, the putative Nramp2-nonIRE transcript was up-regulated after 6 and 20 h activation, and the IRE transcript showed no significant induction (Fig. 1) . To determine if this is linked to differences at the level of post-transcriptional control, the 3'UTRs of Nramp2, with or without the IRE, from the BALB/cJ strain were cloned and sequenced. Sequencing of the BALB/cJ Nramp2-IRE 3'UTR revealed an additional (GT)18 dinucleotide repeat at position 1936 (Genbank Accession code AF029758; unpublished results). Sequencing of the BALB/cJ Nramp2-nonIRE 3'UTR showed it was highly homologous to the published nonIRE transcript (Genbank accession code L33415) but had numerous point mutations and a 118-bp deletion at positions 2232–2350, incorporating a (GT)39 dinucleotide repeat (Fig. 2 ). The BALB/cJ Nramp2-nonIRE 3'UTR also lacked a classical IRE consensus region and contained no known regulatory motifs. To determine whether these BALB/cJ 3'UTRs were additional Nramp2 exons or polymorphisms of the BALB/cJ strain, similar PCR experiments were performed on genomic DNA (unpublished results). These results indicated that the new 3'UTRs represented allelic variants unique to the BALB/cJ strain.



View larger version (64K):
[in this window]
[in a new window]
 
Figure 2. Sequence of the BALB/cJ strain Nramp2-nonIRE 3'UTR cDNA as compared with the published sequence (Genbank accession code L33415). The blocked nucleotides denote sequence variations. The primers used to amplify the full-length clone are identified by arrows immediately underneath the corresponding nucleotide (Table 1) .

The expression of Nramp2 mRNA compared with other iron-responsive and macrophage-activation genes
The discordant regulation of Nramp1 and Nramp2 mRNA suggests that they are not functionally linked. Therefore, cDNA microarray analyses were used in an effort to gain a broader understanding of the status of other genes that may be involved in the Nramp2 regulation pathway. Primary BMMs derived from a Bcgs strain (BALB/cJ) and a Bcgr (SJL/J) strain were unstimulated (control) or incubated with 20 U/ml IFN-{gamma} for 2 h followed by 100 ng/ml LPS for 6 or 20 h, respectively. A hierarchical clustering analysis was performed to identify sets of genes with similar or divergent patterns of expression and induction between the two mouse strains using k-means clustering algorithms provided in the analytic package, GeneSpring. Comparison of the gene trees of both strains revealed that although some genes were expressed at a similar level under the treatment conditions, other groups of genes behaved differently (Fig. 3 ). Some examples of genes that clustered because of similar expression patterns in the BALB/cJ and SJL/J strains were the adaptor protein complex AP-2 (AA016639), lipoprotein lipase (AA049917), heat shock protein (AA116745), and immediate early response gene 2 (AA123976). Genes that show a different expression profile include the beta-2 microglobulin (AA139015), jagged 2 (AA125253), and tyrosine kinase adaptor protein 2 (AA036474). Detailed analysis of strain-specific differences in macrophage-activation profiles is beyond the scope of this study and will be described in detail elsewhere.



View larger version (84K):
[in this window]
[in a new window]
 
Figure 3. Microarray gene trees from (A) BALB/cJ and (B) SJL/J strain macrophages. BMMs were unstimulated (Time=0) or treated with IFN-{gamma} (20 U/ml) for 2 h followed by LPS (100 ng/ml) for 6 or 20 h. Genes were hierarchically clustered by GeneSpring software using a standard correlation. The results are typical of two independent experiments performed.

We examined the specific temporal profiles of a variety of known iron-responsive genes (Fig. 4 A ) and macrophage-activation genes (Fig. 4B) . The Nramp1 and Nramp2 mRNA profiles confirmed and validated the expression pattern observed in the RPAs; i.e., Nramp1 mRNA was induced at 20 h of stimulation, and the Nramp2 mRNA was induced at 6 h and then down-regulated by 20 h (Fig. 4A) . The TfR and ferritin mRNAs showed slight down-regulation over the time course, as did the putative iron exporter, ferroportin1 mRNA (Fig. 4A) . There also appeared to be no significant difference in expression of these iron-responsive genes between the BALB/cJ and SJL/J mouse strains. The ceruloplasmin mRNA, which encodes a protein implicated in iron release from cells [30 ], was up-regulated after 6 h of LPS stimulation in the SJL/J macrophages but not in the BALB/cJ (Fig. 4A) . This profile was also observed for a range of macrophage-activation genes (Fig. 4B) . The macrophage pro-inflammatory cytokines, interleukin (IL)-6, IL-1, tumor necrosis factor {alpha} (TNF-{alpha}), and the macrophage inflammatory protein (MIP) were all markedly induced following stimulation in the SJL/J macrophages and to a much reduced extent in the BALB/cJ. The iNOS gene showed a small induction in the SJL/J strain macrophages after 6 h of LPS but actually decreased in the BALB/cJ stain (Fig. 4B) . The c-fms gene encodes the receptor for macrophage colony stimulating factor (CSF-1), which is involved in macrophage proliferation and differentiation and has been shown to be repressed in BMMs in response to LPS [31 ]. In these experiments, c-fms is already down-modulated by its ligand CSF-1, but in the SJL/J strain, the c-fms gene showed further down-regulation over the time course, whereas in BALB/cJ, the mRNA was actually slightly elevated after 20 h. These findings dissociate Nramp2 expression from known iron-responsive genes and classical inflammation-associated responses in activated macrophages.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 4. Microarray expression profiles of (A) iron-responsive genes and (B) macrophage-activation genes in the BMMs from • BALB/cJ and {blacksquare} SJL/J mouse strains. BMMs were unstimulated (Time=0) or treated with IFN-{gamma} (20 U/ml) for 2 h followed by LPS (100 ng/ml) for 6 or 20 h. Genbank accession numbers are as follows: Nramp1 (L13732), Nramp2 (L33415), TfR (X57349), L-ferritin (M10119), Ferroportin1 (AF231120), ceruloplasmin (M13699), IL-6 (M24221), IL-1 (M15131), TNF-{alpha} (M13049), MIP (X12531), iNOS (M92649), and c-fms (NM_007779). These data are typical of two independent experiments performed.


arrow
DISCUSSION
 
In this study, we have used a variety of techniques to examine the regulation of Nramp2 in primary macrophages. The Nramp1 and Nramp2 transcripts were up-regulated in response to IFN-{gamma} and LPS in all strains analyzed (Fig. 1) . To our knowledge, this is the first study showing cytokine-mediated regulation of Nramp2 mRNA in primary macrophages. In contrast to Nramp1 mRNA, which required 20 h of stimulation, Nramp2 mRNA expression was elevated after just 2 h, and maximal induction was in five of the six mouse strains at 6 h (Fig. 1) . In addition, no significant difference was observed in Nramp2 mRNA expression between Nramp1D169 and Nramp1G169 mouse strains (excluding BALB/cJ), suggesting that Nramp2 mRNA regulation occurs independently of the function of the Nramp1 gene.

The putative Nramp2-IRE and -nonIRE transcripts were regulated in macrophages (Fig. 1) . The Nramp2-IRE transcript appears regulated by iron and IRPs in intestinal cells [12 , 17 , 18 ], but this IRE/IRP interaction is yet to be observed in other cell types. The IRE in Nramp2 mRNA does contain a consensus loop sequence, but the bulge in the stem differs from other IREs [28 ]. Although the IRE in the Nramp2 mRNA can bind IRPs in vitro in lysates from LMTK- mouse fibroblasts, these cells did not display iron-dependent regulation of Nramp2 transcript levels [28 ]. These data suggest that in nonintestinal cells, other regulatory mechanisms are probably involved in the Nramp2-IRE mRNA regulation. Post-transcriptional mechanisms could contribute to induction of the Nramp2-nonIRE in macrophages. The BALB/cJ mice have an Nramp2 variant sequence in the 3'UTR of both transcripts that contributed to its regulation. In particular, the BALB/cJ Nramp2-nonIRE mRNA contained a 118-bp deletion incorporating a GT dinucleotide repeat (Fig. 2) . This transcript appeared to have increased expression over the time course as compared with other mouse strains (Fig. 1) . In contrast, the BALB/cJ Nramp2-IRE transcript, which had a slightly increased number of GT repeats, showed no significant regulation (Fig. 1) .

Many elements within transcripts that control mRNA stability have been localized to the 3'UTR. In mammals, TfR mRNA stability is regulated by IRP that binds within the 3'UTR, protecting a site from endonucleolytic cleavage [32 , 33 ]. Stability of the IGF-II mRNA is also affected by site-specific endonucleolytic cleavage [34 , 35 ]. However, at present, no regulatory motifs (other than the IRE) have been identified in either Nramp2 transcript. As noted in the introduction, the two forms of Nramp2 have distinct C-termini as well as 3'UTRs [16 ]. The Nramp2-IRE C-terminus, particularly, has multiple serine, threonine, and tyrosine amino acids. Analysis, as described by Blom et al. [36 ], suggests that these amino acids have a high probability of being phosphorylated by mammalian protein kinases. Hence, the two isoforms may be differentially regulated by phosphorylation, perhaps indicating diversified functions in activated macrophages. There is also some evidence that the two Nramp2 isoforms localize to different subcellular compartments in neuronal cells [37 ]. Given the selective induction of the Nramp2 mRNA, it will be of some interest to examine whether this is also the case in activated macrophages.

To further explore the regulation of Nramp mRNA, we used microarrays to compare Nramp2 with other known iron-responsive genes in activated macrophages (Fig. 4A) . We compared two mouse strains that differ at the Nramp1 locus. The strains are clearly not congenic, and many allelic differences outside of Nramp could contribute to differences between the two strains. It is not the intention of this study to prove that differences between the two strains are a result of Nramp1 allelic differences. Rather, the comparison of divergent mouse strains provides a very powerful arm to microarray cluster analysis, serving to separate sets of genes into quite distinct regulatory groups. In contrast to Nramp2 mRNA, the TfR and ferritin mRNAs had relatively low expression levels under all the treatment conditions. TfR and ferritin mRNAs have IREs in their untranslated regions and are post-transcriptionally regulated by iron and IRPs [38 , 39 ]. Previous studies have demonstrated that IFN-{gamma} can decrease the expression of TfRs in macrophages by the NO-mediated degradation of IRP2, limiting the availability of iron to pathogens [40 41 42 ]. IRP2 also appears to down-regulate ferritin translation under low iron conditions [43 ]. The expression of ferroportin1 mRNA was also low. This protein is a putative iron exporter that is expressed intracellularly in Kupffer cells [44 , 45 ]. The ferroportin1 mRNA also contains a putative IRE in its 3'UTR and is regulated by iron in a ferritin-like manner [44 ]. In contrast, the ceruloplasmin mRNA was up-regulated in the stimulated macrophages from SJL/J macrophages but not BALB/cJ (Fig. 4A) . Ceruloplasmin is a multi-copper ferroxidase that is implicated in iron efflux from a variety of cells [30 ]. Expression of the ceruloplasmin gene has been demonstrated previously in macrophages and appears to be transcriptionally up-regulated during inflammation [46 ]. This result could indicate an increased iron efflux from Bcgr macrophages, or perhaps ceruloplasmin has another function in these cells. The possibility that loss of ceruloplasmin contributes to the Bcgs phenotype in Nramp1 mutant mice warrants further study. Collectively, these data dissociate regulation of Nramp2 mRNA from other known iron-regulated genes in primary macrophages following stimulation with IFN-{gamma} and LPS.

The Nramp2 mRNA expression profile correlated with several classical macrophage-activation genes (Fig. 4B) . LPS induces the synthesis and release of a variety of macrophage products including TNF-{alpha}, IL-1, -6, -8, -10, and -12, chemokines CP-10, MIP-1, and MIP-2, reactive oxygen intermediates, growth factors, and proteases [47 , 48 ]. Most of the effects of LPS are mediated through its binding to LPS binding protein, and the glycosylphosphatidylinositol-linked membrane receptor CD14, which can then activate multiple signaling pathways, including the toll-like receptor pathway (reviewed in [49 50 51 ]). Activation of macrophage function by LPS involves the induction of gene expression at the transcriptional level. Several transcription factors have been identified, which have been demonstrated to be LPS-inducible in macrophages, including Ets-2, PU.1, AP-1, nuclear factor-{kappa}B (NF-{kappa}B), and NF-IL6 [50 ]. Considering that Nramp2 appears regulated in concert with many of these genes following LPS activation, it is likely the Nramp2 gene is also transcriptionally regulated, possibly by the same factors. The promoter region of the human Nramp2 gene contains putative AP-1 and NF-{kappa}B binding sites and a possible IFN-{gamma}-responsive element and Hif-1-like motif [16 ]. The mouse Nramp2 promoter region has yet to be defined, but the presence of such motifs could explain the observed regulation in LPS-activated macrophages.

One argument against the direct link between Nramp2 and other inflammatory genes was the discordant regulation in the two mouse strains. We noted the hyper-induction of IL-1, IL-6, and TNF-{alpha} genes and also ceruloplasmin in the SJL/J mouse strains as compared with the BALB/cJ, where Nramp2 regulation was identical (Fig. 4A and 4B) . In addition to an enhanced anti-microbial activity [3 , 52 ], Bcgr macrophages have an increased expression of major histocompatibility complex class II molecules [53 ], increased production of NO [54 , 55 ], and pro-inflammatory cytokines [56 , 57 ]—observations that are confirmed and extended by our array results. The basis by which Nramp1 exerts its effects over macrophage pro-inflammatory immune responses is not clear, although studies suggest a role in the stabilization of macrophage pro-inflammatory gene mRNA transcripts [58 ] and activation of protein kinase C [59 ].

Although it is not strictly co-regulated with inflammatory cytokines, the increased expression of Nramp2 in response to inflammatory stimuli suggests that like Nramp1, Nramp2 may be involved in host defense. It has been proposed recently that Nramp1 functions as a cation anti-porter, transporting iron into bacterium-containing phagosomes where it serves as a catalyst for the Haber-Weiss reaction [21 , 23 , 60 ]. This proposal is based on observations that the phagosomes of Bcgr macrophages have a higher rate of iron import and increased iron content than phagosomes from Bcgs macrophages [21 , 60 ]. Considering that Nramp2 is an iron transporter localized to the plasma membrane and recycling endosomes [14 ], these authors suggest that this protein may be involved in iron uptake by macrophages. This hypothesis is supported by our results in RAW264.7 cells, which showed a rapid up-regulation of Nramp2 mRNA with a concomitant increase in iron uptake from 59Fe-nitrilotriacetic acid after cytokine stimulation [25 ]. Although at present there is no direct evidence of Nramp2-mediated iron transport in macrophages, the Nramp2-IRE- and -nonIRE-encoded isoforms have been localized to the plasma membrane and can transport iron in other cell types [61 , 62 ]. It was beyond the scope of this study to determine the internalized iron uptake in primary macrophages, but based on the current hypothesis, we would expect an increase in Bcgr and Bcgs mouse stains after exposure to inflammatory cytokines.

In conclusion, Nramp2 could have multiple functions in activated macrophages. The possible functional significance of Nramp2 as a membrane transporter may be to increase cellular metal-ion uptake for use by Nramp1. However, Nramp2 may also contribute intracellularly to host defense, perhaps partially compensating for an Nramp1 deficiency. The two splice variants of Nramp2 are expressed and regulated in macrophages activated with IFN-{gamma} and LPS, but the mechanisms governing each are not clear. We have made novel use of macrophage cDNA microarrays and different mouse strains to show that Nramp2 mRNA regulation occurs independently of Nramp1 mRNA expression and iron status and also segregates to a separate cluster from classical inflammatory genes. In the course of this study, we provide a first glimpse of the extent of divergence in inducible gene expression between mouse strains, a focus for future investigations.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by the National Health and Medical Research Council (NH&MRC) and by a grant from the Merck Genome Research Institute to D. A. H. Infrastructure support was provided by the ARC Special Research Centre for Functional and Applied Genomics. D. R. R. thanks the NH&MRC and the Australian Research Council for grant support. The authors also thank The Heart Research Institute for financial support. S. L. W. thanks the Queensland Cancer Fund for a Ph.D. Scholarship.

Received August 17, 2001; accepted August 17, 2001.


arrow
REFERENCES
 
    1
  1. Vidal, S., Malo, D., Vogan, K., Skamene, E., Gros, P. (1993) Natural resistance to infection with intracellular parasites: isolation of a candidate for Bcg Cell 73,469-485[Medline]
  2. 2
  3. Blackwell, J. M. (1996) Structure and function of the natural resistance associated macrophage protein (Nramp1), a candidate for infectious and auto-immune disease susceptibility Mol. Med. Today 1,205-211
  4. 3
  5. Vidal, S., Tremblay, M. L., Govoni, G., Gauthier, S., Sebastiani, G., Malo, D., Skamene, E., Olivier, M., Jothy, S., Gros, P. (1995) The Ity/Lsh/Bcg locus: natural resistance to infection with intracellular parasites is abrogated by disruption of the Nramp1 gene J. Exp. Med. 182,655-666[Abstract/Free Full Text]
  6. 4
  7. Marquet, S., Sanchez, F. O., Arias, M., Rodrigues, J., Paris, S. C., Skamene, E., Schurr, E., Garcia, L. F. (1999) Variants of the human NRAMP1 gene and altered human immunodeficiency virus infection susceptibility J. Infect. Dis. 180,1521-1525[Medline]
  8. 5
  9. Ryu, S., Park, Y. K., Bai, G. H., Kim, S. J., Park, S. N., Kang, S. (2000) 3'UTR polymorphisms in the NRAMP1 gene are associated with susceptibility to tuberculosis in Koreans Int. J. Tuberc. Lung Dis. 4,577-580[Medline]
  10. 6
  11. Singal, D. P., Li, J., Zhu, Y., Zhang, G. (2000) NRAMP1 gene polymorphisms in patients with rheumatoid arthritis Tissue Antigens 55,44-47[Medline]
  12. 7
  13. Govoni, G., Gauthier, S., Billia, F., Iscove, N. N., Gros, P. (1997) Cell-specific and inducible Nramp1 gene expression in mouse macrophages in vitro and in vivo J. Leukoc. Biol. 62,277-286[Abstract]
  14. 8
  15. Malo, D., Vogan, K., Vidal, S., Hu, J., Cellier, M., Schurr, E., Fuks, A., Bumstead, N., Morgan, K., Gros, P. (1994) Haplotype mapping and sequence analysis of the mouse Nramp gene predict susceptibility to infection with intracellular parasites Genomics 23,51-61[Medline]
  16. 9
  17. Gruenheid, S., Pinner, E., Desjardins, M., Gros, P. (1997) Natural resistance to infection with intracellular pathogens: the Nramp1 protein is recruited to the membrane of the phagosome J. Exp. Med. 185,717-730[Abstract/Free Full Text]
  18. 10
  19. Searle, S., Bright, N. A., Roach, T. I., Atkinson, P. G. P., Barton, C. H., Meloen, R. H., Blackwell, J. M. (1998) Localisation of Nramp1 in macrophages: modulation with activation and infection J. Cell Sci. 111,2855-2866[Abstract]
  20. 11
  21. Gruenheid, S., Cellier, M., Vidal, S., Gros, P. (1995) Identification and characterization of a second mouse Nramp gene Genomics 25,514-525[Medline]
  22. 12
  23. Gunshin, H., Mackenzie, B., Berger, U. V., Gunshin, Y., Romero, M. F., Boron, W. F., Nussberger, S., Gollan, J. L., Hediger, M. A. (1997) Cloning and characterization of a mammalian proton-coupled metal-ion transporter Nature 388,482-488[Medline]
  24. 13
  25. Vidal, S., Belouchi, A-M., Cellier, M., Beatty, B., Gros, P. (1995) Cloning and characterization of a second human NRAMP gene on chromosome 12q13 Mamm. Genome 6,224-230[Medline]
  26. 14
  27. Gruenheid, S., Canonne-Hergaux, F., Gauthier, S., Hackam, D. J., Grinstein, S., Gros, P. (1999) The iron-transport protein NRAMP2 is an integral membrane glycoprotein that colocalizes with transferrin in recycling endosomes J. Exp. Med. 189,831-841[Abstract/Free Full Text]
  28. 15
  29. Tabuchi, M., Yoshimori, T., Yamagushi, K., Yoshida, T., Kishi, F. (2000) Human NRAMP2/DMT1, which mediates iron transport across endosomal membranes, is localized to late endosomes and lysosomes in HEp-2 cells J. Biol. Chem. 275,22220-22228[Abstract/Free Full Text]
  30. 16
  31. Lee, P. L., Gelbart, T., West, C., Halloran, C., Beutler, E. (1998) The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polmorphisms Blood Cells Mol. Dis. 24,199-215[Medline]
  32. 17
  33. Fleming, R. E., Migas, M. C., Zhou, X-Y., Jiang, J., Britton, R. S., Brunt, E. M., Tomatsu, S., Waheed, A., Bacon, B. R., Sly, W. S. (1999) Mechanism of increased iron absorption in murine model of hereditary hemochromatosis: increased duodenal expression of the iron transporter DMT1 Proc. Natl. Acad. Sci. USA 96,3143-3148[Abstract/Free Full Text]
  34. 18
  35. Han, O., Fleet, J. C., Wood, R. J. (1999) Reciprocal regulation of HFE and Nramp2 gene expression by iron in human intestinal cells J. Nutr. 129,98-104[Abstract/Free Full Text]
  36. 19
  37. Jabado, N., Jankowski, A., Dougaparsad, S., Picard, V., Grinstein, S., Gros, P. (2000) Natural resistance to intracellular infections: natural resistance-associated macrophage protein 1 (NRAMP1) functions as a pH-dependent manganese transporter at the phagosomal membrane J. Exp. Med. 192,1237-1247[Abstract/Free Full Text]
  38. 20
  39. Zwilling, B. S., Kuhn, D. E., Wikoff, L., Brown, D., Lafuse, W. (1999) Role of iron in Nramp1-mediated inhibition of mycobacterial growth Infect. Immun. 67,1386-1392[Abstract/Free Full Text]
  40. 21
  41. Kuhn, D. E., Baker, B. D., Lafuse, W. P., Zwilling, B. S. (1999) Differential iron transport into phagosomes isolated from the RAW264.7 macrophage cell lines transfected with Nramp1Gly169 or Nramp1Asp169 J. Leukoc. Biol. 66,113-119[Abstract]
  42. 22
  43. Blackwell, J. M., Searle, S., Goswami, T., Miller, E. N. (2000) Understanding the multiple functions of Nramp1 Microbes Infect 2,317-321[Medline]
  44. 23
  45. Goswami, T., Bhattacharjee, A., Babal, P., Searle, S., Moore, E., Li, M., Blackwell, J. M. (2001) Natural-resistance-associated macrophage protein 1 is an H+/bivalent cation antiporter Biochem. J. 354,511-519[Medline]
  46. 24
  47. Vidal, S., Pinner, E., Lepage, P., Gauthier, S., Gros, P. (1996) Natural resistance to intracellular infections: Nramp1 encodes a membrane phosphoglycoprotein absent in macrophages from susceptible (Nramp1D169) mouse strains J. Immunol. 157,3559-3568[Abstract]
  48. 25
  49. Wardrop, S. L., Richardson, D. R. (2000) Interferon-g and lipopolysaccharide regulate the expression of Nramp2 and increase the uptake of iron from low relative molecular mass complexes by macrophages Eur. J. Biochem. 267,6586-6593[Medline]
  50. 26
  51. Stacey, K. J., Ross, I. L., Hume, D. A. (1993) Electroporation and DNA-dependent cell death in murine macrophages Immunol. Cell Biol. 71,75-85
  52. 27
  53. Costelloe, E. O., Stacey, K. J., Antalis, T. M., Hume, D. A. (1999) Regulation of the plasminogen activator inhibitor-2 (PAI-2) gene in murine macrophages. Demonstration of a novel pattern of responsiveness to bacterial endotoxin J. Leukoc. Biol. 66,172-182[Abstract]
  54. 28
  55. Wardrop, S. L., Richardson, D. R. (1999) The effect of intracellular iron concentration and nitrogen monoxide on Nramp2 expression and non-transferrin-bound iron uptake Eur. J. Biochem. 263,41-49[Medline]
  56. 29
  57. Nakanaga, K., Maeda, S., Myojin, Y., Xu, D. L., Goto, Y. (1999) Sequence analysis and expression of Nramp-1 gene in Bcgr and Bcgs mice J. Vet. Med. Sci. 61,717-720[Medline]
  58. 30
  59. Harris, Z. L., Durley, A. P., Man, T. K., Gitlin, J. D. (1999) Targeted gene disruption reveals an essential role for ceruloplasmin in cellular iron efflux Proc. Natl. Acad. Sci. USA 96,10812-10817[Abstract/Free Full Text]
  60. 31
  61. Roth, P., Stanley, E. (1992) The biology of CSF-1 and its receptor Curr. Top. Microbiol. Immunol. 181,141-167[Medline]
  62. 32
  63. Binder, R., Horowitz, J. A., Basilion, J. P., Koeller, D. M., Klausner, R. D., Harford, J. B. (1994) Evidence that the pathway of transferrin receptor mRNA degradation involves an endonucleolytic cleavage within the 3'UTR and does not involve poly(A) tail shortening EMBO J 13,1969-1980[Medline]
  64. 33
  65. Mullner, E. W., Neupert, B., Kuhn, L. C. (1989) A specific mRNA-binding factor regulates the iron-dependent stability of cytoplasmic transferrin receptor mRNA Cell 58,373-382[Medline]
  66. 34
  67. Meinsma, D., Scheper, W., Holthuizen, P. E., Van Den Brande, J. L., Sussenbach, J. S. (1992) Site-specific cleavage of IGF-II mRNAs requires sequence elements from two distinct regions of the IGF-II gene Nucleic Acids Res 20,5003-5009[Abstract/Free Full Text]
  68. 35
  69. Nielsen, F. C., Christiansen, J. (1992) Endonucleolysis in the turnover of insulin-like growth factor II mRNA J. Biol. Chem. 267,19404-19411[Abstract/Free Full Text]
  70. 36
  71. Blom, N., Gammeltoft, S., Brunak, S. (1999) Sequence- and structure-based prediction of eukaryotic protein phosphorylation sites J. Mol. Biol. 294,1351-1362[Medline]
  72. 37
  73. Roth, J. A., Horbinski, C., Feng, L., Dolan, K. G., Higgins, D., Garrick, M. D. (2000) Differential localization of divalent metal transporter 1 with and without iron response element in rat PC12 and sympathetic neuronal cells J. Neurosci. 20,7595-7601[Abstract/Free Full Text]
  74. 38
  75. Hentze, M. W., Kühn, L. C. (1996) Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress Proc. Natl. Acad. Sci. USA 93,8175-8182[Abstract/Free Full Text]
  76. 39
  77. Richardson, D. R., Ponka, P. (1997) The molecular mechanisms of the metabolism and transport of iron in normal and neoplastic cells Biochim. Biophys. Acta 1331,1-40[Medline]
  78. 40
  79. Byrd, T. F., Horwitz, M. A. (1989) Interferon gamma-activated human monocytes downregulate transferrin receptors and inhibit the intracellular multiplication of Legionella pneumophila by limiting the availability of iron J. Clin. Investig. 83,1457-1465
  80. 41
  81. Kim, S., Ponka, P. (2000) Effects of interferon-g and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2 J. Biol. Chem. 275,6220-6226[Abstract/Free Full Text]
  82. 42
  83. Mulero, V., Brock, J. H. (1999) Regulation of iron metabolism in murine J774 macrophages: role of nitric oxide-dependent and -independent pathways following activation with gamma interferon and lipopolysaccharide Blood 94,2383-2389[Abstract/Free Full Text]
  84. 43
  85. Recalcati, S., Taramelli, D., Conte, D., Cairo, G. (1998) Nitric oxide-mediated induction of ferritin synthesis in J774 macrophages by inflammatory cytokines: role of selective iron regulatory protein-2 downregulation Blood 91,1059-1066[Abstract/Free Full Text]
  86. 44
  87. Abboud, S., Haile, D. J. (2000) A novel mammalian iron-regulated protein involved in intracellular iron metabolism J. Biol. Chem. 275,19906-19912[Abstract/Free Full Text]
  88. 45
  89. Donovan, A., Brownlie, A., Zhou, Y., Shepard, J., Pratt, S. J., Moynihan, J., Paw, B. H., Drejer, A., Barut, B., Zapata, A., Law, T. C., Brugnara, C., Lux, S. E., Pinkus, G. S., Pinkus, J. L., Kingsley, P. D., Palis, J., Fleming, M. D., Andrews, N. C., Zon, L. I. (2000) Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter Nature 403,776-781[Medline]
  90. 46
  91. Fleming, R. E., Whitman, I. P., Gitlin, J. D. (1991) Induction of ceruloplasmin gene expression in the rat lung during inflammation and hyperoxia Am. J. Physiol. 260,L68-L74[Abstract/Free Full Text]
  92. 47
  93. Rietschel, E. T., Brade, H. (1992) Bacterial endotoxins Sci. Am. 267,54-61[Medline]
  94. 48
  95. Takemura, R., Werb, Z. (1984) Secretory products of macrophages and their physiological functions Am. J. Physiol. 246,C1-C9[Abstract/Free Full Text]
  96. 49
  97. Aderem, A., Ulevitch, R. J. (2000) Toll-like receptors in the induction of the innate immune response Nature 406,782-787[Medline]
  98. 50
  99. Sweet, M. J., Hume, D. A. (1996) Endotoxin signal transduction in macrophages J. Leukoc. Biol. 60,8-26[Abstract]
  100. 51
  101. Ulevitch, R. J., Tobias, P. S. (1995) Receptor-dependent mechanisms of cell stimulation by bacterial endotoxin Annu. Rev. Immunol. 13,437-457[Medline]
  102. 52
  103. Brown, D. H., Miles, B. A., Zwilling, B. S. (1995) Growth of Mycobacterium tuberculosis in BCG-resistant and -susceptible mice: establishment of latency and reactivation Infect. Immun. 63,2243-2247[Abstract/Free Full Text]
  104. 53
  105. Nath, J., Lafuse, W., Zwilling, B. S. (1988) Regulation of class II MHC gene expression by macrophages from Bcgr and Bcgs mice Cell. Immunol. 117,127-135[Medline]
  106. 54
  107. Arias, M., Rojas, M., Zabaleta, J., Rodrigues, J. I., Paris, S. C., Barrera, L. F., Garcia, L. F. (1997) Inhibition of virulent Mycobacterium tuberculosis by Bcgr and Bcgs macrophages correlates with nitric oxide production J. Infect. Dis. 176,1552-1558[Medline]
  108. 55
  109. Barrera, L. F., Kramnik, I., Skamene, E., Radzioch, D. (1994) Nitrite production by macrophages derived from BCG-resistant and -susceptible congenic mouse strains in response to IFN-g and infection with BCG Immunology 82,457-464[Medline]
  110. 56
  111. Lang, T., Prina, E., Sibthorpe, D., Blackwell, J. M. (1997) Nramp1 transfection transfers Ity/Lsh/Bcg-related pleiotropic effects on macrophage activation: influence on antigen processing and presentation Infect. Immun. 65,380-386[Abstract/Free Full Text]
  112. 57
  113. Rojas, M., Olivier, M., Gros, P., Barrera, L. F., Garcia, L. F. (1999) TNF-a and IL-10 modulate the induction of apoptosis by virulent Mycobacterium tuberculosis in murine macrophages J. Immunol. 162,6122-6131[Abstract/Free Full Text]
  114. 58
  115. Brown, D. H., Lafuse, W. P., Zwilling, B. S. (1997) Stabilized expression of mRNA is associated with mycobacterial resistance controlled by Nramp1 Infect. Immun. 65,597-603[Abstract/Free Full Text]
  116. 59
  117. Lafuse, W. P., Alvarez, G. R., Zwilling, B. S. (2000) Regulation of Nramp1 mRNA stability by oxidants and protein kinase C in RAW264.7 macrophages expressing Nramp1Gly169 Biochem. J. 351,687-696
  118. 60
  119. Kuhn, D. E., Lafuse, W. P., Zwilling, B. S. (2001) Iron transport into Mycobacterium avium-containing phagosomes from an Nramp1Gly169-transfected RAW264.7 macrophage cell line J. Leukoc. Biol. 69,43-49[Abstract/Free Full Text]
  120. 61
  121. Canonne-Hergaux, F., Gruenheid, S., Ponka, P., Gros, P. (1999) Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron Blood 93,4406-4417[Abstract/Free Full Text]
  122. 62
  123. Picard, V., Govoni, G., Jabado, N., Gros, P. (2000) Nramp2 (DCT1/DMT1) expressed at the plasma membrane transports iron and other divalent cations into a calcein-accessible cytoplasmic pool J. Biol. Chem. 275,35738-35745[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
D. A. Hume, I. L. Ross, S. R. Himes, R. T. Sasmono, C. A. Wells, and T. Ravasi
The mononuclear phagocyte system revisited
J. Leukoc. Biol., October 1, 2002; 72(4): 621 - 627.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
O. Olakanmi, G. T. Rasmussen, T. S. Lewis, J. B. Stokes, J. D. Kemp, and B. E. Britigan
Multivalent Metal-Induced Iron Acquisition from Transferrin and Lactoferrin by Myeloid Cells
J. Immunol., August 15, 2002; 169(4): 2076 - 2084.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wardrop, S. L.
Right arrow Articles by Richardson, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wardrop, S. L.
Right arrow Articles by Richardson, D. R.