
* Institute of Molecular Biosciences and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, Brisbane, Australia; and
The Heart Research Institute, Camperdown, Sydney, Australia
Correspondence: Professor D. A. Hume, Institute of Molecular Biosciences, University of Queensland, Brisbane 4072, Australia. E-mail: d.hume{at}imb.uq.edu.au
|
|
|---|
and lipopolysaccharide. cDNA microarray analysis revealed that Nramp2
regulation is controlled discordantly from other iron-regulated genes
and classical macrophage-activation genes in different mouse strains.
We suggest that Nramp2 is regulated independently of known
iron-responsive genes in macrophages, and its function in host defense
is unrelated to Nramp1.
Key Words: transferrin receptor ferritin 3'UTR iNOS
|
|
|---|
The Nramp2 (also known as DMT1 or DCT1) gene encodes a protein that is highly homologous to Nramp1 (78%) but is more widely expressed [11 12 13 ]. Nramp2 encodes an H+-dependent symporter of Fe2+, Mn2+, Zn2+, and other divalent metals [12 ] localized to the plasma membrane and recycling endosomes [14 , 15 ]. Nramp2 is probably the iron transporter responsible for apical entry of iron into enterocytes and the endosomal transporter in transferrin/transferrin receptor-containing endosomes. Cloning and sequencing of Nramp2 cDNA have shown at least two splice variants generated by alternative use of two 3' exons encoding distinct C-termini of the protein and 3'-untranslated regions (UTRs) [16 ]. One of the 3'UTRs contains a putative iron-responsive element (IRE), similar to IREs found in the 3'UTR of the transferrin receptor (TfR) mRNA and 5'UTR of the ferritin mRNA [12 , 16 ]. The IRE in Nramp2 could possibly contribute to regulation by iron and iron regulatory protein (IRP) in intestinal cells [12 , 17 , 18 ]. The role and regulation of the nonIRE transcript of Nramp2 have not been defined.
Jabado et al. [19 ] have provided the first direct evidence that Nramp1 is a metal-ion transporter and mediates H+-dependent transport of Mn2+ from the macrophage intraphagosomal space. These studies suggest that Nramp1 contributes to defense against infection by extrusion of divalent cations from the phagosome. Conversely, Zwilling et al. [20 ] and Kuhn et al. [21 ] suggest that Nramp1 transports divalent cations into the phagosome, inhibiting pathogen growth by generating toxic hydroxyl radicals. These proposals may not be exclusive because Nramp1 may actually be capable of transport of different cations in both directions against a proton gradient [22 , 23 ].
Unlike other cell types, macrophages express Nramp1 and Nramp2. At
present, very little is known about the role of Nramp2 in macrophage
iron metabolism, especially after exposure to inflammatory mediators.
Preliminary experiments using the mouse macrophage cell line RAW264.7,
which lacks a functional Nramp1 protein [24
], revealed a
differential regulation of Nramp2 mRNA expression after
activation with bacterial lipopolysaccharide (LPS), with or without the
macrophage-activating lymphokine interferon-
(IFN-
)
[25
]. The putative Nramp2-IRE transcript was
selectively up-regulated, whereas the putative Nramp2-nonIRE
transcript was unaffected. Treatment with LPS and IFN-
/LPS also
increased 59Fe uptake from
59Fe-nitrilotriacetic acid, but the TfR mRNA
levels and 59Fe uptake from 59Fe-Tf were
decreased [25
]. The fact that the Nramp2-IRE
mRNA expression was not regulated in parallel with the TfR
mRNA or IRP1 RNA-binding activity suggests multiple regulatory
mechanisms in these cells.
Because RAW264.7 cells lack a functional Nramp1, we considered the possibility that induction of Nramp2 may partially compensate for the Nramp1 deficiency. In the current study, we have examined the regulation of Nramp1 and Nramp2 mRNA in primary macrophages from a range of mouse strains that are Bcgs (Nramp1D169) or Bcgr (Nramp1G169). The regulation of these two transcripts was then compared with other iron-responsive and macrophage-activation genes, and the results were discussed in terms of macrophage activation and iron homeostasis.
|
|
|---|
Cell culture and treatments
Mouse bone marrow-derived macrophages (BMMs) were differentiated
in culture with colony-stimulating factor (CSF)-1, as previously
described [26
]. Cells were used for experiments on days
68. All BMMs were cultured in RPMI-1640 containing 10%
heat-inactivated Serum Supreme (Biowhittaker, Walkersville, MD), 2 mM
glutamine (Gibco BRL, Sydney, Australia), 30 µg/L penicillin (Gibco
BRL), and 100 µg/L streptomycin (Gibco BRL). Activation of the BMMs
was achieved by incubating with 20 U/ml murine interferon-
(IFN-
;
Gibco BRL) and 100 ng/mL LPS (from Salmonella Minnesota Re
595; Sigma Chemical Co., St. Louis, MO). All cell cultures were done at
37°C in humidified air with 5% CO2. Cellular viability
was monitored by phase-contrast microscopy.
RNase protection assays
All experiments were performed using the Ribonuclease Protection
Assay kit (RPA IITM; Ambion Inc., Austin, TX), as specified by the
manufacturer. Briefly, 32P-labeled RNA probes were
synthesized complementary to the target RNA. The probes used were
generated by polymerase chain reaction (PCR) using the following
primers: Nramp1 (5'GTCTGCCATCTCTACTACC3',
5'GGCAGTGGGCATCGTCGGT3'), Nramp2-nonIRE
(5'GGACCTTTCTGACGATGAAC TTC3', 5'GCTAGCCAGCCAGTAAGTTC3'),
Nramp2-IRE (5'GGATCAGTCTGTCTGTCTTTGC3',
5'CCTGTAGCATTAGGCAGCAC3'), and ß-actin
(5'CCTGTATGCCTCTGGTCGTA3', 5'CATGAAGATCCTGACCGAGC3'). The corresponding
T7 or SP6 RNA polymerase was then used to generate anti-sense RNA
transcripts using an in vitro transcription kit (Promega, Madison, WI).
Total RNA (30 µg) and excess labeled probes (
2x105
cpm) were incubated at 42°C overnight to hybridize probe to its
complement in the sample RNA. After hybridization, the mixtures were
treated with a 1:100 dilution of the ribonuclease A/T1 mix
at 37°C for 30 min to degrade unhybridized probe. The protected
fragments were run on 8 M/5% polyacrylamide gels at 200V for 2 h
and visualized by autoradiography. Gels were dried and exposed to Kodak
XAR films for 2 h to 2 days, quantified by scanning densitometry,
and analyzed using Molecular Analyst software (Bio-Rad, Hercules, CA).
Cloning the Nramp2 allele from BALB/cJ mice
Total RNA from BALB/cJ strain BMMs (15 µg) was
reverse-transcribed (RT) in a 20 µl reaction with NRP5 dT primer
(kindly provided by David Frazer, Queensland Institute of Medical
Research, Australia; Table 1
) using Superscript II (Gibco BRL), according to the
manufacturers instructions. Initial PCRs to amplify the BALB/cJ
Nramp2-nonIRE and -IRE fragments used primers NRP1/NRP2 and
NRP3/NRP4, respectively. Amplification was performed on 2.5 µl cDNA
in a 50 µl volume using the Advantage cDNA PCR kit (Clontech, Palo
Alto, CA). The PCR cycles were performed on a PTC-200 DNA Engine (M.J.
Research, Watertown, MA) and consisted of a 2-min denaturation at
94°C, followed by 35 cycles at 94°C (30 s), 65°C (30 s), and
72°C (1 min) and a single, final extension period of 7 min at 72°C.
The 3' end of the BALB/cJ Nramp2-nonIRE transcript was
amplified by a first-round PCR using primers NRP6 (kindly provided by
David Frazer, Queensland Institute of Medical Research, Australia) and
NRP1, followed by a second nested PCR using primers NRP6 and NRP7.
Amplification conditions were the same as above except for the PCR
cycles, which were 94°C (30 s), 62°C (30 s), and 72°C (2 min).
The BALB/cJ Nramp2-nonIRE 5' end was cloned by first
treating the initial cDNA with terminal transferase (New England
Biolabs, Beverly, MA) as per the manufacturers instructions and then
performing a second RT using Superscript II and the NRP5 dT primer. The
transcript was then amplified by a first-round PCR using primers NRP6
and NRP9, followed by a second nested PCR using primers NRP6 and NRP8.
The PCR cycles for this reaction were 94°C (30 s), 55°C (30 s), and
72°C (4 min). All PCR products were cloned into the pGEM-T vector
(Promega) and sequenced by the Australian Genome Research Facility,
University of Queensland.
|
View this table: [in a new window] |
Table 1. Primers Used for RT-PCR and RACE
|
Reflecting the source of cDNAs on the arrays, predominantly from macrophage libraries, the reference samples (embryos labeled with Cy5) hybridized to less then 20% of the chip, and less then 1% of library and control genes was represented. For this reason, Cy3/Cy5 ratios were not informative, and internal normalization of the Cy3 signal was performed. Initially, the local background surrounding each spot was subtracted from the pixel values. A series of elements that did not contain DNA were also arranged across the chip and used as negative controls for a background subtraction. Raw data from each hybridization were then put through a series of normalizations. Population normalization was as follows: The median value was subtracted from the raw values for each gene before anything else was done. The 50th percentile of all measurements was used as a positive control for each sample; each measurement for each gene was then divided by this synthetic positive control. The bottom 10th percentile was used as a test for correct background subtraction. This was never less than the negative of the synthetic positive control. Each series was normalized back to the zero time point by dividing the measurement for each gene in each sample by the corresponding average value at time zero, assuming that it was at least 0.01. Lastly, normalized values below 0 were set to 0.
|
|
|---|
and
LPS treatment on Nramp1 and Nramp2 mRNA
expression in BMMs derived from Bcgs and Bcgr
mice strains. The differentiated cells were unstimulated (control) or
incubated with 20 U/ml IFN-
for 2 h followed by 100 ng/ml LPS
for 6 or 20 h, respectively (Fig. 1
). Like the classical macrophage-activation marker, inducible
nitric oxide synthase (iNOS) [27
, 28
],
maximal induction of Nramp2 mRNA required IFN-
and LPS
treatment. Treatment of BMMs with IFN-
alone had no effect on mRNA
expression, whereas LPS alone was a weaker stimulus (unpublished
results). The results showed that Nramp1 and
Nramp2 mRNAs are co-expressed in the BMMs derived from all
six mouse strains (Fig. 1)
. The Nramp1 mRNA levels were
up-regulated only after a 20-h incubation with IFN-
plus LPS, and
there was no significant difference among the strains of mice. Previous
studies have also shown a similar Nramp1 induction using
these treatment conditions [7
, 29
] and
indicate that there is no feedback regulation of Nramp1 or Nramp2
expression by the functional product of the Nramp1 gene.
These data also confirmed the presence and regulation of the putative
Nramp2-IRE and -nonIRE transcripts in primary macrophages.
By comparison to Nramp1, Nramp2 mRNA levels were
up-regulated more rapidly and peaked at 6 h of stimulation for
five of the six mouse strains and 20 h for the BALB/cJ strain
(Fig. 1)
. Time course experiments showed this induction began after
only 2 h of LPS activation (unpublished results).
![]() View larger version (75K): [in a new window] |
Figure 1. (A) Detection of Nramp1, Nramp2-IRE,
Nramp2-nonIRE, and ß-actin mRNA from
Bcgs and Bcgr BMMs by RNase protection assay
and (B) densitometry analysis. BMMs were treated with IFN- (20 U/ml)
for 2 h followed by LPS (100 ng/ml) for 6 or 20 h. Total RNA
(30 µg) was hybridized with specific 32P-labeled
anti-sense RNA probes, RNase digested and resolved on a 8 M/5%
polyacrylamide gel. Blots were exposed to film for 2 h (Nramp1,
ß-actin) or 2 days (Nramp2). The blots are representative of
three different sets of experiments. (B) Data are expressed as the
ratio of the mRNA level to that of ß-actin mRNA
measured in the same sample.
|
![]() View larger version (64K): [in a new window] |
Figure 2. Sequence of the BALB/cJ strain Nramp2-nonIRE 3'UTR cDNA as
compared with the published sequence (Genbank accession code L33415).
The blocked nucleotides denote sequence variations. The primers used to
amplify the full-length clone are identified by arrows immediately
underneath the corresponding nucleotide (Table 1)
.
|
for 2 h followed by 100 ng/ml LPS for 6 or 20 h,
respectively. A hierarchical clustering analysis was performed to
identify sets of genes with similar or divergent patterns of expression
and induction between the two mouse strains using k-means clustering
algorithms provided in the analytic package, GeneSpring. Comparison of
the gene trees of both strains revealed that although some genes were
expressed at a similar level under the treatment conditions, other
groups of genes behaved differently (Fig. 3
). Some examples of genes that clustered because of similar
expression patterns in the BALB/cJ and SJL/J strains were the adaptor
protein complex AP-2 (AA016639), lipoprotein lipase (AA049917), heat
shock protein (AA116745), and immediate early response gene 2
(AA123976). Genes that show a different expression profile include the
beta-2 microglobulin (AA139015), jagged 2 (AA125253), and tyrosine
kinase adaptor protein 2 (AA036474). Detailed analysis of
strain-specific differences in macrophage-activation profiles is beyond
the scope of this study and will be described in detail elsewhere.
![]() View larger version (84K): [in a new window] |
Figure 3. Microarray gene trees from (A) BALB/cJ and (B) SJL/J strain
macrophages. BMMs were unstimulated (Time=0) or treated with IFN-
(20 U/ml) for 2 h followed by LPS (100 ng/ml) for 6 or 20 h.
Genes were hierarchically clustered by GeneSpring software using a
standard correlation. The results are typical of two independent
experiments performed.
|
(TNF-
), and the macrophage inflammatory protein (MIP) were all
markedly induced following stimulation in the SJL/J macrophages and to
a much reduced extent in the BALB/cJ. The iNOS gene showed a
small induction in the SJL/J strain macrophages after 6 h of LPS
but actually decreased in the BALB/cJ stain (Fig. 4B)
. The
c-fms gene encodes the receptor for macrophage colony
stimulating factor (CSF-1), which is involved in macrophage
proliferation and differentiation and has been shown to be repressed in
BMMs in response to LPS [31
]. In these experiments,
c-fms is already down-modulated by its ligand CSF-1, but in
the SJL/J strain, the c-fms gene showed further
down-regulation over the time course, whereas in BALB/cJ, the mRNA was
actually slightly elevated after 20 h. These findings dissociate
Nramp2 expression from known iron-responsive genes and classical
inflammation-associated responses in activated macrophages.
![]() View larger version (25K): [in a new window] |
Figure 4. Microarray expression profiles of (A) iron-responsive genes and (B)
macrophage-activation genes in the BMMs from BALB/cJ and
SJL/J mouse strains. BMMs were unstimulated (Time=0) or
treated with IFN- (20 U/ml) for 2 h followed by LPS (100 ng/ml)
for 6 or 20 h. Genbank accession numbers are as follows: Nramp1
(L13732), Nramp2 (L33415), TfR (X57349), L-ferritin (M10119),
Ferroportin1 (AF231120), ceruloplasmin (M13699), IL-6 (M24221), IL-1
(M15131), TNF- (M13049), MIP (X12531), iNOS (M92649), and c-fms
(NM_007779). These data are typical of two independent experiments
performed.
|
|
|
|---|
and LPS in all strains analyzed (Fig. 1)
. To our
knowledge, this is the first study showing cytokine-mediated regulation
of Nramp2 mRNA in primary macrophages. In contrast to
Nramp1 mRNA, which required 20 h of stimulation,
Nramp2 mRNA expression was elevated after just 2 h,
and maximal induction was in five of the six mouse strains at 6 h (Fig. 1)
. In addition, no significant difference was observed
in Nramp2 mRNA expression between
Nramp1D169 and Nramp1G169
mouse strains (excluding BALB/cJ), suggesting that Nramp2
mRNA regulation occurs independently of the function of the
Nramp1 gene. The putative Nramp2-IRE and -nonIRE transcripts were regulated in macrophages (Fig. 1) . The Nramp2-IRE transcript appears regulated by iron and IRPs in intestinal cells [12 , 17 , 18 ], but this IRE/IRP interaction is yet to be observed in other cell types. The IRE in Nramp2 mRNA does contain a consensus loop sequence, but the bulge in the stem differs from other IREs [28 ]. Although the IRE in the Nramp2 mRNA can bind IRPs in vitro in lysates from LMTK- mouse fibroblasts, these cells did not display iron-dependent regulation of Nramp2 transcript levels [28 ]. These data suggest that in nonintestinal cells, other regulatory mechanisms are probably involved in the Nramp2-IRE mRNA regulation. Post-transcriptional mechanisms could contribute to induction of the Nramp2-nonIRE in macrophages. The BALB/cJ mice have an Nramp2 variant sequence in the 3'UTR of both transcripts that contributed to its regulation. In particular, the BALB/cJ Nramp2-nonIRE mRNA contained a 118-bp deletion incorporating a GT dinucleotide repeat (Fig. 2) . This transcript appeared to have increased expression over the time course as compared with other mouse strains (Fig. 1) . In contrast, the BALB/cJ Nramp2-IRE transcript, which had a slightly increased number of GT repeats, showed no significant regulation (Fig. 1) .
Many elements within transcripts that control mRNA stability have been localized to the 3'UTR. In mammals, TfR mRNA stability is regulated by IRP that binds within the 3'UTR, protecting a site from endonucleolytic cleavage [32 , 33 ]. Stability of the IGF-II mRNA is also affected by site-specific endonucleolytic cleavage [34 , 35 ]. However, at present, no regulatory motifs (other than the IRE) have been identified in either Nramp2 transcript. As noted in the introduction, the two forms of Nramp2 have distinct C-termini as well as 3'UTRs [16 ]. The Nramp2-IRE C-terminus, particularly, has multiple serine, threonine, and tyrosine amino acids. Analysis, as described by Blom et al. [36 ], suggests that these amino acids have a high probability of being phosphorylated by mammalian protein kinases. Hence, the two isoforms may be differentially regulated by phosphorylation, perhaps indicating diversified functions in activated macrophages. There is also some evidence that the two Nramp2 isoforms localize to different subcellular compartments in neuronal cells [37 ]. Given the selective induction of the Nramp2 mRNA, it will be of some interest to examine whether this is also the case in activated macrophages.
To further explore the regulation of Nramp mRNA, we used
microarrays to compare Nramp2 with other known iron-responsive genes in
activated macrophages (Fig. 4A)
. We compared two mouse strains that
differ at the Nramp1 locus. The strains are clearly not congenic, and
many allelic differences outside of Nramp could contribute to
differences between the two strains. It is not the intention of this
study to prove that differences between the two strains are a result of
Nramp1 allelic differences. Rather, the comparison of divergent mouse
strains provides a very powerful arm to microarray cluster analysis,
serving to separate sets of genes into quite distinct regulatory
groups. In contrast to Nramp2 mRNA, the TfR and
ferritin mRNAs had relatively low expression levels under
all the treatment conditions. TfR and ferritin
mRNAs have IREs in their untranslated regions and are
post-transcriptionally regulated by iron and IRPs [38
,
39
]. Previous studies have demonstrated that IFN-
can
decrease the expression of TfRs in macrophages by the NO-mediated
degradation of IRP2, limiting the availability of iron to pathogens
[40
41
42
]. IRP2 also appears to down-regulate ferritin
translation under low iron conditions [43
]. The
expression of ferroportin1 mRNA was also low. This protein
is a putative iron exporter that is expressed intracellularly in
Kupffer cells [44
, 45
]. The
ferroportin1 mRNA also contains a putative IRE in its 3'UTR
and is regulated by iron in a ferritin-like manner [44
].
In contrast, the ceruloplasmin mRNA was up-regulated in the
stimulated macrophages from SJL/J macrophages but not BALB/cJ (Fig. 4A)
. Ceruloplasmin is a multi-copper ferroxidase that is implicated in
iron efflux from a variety of cells [30
]. Expression of
the ceruloplasmin gene has been demonstrated previously in macrophages
and appears to be transcriptionally up-regulated during inflammation
[46
]. This result could indicate an increased iron
efflux from Bcgr macrophages, or perhaps ceruloplasmin has
another function in these cells. The possibility that loss of
ceruloplasmin contributes to the Bcgs phenotype in Nramp1
mutant mice warrants further study. Collectively, these data dissociate
regulation of Nramp2 mRNA from other known iron-regulated
genes in primary macrophages following stimulation with IFN-
and
LPS.
The Nramp2 mRNA expression profile correlated with several
classical macrophage-activation genes (Fig. 4B)
. LPS induces the
synthesis and release of a variety of macrophage products including
TNF-
, IL-1, -6, -8, -10, and -12, chemokines CP-10, MIP-1, and
MIP-2, reactive oxygen intermediates, growth factors, and proteases
[47
, 48
]. Most of the effects of LPS are
mediated through its binding to LPS binding protein, and the
glycosylphosphatidylinositol-linked membrane receptor CD14, which can
then activate multiple signaling pathways, including the toll-like
receptor pathway (reviewed in [49
50
51
]). Activation of
macrophage function by LPS involves the induction of gene expression at
the transcriptional level. Several transcription factors have been
identified, which have been demonstrated to be LPS-inducible in
macrophages, including Ets-2, PU.1, AP-1, nuclear factor-
B
(NF-
B), and NF-IL6 [50
]. Considering that Nramp2
appears regulated in concert with many of these genes following LPS
activation, it is likely the Nramp2 gene is also transcriptionally
regulated, possibly by the same factors. The promoter region of the
human Nramp2 gene contains putative AP-1 and NF-
B binding
sites and a possible IFN-
-responsive element and Hif-1-like motif
[16
]. The mouse Nramp2 promoter region has
yet to be defined, but the presence of such motifs could explain the
observed regulation in LPS-activated macrophages.
One argument against the direct link between Nramp2 and other
inflammatory genes was the discordant regulation in the two mouse
strains. We noted the hyper-induction of IL-1, IL-6, and TNF-
genes
and also ceruloplasmin in the SJL/J mouse strains as compared with the
BALB/cJ, where Nramp2 regulation was identical (Fig. 4A
and 4B) . In
addition to an enhanced anti-microbial activity [3
,
52
], Bcgr macrophages have an increased
expression of major histocompatibility complex class II molecules
[53
], increased production of NO [54
,
55
], and pro-inflammatory cytokines [56
,
57
]observations that are confirmed and extended by our
array results. The basis by which Nramp1 exerts its effects over
macrophage pro-inflammatory immune responses is not clear, although
studies suggest a role in the stabilization of macrophage
pro-inflammatory gene mRNA transcripts [58
] and
activation of protein kinase C [59
].
Although it is not strictly co-regulated with inflammatory cytokines, the increased expression of Nramp2 in response to inflammatory stimuli suggests that like Nramp1, Nramp2 may be involved in host defense. It has been proposed recently that Nramp1 functions as a cation anti-porter, transporting iron into bacterium-containing phagosomes where it serves as a catalyst for the Haber-Weiss reaction [21 , 23 , 60 ]. This proposal is based on observations that the phagosomes of Bcgr macrophages have a higher rate of iron import and increased iron content than phagosomes from Bcgs macrophages [21 , 60 ]. Considering that Nramp2 is an iron transporter localized to the plasma membrane and recycling endosomes [14 ], these authors suggest that this protein may be involved in iron uptake by macrophages. This hypothesis is supported by our results in RAW264.7 cells, which showed a rapid up-regulation of Nramp2 mRNA with a concomitant increase in iron uptake from 59Fe-nitrilotriacetic acid after cytokine stimulation [25 ]. Although at present there is no direct evidence of Nramp2-mediated iron transport in macrophages, the Nramp2-IRE- and -nonIRE-encoded isoforms have been localized to the plasma membrane and can transport iron in other cell types [61 , 62 ]. It was beyond the scope of this study to determine the internalized iron uptake in primary macrophages, but based on the current hypothesis, we would expect an increase in Bcgr and Bcgs mouse stains after exposure to inflammatory cytokines.
In conclusion, Nramp2 could have multiple functions in activated
macrophages. The possible functional significance of Nramp2 as a
membrane transporter may be to increase cellular metal-ion uptake for
use by Nramp1. However, Nramp2 may also contribute intracellularly to
host defense, perhaps partially compensating for an Nramp1 deficiency.
The two splice variants of Nramp2 are expressed and
regulated in macrophages activated with IFN-
and LPS, but the
mechanisms governing each are not clear. We have made novel use of
macrophage cDNA microarrays and different mouse strains to show that
Nramp2 mRNA regulation occurs independently of
Nramp1 mRNA expression and iron status and also segregates
to a separate cluster from classical inflammatory genes. In the course
of this study, we provide a first glimpse of the extent of divergence
in inducible gene expression between mouse strains, a focus for future
investigations.
Received August 17, 2001; accepted August 17, 2001.
|
|
|---|
This article has been cited by other articles:
![]() |
D. A. Hume, I. L. Ross, S. R. Himes, R. T. Sasmono, C. A. Wells, and T. Ravasi The mononuclear phagocyte system revisited J. Leukoc. Biol., October 1, 2002; 72(4): 621 - 627. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Olakanmi, G. T. Rasmussen, T. S. Lewis, J. B. Stokes, J. D. Kemp, and B. E. Britigan Multivalent Metal-Induced Iron Acquisition from Transferrin and Lactoferrin by Myeloid Cells J. Immunol., August 15, 2002; 169(4): 2076 - 2084. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||