Department of Veterinary Molecular Biology, Montana State University, Bozeman
Correspondence: Mark T. Quinn, Ph.D., Veterinary Molecular Biology, Montana State University, Bozeman, MT 59717. E-mail: mquinn{at}montana.edu
|
|
|---|
Key Words: neutrophil NADPH oxidase transcriptional regulation promoter
|
|
|---|
Activation of the NADPH oxidase involves the assembly of several neutrophil cytosolic and membrane proteins [1 , 3 ]. The membrane-associated component directly implicated in the flow of electrons from NADPH to O2 is a heterodimeric flavocytochrome b, which is composed of 91 kDa and 22 kDa subunits (gp91phox and p22phox, respectively) [7 , 8 ]. The cytosolic NADPH oxidase proteins include p40phox, p47phox, p67phox, and a low molecular-weight GTPase, Rac2 (reviewed in references [1 , 9 , 10 ]). During activation, the cytosolic oxidase proteins translocate to the membrane and associate with flavocytochrome b and possibly cytoskeletal proteins (reviewed in references [1 , 2 , 9 ]). Although the purpose of NADPH oxidase-generated oxidants is to destroy pathogens, these reactive oxygen species can also damage host tissues in the vicinity of the inflammatory site [11 12 13 ]. Thus, to insure minimal host tissue damage, the assembly/activation and deactivation of the NADPH oxidase system must be a tightly regulated process at the transcriptional and post-transcriptional levels.
Recent studies on the NADPH oxidase have suggested that p67phox may be the rate-limiting cofactor in the NADPH oxidase. For example, p47phox-independent NADPH oxidase activity can be reconstituted in vitro with only flavocytochrome b and high concentrations of Rac and p67phox [14 , 15 ]. Furthermore, Paclet and coworkers [16 ] recently used atomic force microscopy to directly show that of all cytosolic components, p67phox played the most critical function in assembly and activation of the NADPH oxidase.
Based on the demonstrated importance of p67phox in oxidase function, we hypothesized that transcriptional regulation of p67phox expression might play an important role in overall regulation of NADPH oxidase. The expression of p67phox appears to be regulated somewhat differently than that of other NADPH oxidase proteins during cellular differentiation. Generally, p67phox is expressed later than the other components, and its expression appears to correlate most closely with oxidase activity, supporting its role as the key factor limiting the respiratory burst during differentiation [17 18 19 ]. It has also been shown that the oxidase components gp91phox, p67phox, and p47phox are all regulated by the myeloid-specific transcription factor, PU.1 [24 , 26 , 27 ]. However, in contrast to this similarity, it has been shown that an intact PU.1 binding site within the p47phox and gp91phox promoters is essential for their activity but not for p67phox promoter activity. Of the various oxidase components, the transcriptional regulation of gp91phox has been best described, although there are still some controversies. Some data suggest that a CCAAT box within the promoter is recognized by CP1 and that this interaction is inhibited by CDP, resulting in transcriptional repression [20 21 22 ]. In contrast, a more recent study suggested that CDP does not bind this repressor element and that a Pbx-HoxA10 dimer is responsible for repressing gp91phox expression in myeloid cells [23 ]. There are also conflicting studies regarding the components of the multi-protein HAF1 complex, which binds the PU.1 binding element within the gp91phox promoter. Previously, it was demonstrated that the transcription factors PU.1, interferon regulatory factor 1 (IRF-1), and ICSBP made up the components of this complex [24 ]. In contrast, Voo and Skalnik [25 ] found that Elf-1, but not PU.1, was part of the HAF1 complex and that PU.1 was present in a faster-migrating complex.
Recently Eklund and Kakar [26
] identified an
interferon-
(IFN-
)-inducible element within the
p67phox promoter as a result of its similarity
in sequence to the IFN-
-inducible PU.1 consensus site of the
gp91phox promoter. They also showed that PU.1,
IRF-1, and ICSBP bound to this element within the
p67phox promoter, similar to their observations
regarding the PU.1 binding element of gp91phox.
However, as mentioned above, mutations within this site do not
eliminate basal transcription from the p67phox
promoter, unlike the gp91phox and
p47phox promoters, where PU.1 binding-site
mutations eliminate basal transcription [27
]. These
results suggest that the PU.1 binding element regulates these genes in
a slightly different manner and that there are other regulatory
elements within the p67phox promoter important
for basal transcriptional regulation of this gene.
Because of the discrepancy in data regarding the factors that bind the PU.1 element within the gp91phox promoter and the difference in response to mutagenesis of the PU.1 site in the p67phox and gp91phox promoters, we focused on further characterizing the promoter region of p67phox. The p67phox promoter region was cloned and sequenced, and putative binding sites for known transcription factors were identified. Three putative PU.1 binding sites were identified, including the previously demonstrated PU.1 binding element. However, only one of the three PU.1 sites was shown to interact specifically and with high affinity to PU.1 from HL-60 cells, but mutation of this site did not fully eliminate transcriptional activity. In contrast, a binding site for the nuclear factor AP-1 was shown to be required for basal transcription of the p67phox promoter in HL-60 cells, and mutation of this domain completely abrogated transcription. Our results demonstrate a key role for AP-1 in the regulation of the p67phox promoter.
|
|
|---|
Cell culture
The human promyelocytic cell line HL-60 and the human myeloid
cell line PLB-985 were grown in Dulbeccos modified Eagless medium
(DMEM) supplemented with 20% fetal bovine serum (FBS) and in RPMI 1640
supplemented with 10% FBS, respectively. Both medias contained
penicillin and streptomycin. Cell lines were maintained at 5 x
105/mL. The day prior to transfection, cells were seeded at
5 x 105/mL in fresh media.
Human p67phox genomic cloning and sequencing
The p67phox genomic region 5' of the
translational start site (TLS) was cloned using the GenomeWalker Kit
(Clontech, Palo Alto, CA). Using polymerase chain reaction (PCR), two
overlapping regions of the p67phox promoter were
amplified from the human genomic libraries provided by the
manufacturer. The first genomic fragment was generated using a forward
primer complementary to the adaptor sequence of the genomic DNA
fragments and a reverse primer (5'-CTGGTAAAGGCCTTCTCTGCTTCAGTCATG-3')
corresponding to bp 11384 of the p67phox cDNA.
The amplified PCR products were analyzed on a 1.5% agarose gel
followed by nested PCR amplification. The forward primer corresponded
to nested adaptor sequence and the reverse primer
(5'-TCCAGGGCTCCCTTCCAGTCCTTCTTGTCC-3') to bp 7951 of
p67phox cDNA. The amplified product was cloned
into the pCR2.1 vector using a TA Cloning Kit (Invitrogen, Carlsbad,
CA) and sequenced. The second genomic fragment was isolated as above
using primers designed from the 5' region of the first walk. The
reverse primer for the initial amplification was
5'-CCAAATGAAACCCGTGACCTAGAGTGAGAAC-3' (-558589 from TLS)
and 5'-CTTCTGTTCCTGTTTGTCTGCTCTTTCCC-3' (-590617) for
the nested PCR. Three independent clones were sequenced from each
genomic walk to establish a consensus sequence.
For cycle sequencing, PCR was performed on a Perkin Elmer 2400 thermocycler using Big Dye Terminators, and the samples were run on an ABI 310 Genetic Analyzer (Perkin-Elmer ABI, Foster City, CA). The nucleotide sequence translation and analysis were performed with DNASTAR software (Madison, WI).
5' Rapid amplification of cDNA ends (5' RACE)
Total RNA was isolated from differentiated HL-60 and PLB-985
cells. HL-60 cells were differentiated by incubating cells
(5x105 cells/mL) with 10 µM 9-cis-retinoic acid (RA) for
48 h. Cells were washed in media and resuspended at 5 x
105/mL in media containing 0.5% DMF (dimethylformamide)
for 57 days. PLB-985 cells were differentiated in the presence of 10
µM RA for 24 h. Cells were washed and incubated for 57 days
with 0.5% DMF. The nitroblue tetrazolium (NBT) test was used to
determine differentiation [28
, 29
].
Briefly, media was removed from cells, and a saturated NBT solution
prepared freshly in media along with phorbol 12-myristate 13-acetate
(PMA) at 100 ng/mL was added. Cells were incubated for 3060 min at
37°C. Differentiated cells (purple) were scored visually.
RNA from the differentiated cells was isolated using an SV Total RNA Isolation System (Promega, Madison, WI) and used to perform 5' RACE with the SMART RACE cDNA Amplification Kit (Clontech), according to the manufacturers protocol. Briefly, 1 µg total RNA was used to generate 5' RACE-ready cDNA. The forward primer for the initial PCR amplification corresponded to the SMART II oligonucleotide, and the reverse primer was the same as that used for the first genomic walk. The RACE-amplified DNA was gel-purified using a QIAquick Gel Extraction Kit (Qiagen, Valencia, CA) and subjected to a "nested" PCR reaction. The forward primer corresponded to nested Smart II sequence, and the reverse primer was the same used for the first nested genomic walk. The nested PCR products were TA-cloned as above, and a total of 19 HL-60 and 16 PLB-985 5' RACE products were sequenced to determine the transcriptional start site (TSS).
Luciferase vector construction
PCR was used to amplify a single 2 kb genomic
p67phox promoter sequence from genomic DNA. The
forward primer (5'-CGCGGTACCAAACTGGGCTTTGAAAGATGAGTAGGAG-3')
corresponded to the 5' end of the second genomic walk and contained a
KpnI restriction site. The reverse primer
(5'-GGGCTCGAGCGGTCCACCAGGGACATGATTAGGTAG-3') spanned the TLS of
p67phox and contained an XhoI
restriction site. The amplified DNA was digested with KpnI
and XhoI and cloned into the pGL3-Basic Luciferase Vector
(Promega). This clone, pGL3-p67-2017 (i.e., 2017 bp 5' of the TLS), was
sequenced to confirm that no PCR mutations were introduced and was
subsequently used to generate the promoter deletion constructs. All
forward primers contained a KpnI restriction site and the
p67phox promoter sequence necessary to generate
the desired deletion (see Fig. 1 ). The reverse primer was the same as used above containing the
XhoI restriction site. The amplified DNA was digested with
KpnI and XhoI and ligated into
KpnI/XhoI-digested pGL3-Basic.
![]() View larger version (50K): [in a new window] |
Figure 1. Sequence analysis of the p67phox promoter. Exon1
and the beginning of exon2 are labeled below the sequences and
indicated in bold type. The translational start site within exon2 is
underlined and labeled (TLS), with the first bp of the TLS designated
as +1. The transcriptional start sites are indicated with arrows, and
consensus-binding sites for transcription factors PU.1, AP-1, and AP-4
are underlined and labeled. The first nucleotide of each promoter
deletion construct is in bold type and labeled with respect to length
of nucleotides from the ATG start site. This sequence has been
submitted to GenBank with accession number AY032997.
|
Transient transfections
The day prior to transfection, cells were resuspended to 5 x 105/mL in fresh DMEM media. For transfections,
107 cells were resuspended in 800 µL RPMI containing 25
µg luciferase-reporter constructs and 5 µg pRL-TK vector to control
for transfection efficiency. Cells were electroporated at 950 µF and
210 V in 0.4 cm cuvettes. Cells were resuspended in 8 mL DMEM and
incubated for 24 h. Transfected cells were assayed for firefly and
Renilla luciferase activity as per the manufacturers
protocol using the Dual-Luciferase Reporter Assay System (Promega).
Briefly, cells were washed in PBS and resuspended in 100 µL lysis
buffer (Promega). To test for firefly luciferase activity, 30 µL was
used with an EG&G BERTHOLD Lumat LB 9507 luminometer. Subsequently, 100
µL Stop & Glo Reagent (Promega) was added to the sample and tested
for Renilla luciferase activity.
In vitro translation of human PU.1
The PU.1 full-length cDNA was isolated from a human leukocyte
cDNA library by PCR amplification using gene-specific PCR primers
spanning the start and stop sites. The amplified PU.1 PCR product was
TA-cloned, and the sequence was confirmed. A clone containing an insert
in the correct orientation was in vitro-transcribed and translated
using the TNT Quick Coupled Transcription/Translation Systems
(Promega). The [35S]methionine-PU.1 was run on a sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel, and
the gel was subjected to autoradiography to confirm the correct
molecular mass of 38 kDa as previously demonstrated
[30
]. [35S]Methionine-PU.1 (2 µL) was
used per electrophoretic mobility shift assay (EMSA) reaction.
Electrophoretic mobility shift assay (EMSA)
DIG-11-ddUTP-labeled double-stranded oligonucleotide probes were
used as probes for EMSA. Briefly, equal molar amounts of complementary
oligonucleotides were annealed in TEN buffer [10 mM Tris-HCL, 1 mM
ethylenediaminetetraacetate (EDTA), 0.1 M NaCl, pH 8.0] for 10
min at 95°C. The annealed DNA was labeled using a DIG Gel Shift Kit
(Roche, Indianapolis, IN) as per the manufacturers protocol. For
gel-shift assays, the labeled DNA probe was incubated with 6 µg
nuclear extract in 1x binding buffer (Roche) for 20 min at 4°C. For
competition assays, 100-fold excess of cold competitor was added along
with labeled probe. For super-shift and peptide-blocking assays,
antibody and blocking peptides were added to nuclear extracts and
incubated for 20 min at 4°C prior to addition of labeled probe.
Samples were run on a 5% nondenaturing polyacrylamide gel (19:1) in
0.5 x TBE (PU.1 EMSA) or 0.25 x TBE (AP-1 EMSA) and
electrophoresed at 170V for 3.5 h. Gels were transferred to
positively charged nylon membrane (Roche) at 400 mA for 1 h.
Membranes were soaked in 2x saline sodium citrate (SSC), and
oligonucleotides were cross-linked using a Stratalinker at 120 mJ.
Chemiluminescent detection was performed as described (DIG Gel Shift
Kit, Roche).
|
|
|---|
1 kb of this sequence
(-2015-1000) is new, the second 1 kb
(-1000 to the TLS) is similar to what has been published
previously for this region [26
]. Note, however, that
there were several differences in our sequence as compared with the
sequence shown, including many added bases and some base differences.
The reason for these differences is not clear, however we have
confirmed our sequence is correct by sequencing over this region many
times in the process of preparing mutant constructs. One possible
explanation for the differences in sequence is single nucleotide
polymorphisms. However, the reason for the presence of added or missing
bases is not clear.
Identification of the p67phox
transcriptional start site
To identify the transcriptional start site for
p67phox in myeloid cells, total RNA was isolated
from human promyelocytic HL-60 and myeloid PLB-985 cell lines that had
been differentiated with retinoic acid and dimethyl sulfoxide (DMSO) to
increase p67phox gene expression. The 5' RACE
DNA from both cell lines was cloned, and a total of 19 HL-60 and 16
PLB-985 5' RACE clones were sequenced to determine and compare the TSS
(Fig. 1)
. Because there were multiple TSS, the first nucleotide of the
translational start site was designated as +1 bp. Two major
transcriptional start sites were identified at positions
-167 and -121 and were located within the
first intron. Nine p67phox transcripts began at
position -167, eight from the HL-60 cells and one from
PLB-985 cells. Eight transcripts from PLB-985 cells and two from HL-60
cells began at position -121. Six RACE products began at
-94 bp (three from each cell line). Two transcripts from
PLB-985 cells and one from HL-60 cells began at -104. It
is interesting that one PLB-985 RACE product began at -584
and did not contain any sequence from intron 1. These transcripts begin
at slightly different positions than those previously shown for
p67phox [26
], which could be
explained by the different methods and cell types used to isolate and
identify p67phox transcript sequence.
Previously, a transcriptional start site at -24 was
identified by isolating p67phox cDNA from a
library derived from HL-60 cells differentiated with dibutyril cAMP
[31
], whereas transcripts beginning at -24,
-42, and -58 were identified by primer
extension using RNA from the human U937 myelomonocytic cell line
[26
]. Because all of the transcripts contained the same
coding region, the significance of the alternative TSS is unclear. One
possibility is that different TSS are used in different cell types or
that some are preferentially used in response to certain signals. The
TSS at position -104 was shown to be inducible by IFN-
treatment of U937 cells [26
] and is similar in position
to the TSS for three of the transcripts isolated from differentiated
HL-60 and PLB-985 cells. A second possibility is that mRNAs originating
from different TSS could have variable stabilities or that the
different 5'-untranslated regions (UTRs) could affect elongation by the
RNA polymerase [32
33
34
35
].
Localization of p67phox promoter activity
To identify promoter elements that were important for
p67phox transcriptional activity, nine different
p67phox promoter fragments ranging in size from
402015 bp were cloned 5' of the luciferase-reporter gene (Fig. 2 A
). The promoter constructs were co-transfected into HL-60 cells
along with the pRL-TK vector (transfection-efficiency control), and the
normalized data are shown in Figure 2B
. No significant transcriptional
activity was observed for constructs containing 150 bp or less of the
promoter. The first significant luciferase activity of 20-fold was
observed for the construct containing 300 bp of sequence upstream of
the TLS. The luciferase activity more than doubled for constructs
containing
500 bp of the promoter region, suggesting additional
regulatory elements between 300 and 500 bp. The promyelocytic cell line
PLB-985 and the erythroid cell line K562 were also tested for
p67phox promoter activity (unpublished results).
Similar results were obtained with PLB-985 cells, however the maximum
luciferase activity was five times less than that observed with the
HL-60 cells. This is most likely a result of the difficulty in
transfecting PLB-985 cells and correlated with the reduced activity of
the reporter gene product used to correct for differences in
transfection efficiency. The K562 cells showed initial activity for the
-75 promoter construct of approximately fivefold over the
vector with no insert. In K562 cells, no additional increase in
promoter activity was observed for the larger promoter fragments. These
results suggest important regulatory sequences are located between
-150 bp and -500 bp 5' of the ATG start site
and that they confer myeloid-specific activity.
![]() View larger version (10K): [in a new window] |
Figure 2. Identification of the minimal promoter region of
p67phox necessary for basal transcriptional
activity. (A) Promoter deletion constructs. Serial deletion fragments
were generated using PCR with the longest 2015 bp fragment as a
template, as described in Materials and Methods. The length of each
fragment is labeled with the number of nucleotides from the ATG start
site. These promoter deletion fragments were cloned 5' of the
luciferase gene. (B) Luciferase activity of the promoter deletion
constructs. Log-phase HL-60 cells were co-transfected with the
indicated promoter-deletion constructs and pRL-TK to normalize for
transfection efficiency, and 48 h post-transfection, cell extracts
were assayed for luciferase activity. Luciferase values were corrected
for transfection efficiency and are shown relative to the activity of
the promoterless vector, pGL3-Basic. Data are representative of four
independent experiments using two different DNA preparations of each
construct.
|
-induced p67phox
expression. The second site at -283 is the same as a PU.1
site identified in the promoter of another NADPH oxidase gene,
p47phox [27
] and in the
neutrophil elastase gene promoter [38
]. The third
putative PU.1 binding site at -328 is identical to the
PU.1 binding site in the promoter of the immunoglobulin (Ig)J
gene [39
]. Consensus binding sites for the ubiquitously
expressed AP-4 and AP-1 transcription factors [40
] were
also identified (Fig. 1)
. AP-1 has been shown to be activated by many
different stimuli, including mitogenic growth factors, inflammatory
cytokines, growth factors of the transforming growth factor-ß
(TGF-ß) family, UV and ionizing irradiation, cellular stress, antigen
binding, and neoplastic transformation [41
,
42
]. AP-4 was first identified as a factor binding to the
simian virus SV40 enhancer and was shown to interact synergistically
with AP-1 to increase transcription in vitro from the SV40 late
promoter [43
].
Transcriptional activity of p67phox
promoter mutants
To determine the role of the AP-1, AP-4, or PU.1 sites in
p67phox expression,
p67phox promoter mutants of these sites were
generated within the 500 bp promoter fragment and cloned 5' of the
luciferase-reporter gene as described in Materials and Methods
(Fig. 3 A
). HL-60 cells were co-transfected with promoter mutant constructs
and the pRL-TK vector, and the normalized data are shown in Figure 3B .
Mutagenesis of any one of the PU.1 sites reduced the basal
transcriptional activity by approximately 50%, as compared with the
wild-type p67phox 500 bp promoter construct,
suggesting that any one of these sites is not singularly responsible
for the basal transcriptional activity of this promoter. Of the double
mutants studied, PU.1-176,283 and
PU.1-283,328 further reduced the promoter activity
compared with that of the single PU.1 mutants, however the
PU.1-176,328 double mutant showed no additional reduction
in activity compared with that of the single mutants (Fig. 3B)
. It is
interesting that when all three putative PU.1 binding sites were
mutated, the result was complete loss of basal transcriptional
activity. These results suggest that all three putative PU.1 sites may
play some role in p67phox expression.
![]() View larger version (13K): [in a new window] |
Figure 3. Transcriptional activity of p67phox promoter
mutants. (A) Promoter mutant constructs. The promoter deletion
construct containing 500 nucleotides 5' of the ATG start site (labeled
p67500) was used as a template to generate the various PU.1, AP-1,
and AP-4 mutant promoter fragments via site-directed mutagenesis. These
fragments were cloned 5' of the luciferase gene. The specific consensus
site that was mutated is labeled at the right of the fragment, and the
position of the mutation within the fragment is indicated with an X.
The translation start site is labeled TLS. (B) Luciferase activity of
the promoter mutant constructs. HL-60 cells were co-transfected with
the indicated promoter mutant constructs and pRL-TK to normalize for
transfection efficiency. Luciferase activity was determined and shown
as described in Figure 2
. Data are representative of four independent
experiments using two different DNA preparations of each construct and
represent five replicate transfections per construct
(mean±SE).
|
In vitro synthesized PU.1 and PU.1 from HL-60 nuclear extracts
specifically bind PU.1-283 with high affinity
To determine if PU.1 binds specifically to the PU.1 sites
identified in the p67phox promoter, EMSA
analysis was performed using double-stranded oligonucleotides
representing the three putative PU.1 sites and in vitro synthesized
PU.1 or nuclear extracts from HL-60 cells. The PU.1 binding site from
the gp91phox promoter was used as a control. As
shown in Figure 4
, the PU.1-283 site was bound by in vitro synthesized
PU.1 (lane 5). The specificity of this interaction was demonstrated by
super-shifting with anti-PU.1 antibody (with concurrent loss of the
PU.1-specific band) and by blocking the super-shift with anti-PU.1
antibody-blocking peptide (lanes 6 and 7, respectively). Importantly,
these results are comparable to those observed with the PU.1 binding
site from the promoter of gp91phox (lanes
1113). The PU.1 sites at -176 and -328
appear to be bound by in vitro synthesized PU.1 (lanes 2 and 8,
respectively) but with much less affinity than the
PU.1-283 site.
![]() View larger version (87K): [in a new window] |
Figure 4. EMSA of the PU.1 consensus sites using 35S-labeled PU.1.
EMSA was performed using in vitro-synthesized 35S-labeled
PU.1, and DNA-protein complexes were separated on 5% polyacrylamide
gels. Lane 1 contains no oligonucleotide; lanes 24 contain
PU.1-176 oligonucleotide (TGGGGACATTTCCTGATGCATTTGCAACAC);
lanes 57, the PU.1-283 oligonucleotide
(GCTGATGTACTTCCTCTCTCCTCCACACTC); lanes 810, the
PU.1-328 oligonucleotide (CTGGGTGACAGAGCAGAAGCATTTTGGGGA);
and lanes 1113, the gp91 PU.1 oligonucleotide
(CTGCTGTTTTCATTTCCTCATTGGAAGAAGC) as a control for PU.1 binding. Where
indicated, 2 µg anti-PU.1 antibody (lanes 3, 6, 9, 12) or anti-PU.1
antibody and anti-PU.1 antibody-blocking peptide were added (lanes 4,
7, 10, 13). The arrows and arrowheads indicate the specific
PU.1-shifted complex and the super-shifted complex, respectively.
|
![]() View larger version (58K): [in a new window] |
Figure 5. EMSA of the PU.1 consensus sites using HL-60 nuclear extracts. (A)
PU.1-283 binds PU.1 from HL-60 nuclear extracts. Labeled
oligonucleotides corresponding to the different PU.1 consensus sites
were incubated with HL-60 nuclear extracts in the absence (lanes 1, 5,
9, 13) or presence of 200-fold excess of wild-type (WT gp91 PU.1, lanes
2, 6, 10, 14) or mutant (MUT gp91 PU.1, lanes 3, 7, 11, 15)
gp91phox PU.1-competing oligonucleotide. Refer
to Figure 4
legend for sequences of the PU.1 and wild-type
gp91phox PU.1 probes. The
gp91phox PU.1 mutant oligonucleotide sequence is
CTGCTGTTTTCAAAACCTCATTGGAAGAAGC. For super-shift analysis, anti-PU.1
antibody was added where indicated (lanes 4, 8, 12, 16). DNA-protein
complexes were analyzed as described in the legend to Figure 4
. The
arrows and arrowheads indicate the specific PU.1-shifted complex and
the super-shifted complex, respectively. (B) PU.1 specifically binds
the PU.1-283 consensus site. PU.1-283 probe
was incubated with HL-60 nuclear extracts in the absence (lane 1) or
presence of 200-fold excess of WT gp91phox PU.1
(lane 2) or MUT gp91phox PU.1 (lane 3) as the
competing oligonucleotide. Where indicated, anti-PU.1 antibody was
added in the absence (lane 4) or presence (lane 5) of anti-PU.1
antibody-blocking peptide. JunD antibody was added (lane 6) to
demonstrate the specificity of the super-shift by anti-PU.1 antibody.
|
![]() View larger version (82K): [in a new window] |
Figure 6. AP-1 nuclear factors Fos and Jun specifically bind to the
p67phox promoter AP-1 consensus site. Labeled
p67phox AP-1 consensus site
(ATGGTAGGGTTATAAATCAGTTGCCAAAAG)was used as a
probe for EMSA analysis. The labeled probe was incubated with serum
responsive (SR) 3T3 nuclear extract in the absence (lane 1) or presence
of 200-fold excess of p67phox AP-1 site (p67
AP-1, lane 2); wild type AP-1 site 5'-CGCTTGATGAGTCAGCCGGAA-3' (WT
AP-1, lane 4); mutant gp91phox PU.1 site (MUT
gp91 PU.1, lane 3); or mutant AP-1 5'-CGCTTGATGACCCAGCCGGAA-3' (MUT
AP-1, lane 5)-competing oligonucleotide. Where indicated, antibodies
against cFos, c-Jun, FosB, JunB, and JunD were added in the absence
(lanes 6, 9, 12, 15, 18) or presence of specific
antibody-blocking peptides (lanes 7, 10, 13, 16, 19). Anti-PU.1
antibody was included as a negative control (lanes 8, 11, 14, 17, 20)
to demonstrate the specificity of the super-shift by these antibodies.
Procedures were similar to those for Figures 4
and 5
. The arrows and
arrowheads indicate the specific PU.1-shifted complex and the
super-shifted complex, respectively.
|
|
|
|---|
The promoter deletion studies described here identified the promoter sequence between -500 bp and the ATG start site as necessary for maximal basal transcriptional activity, suggesting that important regulatory elements are located within this region. Mutagenesis of an AP-1 site within this region completely abrogated basal transcriptional activity for the 500 bp promoter fragment, and EMSA studies demonstrated that Fos/Jun heterodimers specifically bind to this site. Our results, however, do not rule out the possibility that Jun homodimers or other AP-1 family members also bind this site. It is possible that Fos/Jun heterodimers and Jun homodimers bind to and/or compete for the p67phox AP-1 consensus site. Which dimer actually binds in vivo may be determined in part by the levels of each factor, which in turn may depend on the differentiation state of the cell, the cell type, or by the different binding affinities observed for the various AP-1 dimers [44 , 45 ]. It has been demonstrated previously that heterodimers formed between the different Jun and Fos proteins have better binding activity than Jun/Jun homodimers and that Jun/Fos/DNA complexes are more stable than Jun/Jun/DNA complexes [45 ]. AP-1 factors have also been shown to confer positive and negative transcriptional regulation depending on which AP-1 complex is occupying the DNA binding site. For example, the human proenkephalin promoter is activated by a JunD homodimer [46 ]. Although a JunB homodimer cannot bind the AP-1 site in the proenkephalin promoter, it can bind with high affinity as a JunB/c-Fos heterodimer, thereby inhibiting activation by JunD. AP-1 factors do not need to compete for DNA binding to have antagonistic effects on promoter activity, as demonstrated for several marker genes of epidermal keratinocytes [47 ]. For example, c-Jun/c-Fos heterodimers activated gene expression by binding at AP-1 sites, however JunB repression and JunD activation of these promoters did not involve c-Fos and were not dependent on interactions with the AP-1 site [47 ]. Which of the AP-1 family members are involved and their effect on p67phox promoter activity in myeloid cells remain to be determined.
In addition to the PU.1 consensus site at position -176
demonstrated by Eklund and Kakar [26
], we have
identified two additional putative PU.1 binding sites at positions
-283 and -328 bp from the TLS. The
-283 PU.1 consensus site specifically and avidly
interacted with PU.1 from HL-60 nuclear extracts and with in
vitro-synthesized PU.1. EMSA analysis using in vitro-synthesized PU.1,
but not HL-60 nuclear extracts, suggested the two remaining sites also
interacted with PU.1 but with much lower affinity. The difference in
binding affinity may be caused by the difference in nucleotide sequence
flanking the core PU.1 binding site as demonstrated by Li et al.
[40
]. A requirement for multiple binding sites for the
same transcription factor has been shown and that the binding of the
factor to multiple sites can be cooperative. For example, WT1 binds to
high- and low-affinity sites within the insulin-like growth factor II
promoter, and binding of even-skipped to high-affinity binding sites of
the ultra-bithorax gene promoter facilitates subsequent binding of
even-skipped to low-affinity binding sites [48
,
49
]. Similarly, cooperative interactions between PU.1
molecules bound to the p67phox promoter may
stabilize their binding and enhance the ability of PU.1 to regulate
p67phox gene expression. The complete loss of
promoter activity observed when all three sites are mutated certainly
suggests that each site plays some role in
p67phox promoter activity. Another explanation
for the difference in PU.1 binding to the various consensus sites is
that PU.1 could be binding to the various sites in conjunction with
different cofactors that are present only in certain cell types and
under certain cell conditions or differentiation states or that need to
be activated in response to specific signals. This would suggest that
the different PU.1 sites could regulate p67phox
promoter activity by responding differently to different stimuli
possibly in different cell types. The studies shown to date suggest
that there are different mechanisms for PU.1 regulation of
gp91phox, p47phox, and
p67phox [24
, 26
,
27
]. Promoter mutations that abolish PU.1 binding to the
promoters of gp91phox and
p47phox also abolished promoter function. In
contrast, PU.1 enhanced but was not essential for
p67phox-promoter function. These findings are
consistent with the observation that PU.1 knockout mice contain a
p67phox message [50
], which
suggests that PU.1 is not necessary for basal transcription of
p67phox but does not rule out the possibility
that PU.1 is involved in the induction of
p67phox by inflammatory mediators. Also, PU.1
alone was able to confer lineage-inappropriate expression of
p47phox, however p67phox
and gp91phox required additional
lineage-specific factors, IRF-1 and ICSBP, with PU.1 for enhanced
promoter function in response to INF-
. It will be of interest to
determine if the PU.1 consensus binding sites at positions
-329 and -284 require the lineage-specific
factors IRF-1 and ICSBP along with PU.1 to affect
p67phox promoter activity, as that demonstrated
for the PU.1 binding sites of the gp91phox and
p67phox (-176) promoters
[24
, 26
, 51
, 52
].
In the present studies, we have determined that none of the PU.1
consensus sites in the p67phox promoter are
individually responsible for basal p67phox
promoter activity. However, when all were mutated, no promoter activity
was detected, suggesting some role for all three sites in promoter
activity. Further characterization of the PU.1 binding sites within the
p67phox promoter is necessary to fully
understand the role of PU.1 in p67phox gene
expression.
It has recently been shown that CBP (CREB-binding protein) may also play a role in co-activation of p67phox. Eklund and Kakar [26 ] demonstrated that PU.1, IRF-1, and ICSBP recruit CBP to the p67phox promoter at a putative PU.1 consensus site at position -176, suggesting that this is the mechanism by which PU.1 activates transcription of p67phox. Although it has been proposed that CBP participates in the activities of hundreds of different transcription factors by bringing histone acetyltransferase (HAT) activity to the promoter [53 ], the exact role of CBP in transcriptional regulation remains unclear (for review, see [54 ]). CBP has also been shown to regulate transcriptional activity by acetylating transcription factors to increase their binding affinities for DNA [55 ]. It is interesting that CBP has been shown to interact directly with PU.1 and c-Fos using the yeast two-hybrid system [56 ], and it was suggested that the limiting amounts of CBP in the cell may mediate synergistic and antagonistic interactions between PU.1 and other transcription factors. CBP has also been shown to stimulate Fos/Jun activity via its interaction with c-Fos [57 ]. Considering the close juxtaposition of the AP-1 site and PU.1 sites in the p67phox promoter, the possibility exists that there may be cross-talk (positive or negative) between factors binding the AP-1 and PU.1 sites.
There are examples of AP-1 and PU.1 cooperating to regulate
cell-specific gene expression. PU.1 and c-Jun are necessary for basal
promoter function of the macrophage-specific macrosialin gene and act
synergistically to activate its promoter [58
].
Additionally, the macrophage scavenger receptor gene, which is highly
expressed during monocyte-to-macrophage differentiation, is
regulated by PU.1 and AP-1 [59
]. It is interesting that
both of these factors have also been shown to regulate the
monocyte-specific macrophage colony-stimulating factor (M-CSF)
receptor, which has a PU.1 but not an AP-1 DNA binding site
[60
]. In this case, c-Jun apparently does not bind
directly to the M-CSF receptor promoter but interacts with the
ETS domain of PU.1 to act as a co-activator of PU.1, resulting
in the expression of the M-CSF receptor gene. Also, it has been
demonstrated that PU.1 binding to the Ig
3' enhancer region recruits
other transcription factors including c-Fos and c-Jun to form a
multi-protein-complex that synergistically activates transcription
[61
]. However, mutants of PU.1 lacking the
transactivation domain are still able to cooperate synergistically to
activate this promoter [62
]. In this case, it has been
proposed that the role of PU.1 is to serve as an architectural protein
by inducing DNA bending, which promotes binding of other transcription
factors to nearby regulatory elements and allows the formation of a
higher-order protein complex. It is interesting that AP-1 factors have
also been shown to induce DNA bending [63
,
64
]. Similar to PU.1, it was suggested that the
AP-1-induced changes in DNA structure may promote cooperative binding
of factors to nearby binding sites and mediate interactions between
these regulatory proteins [65
].
The expression of p67phox has been shown to be
up-regulated by lipopolysaccharide binding protein (LPS) and TNF-
[66
, 67
]. It is interesting that AP-1 has
been shown to be important in the expression of certain genes when
cells are exposed to LPS, TNF-
, and INF-
. For example, LPS
induction of promoter activity of the kappa immunoglobulin light-chain
gene in pre-B cells requires an intact AP-1 DNA-binding site
[68
], and the binding of AP-1 to an AP-1 consensus site
within the IL-18 gene promoter was increased upon IFN-
or LPS
treatment [69
]. AP-1 is also activated by TNF in the
inflammatory response, resulting in the expression of proinflammatory
cell-adhesion molecules and tissue-remodeling proteases
[41
, 42
]. Considering the role AP-1 plays
in the expression of genes involved in the inflammatory response and
the role that neutrophils play in inflammation, it will now be
important to determine if the AP-1 site in the promoter of
p67phox is responsive to the inflammatory
mediators TNF-
, IFN-
, or LPS and whether PU.1 and AP-1 can
functionally cooperate to stimulate p67phox
promoter activity.
Received June 16, 2001; revised August 6, 2001; accepted August 7, 2001.
|
|
|---|
-induced p67phox and gp91phox expression J. Immunol. 163,6095-6105This article has been cited by other articles:
![]() |
A. Manea, S. A. Manea, A. V. Gafencu, M. Raicu, and M. Simionescu AP-1-Dependent Transcriptional Regulation of NADPH Oxidase in Human Aortic Smooth Muscle Cells: Role of p22phox Subunit Arterioscler Thromb Vasc Biol, May 1, 2008; 28(5): 878 - 885. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Ni, Y. Zhan, H. He, E. Maynard, J. A. Balschi, and P. Oettgen Ets-1 Is a Critical Transcriptional Regulator of Reactive Oxygen Species and p47phox Gene Expression in Response to Angiotensin II Circ. Res., November 9, 2007; 101(10): 985 - 994. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bedard and K.-H. Krause The NOX Family of ROS-Generating NADPH Oxidases: Physiology and Pathophysiology Physiol Rev, January 1, 2007; 87(1): 245 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Gauss, P. L. Bunger, T. C. Larson, C. J. Young, L. K. Nelson-Overton, D. W. Siemsen, and M. T. Quinn Identification of a novel tumor necrosis factor {alpha}-responsive region in the NCF2 promoter J. Leukoc. Biol., February 1, 2005; 77(2): 267 - 278. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Quinn and K. A. Gauss Structure and regulation of the neutrophil respiratory burst oxidase: comparison with nonphagocyte oxidases J. Leukoc. Biol., October 1, 2004; 76(4): 760 - 781. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Throm and M. J. Klemsz PU.1 regulates glutathione peroxidase expression in neutrophils J. Leukoc. Biol., July 1, 2003; 74(1): 111 - 117. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-L. Li, A. J. Valente, M. Qiang, W. Schlegel, M. Gamez, and R. A. Clark Multiple PU.1 sites cooperate in the regulation of p40phox transcription during granulocytic differentiation of myeloid cells Blood, May 29, 2002; 99(12): 4578 - 4587. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||