Pepro Tech

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gauss, K. A.
Right arrow Articles by Quinn, M. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gauss, K. A.
Right arrow Articles by Quinn, M. T.
(Journal of Leukocyte Biology. 2002;71:163-172.)
© 2002 by Society for Leukocyte Biology

AP-1 is essential for p67phox promoter activity

Katherine A. Gauss, Peggy L. Bunger and Mark T. Quinn

Department of Veterinary Molecular Biology, Montana State University, Bozeman

Correspondence: Mark T. Quinn, Ph.D., Veterinary Molecular Biology, Montana State University, Bozeman, MT 59717. E-mail: mquinn{at}montana.edu


arrow
ABSTRACT
 
The cytosolic NADPH oxidase cofactor p67phox has been shown to be one of the limiting factors in assembly and activation of this multi-protein enzyme complex and, therefore, must be highly regulated at the transcriptional level. In the present studies, we have further characterized the promoter for human p67phox. Genomic sequence upstream of the translational start site (TLS; 2 kb) was cloned, and RACE was used to identify and compare the transcriptional start site (TSS) in two myeloid cell lines, HL-60 and PLB-985. Two major TSS were identified within the first intron for both cell lines, and one transcript isolated from PLB-985 cells started approximately 34 bp 5' of exon 1 and contained no intron 1 sequence. To identify regulatory regions of the promoter, a luciferase reporter was used to assay a series of promoter deletion constructs. The greatest transcriptional activity was observed for fragments containing at least 500 bp upstream of the TLS. Sequence analysis of the p67phox promoter revealed consensus binding sites for previously described transcription factors including AP-1 and PU.1. Site-directed mutagenesis of the AP-1 site demonstrated that this site was essential for basal transcription. EMSA, competition, and super-shift assays showed that this site was specifically recognized by nuclear factors of the AP-1 family. EMSA analysis and promoter-reporter assays with the PU.1 consensus sites at positons -176, -283, and -328 demonstrate that PU.1 binds the site at position -283 with high affinity. Mutagenesis of any one of the PU.1 sites reduced the basal transcriptional activity by approximately 50%, demonstrating that, although none of these sites is singularly responsible for the basal transcriptional activity, all three sites play some role in the transcriptional activity of the p67phox promoter. In support of this conclusion, mutagenesis of all three sites completely abrogated transcriptional activity.

Key Words: neutrophil • NADPH oxidase • transcriptional regulation • promoter


arrow
INTRODUCTION
 
The phagocyte NADPH oxidase is a multi-protein enzyme complex that plays an essential role in host defense (reviewed in [1 ]). The NADPH oxidase catalyzes the transfer of electrons from NADPH to O2, resulting in the formation of superoxide anion (O2-) [2 , 3 ]. O2- is rapidly converted to secondary toxic oxygen species, such as hydrogen peroxide (H2O2), hydroxyl radical (OH), and hypochlorous acid (HOCl), which can efficiently kill microorganisms [4 ]. The importance of the NADPH oxidase to host immunity is demonstrated by the recurrent infections that occur in individuals with chronic granulomatous disease (CGD), which results in genetic defects of the NADPH oxidase components [5 , 6 ].

Activation of the NADPH oxidase involves the assembly of several neutrophil cytosolic and membrane proteins [1 , 3 ]. The membrane-associated component directly implicated in the flow of electrons from NADPH to O2 is a heterodimeric flavocytochrome b, which is composed of 91 kDa and 22 kDa subunits (gp91phox and p22phox, respectively) [7 , 8 ]. The cytosolic NADPH oxidase proteins include p40phox, p47phox, p67phox, and a low molecular-weight GTPase, Rac2 (reviewed in references [1 , 9 , 10 ]). During activation, the cytosolic oxidase proteins translocate to the membrane and associate with flavocytochrome b and possibly cytoskeletal proteins (reviewed in references [1 , 2 , 9 ]). Although the purpose of NADPH oxidase-generated oxidants is to destroy pathogens, these reactive oxygen species can also damage host tissues in the vicinity of the inflammatory site [11 12 13 ]. Thus, to insure minimal host tissue damage, the assembly/activation and deactivation of the NADPH oxidase system must be a tightly regulated process at the transcriptional and post-transcriptional levels.

Recent studies on the NADPH oxidase have suggested that p67phox may be the rate-limiting cofactor in the NADPH oxidase. For example, p47phox-independent NADPH oxidase activity can be reconstituted in vitro with only flavocytochrome b and high concentrations of Rac and p67phox [14 , 15 ]. Furthermore, Paclet and coworkers [16 ] recently used atomic force microscopy to directly show that of all cytosolic components, p67phox played the most critical function in assembly and activation of the NADPH oxidase.

Based on the demonstrated importance of p67phox in oxidase function, we hypothesized that transcriptional regulation of p67phox expression might play an important role in overall regulation of NADPH oxidase. The expression of p67phox appears to be regulated somewhat differently than that of other NADPH oxidase proteins during cellular differentiation. Generally, p67phox is expressed later than the other components, and its expression appears to correlate most closely with oxidase activity, supporting its role as the key factor limiting the respiratory burst during differentiation [17 18 19 ]. It has also been shown that the oxidase components gp91phox, p67phox, and p47phox are all regulated by the myeloid-specific transcription factor, PU.1 [24 , 26 , 27 ]. However, in contrast to this similarity, it has been shown that an intact PU.1 binding site within the p47phox and gp91phox promoters is essential for their activity but not for p67phox promoter activity. Of the various oxidase components, the transcriptional regulation of gp91phox has been best described, although there are still some controversies. Some data suggest that a CCAAT box within the promoter is recognized by CP1 and that this interaction is inhibited by CDP, resulting in transcriptional repression [20 21 22 ]. In contrast, a more recent study suggested that CDP does not bind this repressor element and that a Pbx-HoxA10 dimer is responsible for repressing gp91phox expression in myeloid cells [23 ]. There are also conflicting studies regarding the components of the multi-protein HAF1 complex, which binds the PU.1 binding element within the gp91phox promoter. Previously, it was demonstrated that the transcription factors PU.1, interferon regulatory factor 1 (IRF-1), and ICSBP made up the components of this complex [24 ]. In contrast, Voo and Skalnik [25 ] found that Elf-1, but not PU.1, was part of the HAF1 complex and that PU.1 was present in a faster-migrating complex.

Recently Eklund and Kakar [26 ] identified an interferon-{gamma} (IFN-{gamma})-inducible element within the p67phox promoter as a result of its similarity in sequence to the IFN-{gamma}-inducible PU.1 consensus site of the gp91phox promoter. They also showed that PU.1, IRF-1, and ICSBP bound to this element within the p67phox promoter, similar to their observations regarding the PU.1 binding element of gp91phox. However, as mentioned above, mutations within this site do not eliminate basal transcription from the p67phox promoter, unlike the gp91phox and p47phox promoters, where PU.1 binding-site mutations eliminate basal transcription [27 ]. These results suggest that the PU.1 binding element regulates these genes in a slightly different manner and that there are other regulatory elements within the p67phox promoter important for basal transcriptional regulation of this gene.

Because of the discrepancy in data regarding the factors that bind the PU.1 element within the gp91phox promoter and the difference in response to mutagenesis of the PU.1 site in the p67phox and gp91phox promoters, we focused on further characterizing the promoter region of p67phox. The p67phox promoter region was cloned and sequenced, and putative binding sites for known transcription factors were identified. Three putative PU.1 binding sites were identified, including the previously demonstrated PU.1 binding element. However, only one of the three PU.1 sites was shown to interact specifically and with high affinity to PU.1 from HL-60 cells, but mutation of this site did not fully eliminate transcriptional activity. In contrast, a binding site for the nuclear factor AP-1 was shown to be required for basal transcription of the p67phox promoter in HL-60 cells, and mutation of this domain completely abrogated transcription. Our results demonstrate a key role for AP-1 in the regulation of the p67phox promoter.


arrow
MATERIALS AND METHODS
 
Materials
Oligonucleotide primers were synthesized by Gibco-BRL (Grand Island, NY) and Sigma Genosys (Woodlands, TX). PU.1 and AP-1 antibodies and blocking peptides were from Santa Cruz Biotechnology (Santa Cruz, CA) and Geneka Biotechnology (Montreal, Canada), respectively.

Cell culture
The human promyelocytic cell line HL-60 and the human myeloid cell line PLB-985 were grown in Dulbecco’s modified Eagles’s medium (DMEM) supplemented with 20% fetal bovine serum (FBS) and in RPMI 1640 supplemented with 10% FBS, respectively. Both medias contained penicillin and streptomycin. Cell lines were maintained at 5 x 105/mL. The day prior to transfection, cells were seeded at 5 x 105/mL in fresh media.

Human p67phox genomic cloning and sequencing
The p67phox genomic region 5' of the translational start site (TLS) was cloned using the GenomeWalker Kit (Clontech, Palo Alto, CA). Using polymerase chain reaction (PCR), two overlapping regions of the p67phox promoter were amplified from the human genomic libraries provided by the manufacturer. The first genomic fragment was generated using a forward primer complementary to the adaptor sequence of the genomic DNA fragments and a reverse primer (5'-CTGGTAAAGGCCTTCTCTGCTTCAGTCATG-3') corresponding to bp 113–84 of the p67phox cDNA. The amplified PCR products were analyzed on a 1.5% agarose gel followed by nested PCR amplification. The forward primer corresponded to nested adaptor sequence and the reverse primer (5'-TCCAGGGCTCCCTTCCAGTCCTTCTTGTCC-3') to bp 79–51 of p67phox cDNA. The amplified product was cloned into the pCR2.1 vector using a TA Cloning Kit (Invitrogen, Carlsbad, CA) and sequenced. The second genomic fragment was isolated as above using primers designed from the 5' region of the first walk. The reverse primer for the initial amplification was 5'-CCAAATGAAACCCGTGACCTAGAGTGAGAAC-3' (-558–589 from TLS) and 5'-CTTCTGTTCCTGTTTGTCTGCTCTTTCCC-3' (-590–617) for the nested PCR. Three independent clones were sequenced from each genomic walk to establish a consensus sequence.

For cycle sequencing, PCR was performed on a Perkin Elmer 2400 thermocycler using Big Dye Terminators, and the samples were run on an ABI 310 Genetic Analyzer (Perkin-Elmer ABI, Foster City, CA). The nucleotide sequence translation and analysis were performed with DNASTAR software (Madison, WI).

5' Rapid amplification of cDNA ends (5' RACE)
Total RNA was isolated from differentiated HL-60 and PLB-985 cells. HL-60 cells were differentiated by incubating cells (5x105 cells/mL) with 10 µM 9-cis-retinoic acid (RA) for 48 h. Cells were washed in media and resuspended at 5 x 105/mL in media containing 0.5% DMF (dimethylformamide) for 5–7 days. PLB-985 cells were differentiated in the presence of 10 µM RA for 24 h. Cells were washed and incubated for 5–7 days with 0.5% DMF. The nitroblue tetrazolium (NBT) test was used to determine differentiation [28 , 29 ]. Briefly, media was removed from cells, and a saturated NBT solution prepared freshly in media along with phorbol 12-myristate 13-acetate (PMA) at 100 ng/mL was added. Cells were incubated for 30–60 min at 37°C. Differentiated cells (purple) were scored visually.

RNA from the differentiated cells was isolated using an SV Total RNA Isolation System (Promega, Madison, WI) and used to perform 5' RACE with the SMART RACE cDNA Amplification Kit (Clontech), according to the manufacturer’s protocol. Briefly, 1 µg total RNA was used to generate 5' RACE-ready cDNA. The forward primer for the initial PCR amplification corresponded to the SMART II oligonucleotide, and the reverse primer was the same as that used for the first genomic walk. The RACE-amplified DNA was gel-purified using a QIAquick Gel Extraction Kit (Qiagen, Valencia, CA) and subjected to a "nested" PCR reaction. The forward primer corresponded to nested Smart II sequence, and the reverse primer was the same used for the first nested genomic walk. The nested PCR products were TA-cloned as above, and a total of 19 HL-60 and 16 PLB-985 5' RACE products were sequenced to determine the transcriptional start site (TSS).

Luciferase vector construction
PCR was used to amplify a single 2 kb genomic p67phox promoter sequence from genomic DNA. The forward primer (5'-CGCGGTACCAAACTGGGCTTTGAAAGATGAGTAGGAG-3') corresponded to the 5' end of the second genomic walk and contained a KpnI restriction site. The reverse primer (5'-GGGCTCGAGCGGTCCACCAGGGACATGATTAGGTAG-3') spanned the TLS of p67phox and contained an XhoI restriction site. The amplified DNA was digested with KpnI and XhoI and cloned into the pGL3-Basic Luciferase Vector (Promega). This clone, pGL3-p67-2017 (i.e., 2017 bp 5' of the TLS), was sequenced to confirm that no PCR mutations were introduced and was subsequently used to generate the promoter deletion constructs. All forward primers contained a KpnI restriction site and the p67phox promoter sequence necessary to generate the desired deletion (see Fig. 1 ). The reverse primer was the same as used above containing the XhoI restriction site. The amplified DNA was digested with KpnI and XhoI and ligated into KpnI/XhoI-digested pGL3-Basic.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 1. Sequence analysis of the p67phox promoter. Exon1 and the beginning of exon2 are labeled below the sequences and indicated in bold type. The translational start site within exon2 is underlined and labeled (TLS), with the first bp of the TLS designated as +1. The transcriptional start sites are indicated with arrows, and consensus-binding sites for transcription factors PU.1, AP-1, and AP-4 are underlined and labeled. The first nucleotide of each promoter deletion construct is in bold type and labeled with respect to length of nucleotides from the ATG start site. This sequence has been submitted to GenBank with accession number AY032997.

A site-directed mutagenesis kit (QuikChange, Stratagene, La Jolla, CA) was used to generate the mutated binding sites. The mutagenic primers were as follows: PU.1-176, 5'-TGGGGACATAAACTGATGCATTTGCAACAC-3'; PU.1-283, 5'-GCTGATGTACTTAATCTCTCCTCCACACTC-3'; PU.1-328, 5'-CTGGGTGACAGAGCATTTGCATTTTGGGGA-3'; AP-1, 5'-ATGGTAGGGTTATAAATCAGTTGCCAAAAG-3'; AP-4, 5'-TGATCCTTCAGGCAGCTTTTGATGTACTTC-3'. Altered nucleotides are underlined. The double PU.1 binding-site mutations were made by first mutating one PU.1 site and then using that construct as template for a second round of site-directed mutagenesis. The triple PU.1 mutant was generated using one of the PU.1 double mutants as template. All constructs were confirmed by sequencing.

Transient transfections
The day prior to transfection, cells were resuspended to 5 x 105/mL in fresh DMEM media. For transfections, 107 cells were resuspended in 800 µL RPMI containing 25 µg luciferase-reporter constructs and 5 µg pRL-TK vector to control for transfection efficiency. Cells were electroporated at 950 µF and 210 V in 0.4 cm cuvettes. Cells were resuspended in 8 mL DMEM and incubated for 24 h. Transfected cells were assayed for firefly and Renilla luciferase activity as per the manufacturer’s protocol using the Dual-Luciferase Reporter Assay System (Promega). Briefly, cells were washed in PBS and resuspended in 100 µL lysis buffer (Promega). To test for firefly luciferase activity, 30 µL was used with an EG&G BERTHOLD Lumat LB 9507 luminometer. Subsequently, 100 µL Stop & Glo Reagent (Promega) was added to the sample and tested for Renilla luciferase activity.

In vitro translation of human PU.1
The PU.1 full-length cDNA was isolated from a human leukocyte cDNA library by PCR amplification using gene-specific PCR primers spanning the start and stop sites. The amplified PU.1 PCR product was TA-cloned, and the sequence was confirmed. A clone containing an insert in the correct orientation was in vitro-transcribed and translated using the TNT Quick Coupled Transcription/Translation Systems (Promega). The [35S]methionine-PU.1 was run on a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel, and the gel was subjected to autoradiography to confirm the correct molecular mass of 38 kDa as previously demonstrated [30 ]. [35S]Methionine-PU.1 (2 µL) was used per electrophoretic mobility shift assay (EMSA) reaction.

Electrophoretic mobility shift assay (EMSA)
DIG-11-ddUTP-labeled double-stranded oligonucleotide probes were used as probes for EMSA. Briefly, equal molar amounts of complementary oligonucleotides were annealed in TEN buffer [10 mM Tris-HCL, 1 mM ethylenediaminetetraacetate (EDTA), 0.1 M NaCl, pH 8.0] for 10 min at 95°C. The annealed DNA was labeled using a DIG Gel Shift Kit (Roche, Indianapolis, IN) as per the manufacturer’s protocol. For gel-shift assays, the labeled DNA probe was incubated with 6 µg nuclear extract in 1x binding buffer (Roche) for 20 min at 4°C. For competition assays, 100-fold excess of cold competitor was added along with labeled probe. For super-shift and peptide-blocking assays, antibody and blocking peptides were added to nuclear extracts and incubated for 20 min at 4°C prior to addition of labeled probe. Samples were run on a 5% nondenaturing polyacrylamide gel (19:1) in 0.5 x TBE (PU.1 EMSA) or 0.25 x TBE (AP-1 EMSA) and electrophoresed at 170V for 3.5 h. Gels were transferred to positively charged nylon membrane (Roche) at 400 mA for 1 h. Membranes were soaked in 2x saline sodium citrate (SSC), and oligonucleotides were cross-linked using a Stratalinker at 120 mJ. Chemiluminescent detection was performed as described (DIG Gel Shift Kit, Roche).


arrow
RESULTS
 
Cloning the human p67phox 5'-promoter region
Two overlapping DNA fragments containing approximately 2 kb of the 5'-flanking region of the p67phox gene were cloned by genomic walking as described in Materials and Methods. The first genomic fragment (walk1) was cloned using reverse and nested reverse primers that corresponded to p67phox cDNA sequence to generate specific p67phox promoter first- and second-round PCR products. A 720 bp amplified product was cloned into the pCR2.1 vector and sequenced to verify that the 3' sequence of the clone corresponded to the 5' sequence of the p67phox cDNA. To obtain an additional 5'-flanking promoter region, sequence from walk1 was used to design reverse and nested reverse primers for a second genomic walk. A 1430 bp amplified product was cloned and sequenced to verify an overlapping sequence corresponding to a 5' sequence of the 1st walk. A full-length 2 kb fragment of the p67phox promoter was cloned by amplifying human genomic DNA using a forward primer that corresponded to sequence from the 5' end of the second genomic walk and a reverse primer that spanned the p67phox translational start site. A consensus sequence is shown in Figure 1 . Although the first ~1 kb of this sequence (-2015–-1000) is new, the second 1 kb (-1000 to the TLS) is similar to what has been published previously for this region [26 ]. Note, however, that there were several differences in our sequence as compared with the sequence shown, including many added bases and some base differences. The reason for these differences is not clear, however we have confirmed our sequence is correct by sequencing over this region many times in the process of preparing mutant constructs. One possible explanation for the differences in sequence is single nucleotide polymorphisms. However, the reason for the presence of added or missing bases is not clear.

Identification of the p67phox transcriptional start site
To identify the transcriptional start site for p67phox in myeloid cells, total RNA was isolated from human promyelocytic HL-60 and myeloid PLB-985 cell lines that had been differentiated with retinoic acid and dimethyl sulfoxide (DMSO) to increase p67phox gene expression. The 5' RACE DNA from both cell lines was cloned, and a total of 19 HL-60 and 16 PLB-985 5' RACE clones were sequenced to determine and compare the TSS (Fig. 1) . Because there were multiple TSS, the first nucleotide of the translational start site was designated as +1 bp. Two major transcriptional start sites were identified at positions -167 and -121 and were located within the first intron. Nine p67phox transcripts began at position -167, eight from the HL-60 cells and one from PLB-985 cells. Eight transcripts from PLB-985 cells and two from HL-60 cells began at position -121. Six RACE products began at -94 bp (three from each cell line). Two transcripts from PLB-985 cells and one from HL-60 cells began at -104. It is interesting that one PLB-985 RACE product began at -584 and did not contain any sequence from intron 1. These transcripts begin at slightly different positions than those previously shown for p67phox [26 ], which could be explained by the different methods and cell types used to isolate and identify p67phox transcript sequence. Previously, a transcriptional start site at -24 was identified by isolating p67phox cDNA from a library derived from HL-60 cells differentiated with dibutyril cAMP [31 ], whereas transcripts beginning at -24, -42, and -58 were identified by primer extension using RNA from the human U937 myelomonocytic cell line [26 ]. Because all of the transcripts contained the same coding region, the significance of the alternative TSS is unclear. One possibility is that different TSS are used in different cell types or that some are preferentially used in response to certain signals. The TSS at position -104 was shown to be inducible by IFN-{gamma} treatment of U937 cells [26 ] and is similar in position to the TSS for three of the transcripts isolated from differentiated HL-60 and PLB-985 cells. A second possibility is that mRNAs originating from different TSS could have variable stabilities or that the different 5'-untranslated regions (UTRs) could affect elongation by the RNA polymerase [32 33 34 35 ].

Localization of p67phox promoter activity
To identify promoter elements that were important for p67phox transcriptional activity, nine different p67phox promoter fragments ranging in size from 40–2015 bp were cloned 5' of the luciferase-reporter gene (Fig. 2 A ). The promoter constructs were co-transfected into HL-60 cells along with the pRL-TK vector (transfection-efficiency control), and the normalized data are shown in Figure 2B . No significant transcriptional activity was observed for constructs containing 150 bp or less of the promoter. The first significant luciferase activity of 20-fold was observed for the construct containing 300 bp of sequence upstream of the TLS. The luciferase activity more than doubled for constructs containing >=500 bp of the promoter region, suggesting additional regulatory elements between 300 and 500 bp. The promyelocytic cell line PLB-985 and the erythroid cell line K562 were also tested for p67phox promoter activity (unpublished results). Similar results were obtained with PLB-985 cells, however the maximum luciferase activity was five times less than that observed with the HL-60 cells. This is most likely a result of the difficulty in transfecting PLB-985 cells and correlated with the reduced activity of the reporter gene product used to correct for differences in transfection efficiency. The K562 cells showed initial activity for the -75 promoter construct of approximately fivefold over the vector with no insert. In K562 cells, no additional increase in promoter activity was observed for the larger promoter fragments. These results suggest important regulatory sequences are located between -150 bp and -500 bp 5' of the ATG start site and that they confer myeloid-specific activity.



View larger version (10K):
[in this window]
[in a new window]
 
Figure 2. Identification of the minimal promoter region of p67phox necessary for basal transcriptional activity. (A) Promoter deletion constructs. Serial deletion fragments were generated using PCR with the longest 2015 bp fragment as a template, as described in Materials and Methods. The length of each fragment is labeled with the number of nucleotides from the ATG start site. These promoter deletion fragments were cloned 5' of the luciferase gene. (B) Luciferase activity of the promoter deletion constructs. Log-phase HL-60 cells were co-transfected with the indicated promoter-deletion constructs and pRL-TK to normalize for transfection efficiency, and 48 h post-transfection, cell extracts were assayed for luciferase activity. Luciferase values were corrected for transfection efficiency and are shown relative to the activity of the promoterless vector, pGL3-Basic. Data are representative of four independent experiments using two different DNA preparations of each construct.

The p67phox promoter sequence between -150 and -500 was analyzed using the TRAnscription Databases and Analysis Tools (TRADAT) [36 ] software to identify possible binding sites for known transcription factors. Three putative binding sites for the myeloid-specific transcription factor PU.1 were identified (Fig. 1) . The site at -176 is similar in sequence to the PU.1 binding site in the promoter of another NADPH oxidase gene, gp91phox [25 , 37 ]. This site in the p67phox promoter has been recently characterized [26 ], and it was shown that this site was necessary for INF-{gamma}-induced p67phox expression. The second site at -283 is the same as a PU.1 site identified in the promoter of another NADPH oxidase gene, p47phox [27 ] and in the neutrophil elastase gene promoter [38 ]. The third putative PU.1 binding site at -328 is identical to the PU.1 binding site in the promoter of the immunoglobulin (Ig)J gene [39 ]. Consensus binding sites for the ubiquitously expressed AP-4 and AP-1 transcription factors [40 ] were also identified (Fig. 1) . AP-1 has been shown to be activated by many different stimuli, including mitogenic growth factors, inflammatory cytokines, growth factors of the transforming growth factor-ß (TGF-ß) family, UV and ionizing irradiation, cellular stress, antigen binding, and neoplastic transformation [41 , 42 ]. AP-4 was first identified as a factor binding to the simian virus SV40 enhancer and was shown to interact synergistically with AP-1 to increase transcription in vitro from the SV40 late promoter [43 ].

Transcriptional activity of p67phox promoter mutants
To determine the role of the AP-1, AP-4, or PU.1 sites in p67phox expression, p67phox promoter mutants of these sites were generated within the 500 bp promoter fragment and cloned 5' of the luciferase-reporter gene as described in Materials and Methods (Fig. 3 A ). HL-60 cells were co-transfected with promoter mutant constructs and the pRL-TK vector, and the normalized data are shown in Figure 3B . Mutagenesis of any one of the PU.1 sites reduced the basal transcriptional activity by approximately 50%, as compared with the wild-type p67phox 500 bp promoter construct, suggesting that any one of these sites is not singularly responsible for the basal transcriptional activity of this promoter. Of the double mutants studied, PU.1-176,283 and PU.1-283,328 further reduced the promoter activity compared with that of the single PU.1 mutants, however the PU.1-176,328 double mutant showed no additional reduction in activity compared with that of the single mutants (Fig. 3B) . It is interesting that when all three putative PU.1 binding sites were mutated, the result was complete loss of basal transcriptional activity. These results suggest that all three putative PU.1 sites may play some role in p67phox expression.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 3. Transcriptional activity of p67phox promoter mutants. (A) Promoter mutant constructs. The promoter deletion construct containing 500 nucleotides 5' of the ATG start site (labeled p67–500) was used as a template to generate the various PU.1, AP-1, and AP-4 mutant promoter fragments via site-directed mutagenesis. These fragments were cloned 5' of the luciferase gene. The specific consensus site that was mutated is labeled at the right of the fragment, and the position of the mutation within the fragment is indicated with an X. The translation start site is labeled TLS. (B) Luciferase activity of the promoter mutant constructs. HL-60 cells were co-transfected with the indicated promoter mutant constructs and pRL-TK to normalize for transfection efficiency. Luciferase activity was determined and shown as described in Figure 2 . Data are representative of four independent experiments using two different DNA preparations of each construct and represent five replicate transfections per construct (mean±SE).

Mutagenesis of the AP-4 site had no affect on transcriptional activity, suggesting this site is not necessary for basal transcriptional activity (Fig. 3B) . In contrast, the construct containing the mutant AP-1 site showed complete loss of transcriptional activity (Fig. 3B) , suggesting that the AP-1 site is essential for basal transcription of the p67phox promoter in HL-60 cells.

In vitro synthesized PU.1 and PU.1 from HL-60 nuclear extracts specifically bind PU.1-283 with high affinity
To determine if PU.1 binds specifically to the PU.1 sites identified in the p67phox promoter, EMSA analysis was performed using double-stranded oligonucleotides representing the three putative PU.1 sites and in vitro synthesized PU.1 or nuclear extracts from HL-60 cells. The PU.1 binding site from the gp91phox promoter was used as a control. As shown in Figure 4 , the PU.1-283 site was bound by in vitro synthesized PU.1 (lane 5). The specificity of this interaction was demonstrated by super-shifting with anti-PU.1 antibody (with concurrent loss of the PU.1-specific band) and by blocking the super-shift with anti-PU.1 antibody-blocking peptide (lanes 6 and 7, respectively). Importantly, these results are comparable to those observed with the PU.1 binding site from the promoter of gp91phox (lanes 11–13). The PU.1 sites at -176 and -328 appear to be bound by in vitro synthesized PU.1 (lanes 2 and 8, respectively) but with much less affinity than the PU.1-283 site.



View larger version (87K):
[in this window]
[in a new window]
 
Figure 4. EMSA of the PU.1 consensus sites using 35S-labeled PU.1. EMSA was performed using in vitro-synthesized 35S-labeled PU.1, and DNA-protein complexes were separated on 5% polyacrylamide gels. Lane 1 contains no oligonucleotide; lanes 2–4 contain PU.1-176 oligonucleotide (TGGGGACATTTCCTGATGCATTTGCAACAC); lanes 5–7, the PU.1-283 oligonucleotide (GCTGATGTACTTCCTCTCTCCTCCACACTC); lanes 8–10, the PU.1-328 oligonucleotide (CTGGGTGACAGAGCAGAAGCATTTTGGGGA); and lanes 11–13, the gp91 PU.1 oligonucleotide (CTGCTGTTTTCATTTCCTCATTGGAAGAAGC) as a control for PU.1 binding. Where indicated, 2 µg anti-PU.1 antibody (lanes 3, 6, 9, 12) or anti-PU.1 antibody and anti-PU.1 antibody-blocking peptide were added (lanes 4, 7, 10, 13). The arrows and arrowheads indicate the specific PU.1-shifted complex and the super-shifted complex, respectively.

To further characterize the putative PU.1 sites, EMSA was performed using nuclear extracts from HL-60 cells (Fig. 5 ). Again, similar to results observed with the gp91phox PU.1 binding site, the PU.1-283 site specifically shifted a band that could be competed away with the cold gp91phox PU.1 binding site (Fig. 5A , lane 6), but not with a mutant gp91phox PU.1 binding site (lane 7), and could be super-shifted with an anti-PU.1 antibody and concurrent loss of the PU.1-specific band (lane 8). To further demonstrate the specificity of the interaction of PU.1 with the PU.1-283 site, the super-shift was blocked with an anti-PU.1 antibody-blocking peptide, and there was no apparent super-shift with a non-PU.1 antibody (Fig. 5B , lanes 5 and 6). Taken together, these data suggest that the site at -283 is specifically bound with high affinity by PU.1. These results do not, however, rule out the possibility of PU.1 binding to PU.1-176 and PU.1-328, because the three sites investigated here are different in sequence, and it has been demonstrated that 5' or 3' sequence flanking the core binding site can greatly affect the affinity of PU.1 binding [40 ]. It is also possible that PU.1 binds to PU.1-176 and PU.1-328 but only in the presence of other factors that are not present in undifferentiated HL-60 cells or in the in vitro-synthesized PU.1 extract. Even if accessory cofactors are present, they may need to be activated in response to cellular signals prior to PU.1 and/or DNA interactions.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 5. EMSA of the PU.1 consensus sites using HL-60 nuclear extracts. (A) PU.1-283 binds PU.1 from HL-60 nuclear extracts. Labeled oligonucleotides corresponding to the different PU.1 consensus sites were incubated with HL-60 nuclear extracts in the absence (lanes 1, 5, 9, 13) or presence of 200-fold excess of wild-type (WT gp91 PU.1, lanes 2, 6, 10, 14) or mutant (MUT gp91 PU.1, lanes 3, 7, 11, 15) gp91phox PU.1-competing oligonucleotide. Refer to Figure 4 legend for sequences of the PU.1 and wild-type gp91phox PU.1 probes. The gp91phox PU.1 mutant oligonucleotide sequence is CTGCTGTTTTCAAAACCTCATTGGAAGAAGC. For super-shift analysis, anti-PU.1 antibody was added where indicated (lanes 4, 8, 12, 16). DNA-protein complexes were analyzed as described in the legend to Figure 4 . The arrows and arrowheads indicate the specific PU.1-shifted complex and the super-shifted complex, respectively. (B) PU.1 specifically binds the PU.1-283 consensus site. PU.1-283 probe was incubated with HL-60 nuclear extracts in the absence (lane 1) or presence of 200-fold excess of WT gp91phox PU.1 (lane 2) or MUT gp91phox PU.1 (lane 3) as the competing oligonucleotide. Where indicated, anti-PU.1 antibody was added in the absence (lane 4) or presence (lane 5) of anti-PU.1 antibody-blocking peptide. JunD antibody was added (lane 6) to demonstrate the specificity of the super-shift by anti-PU.1 antibody.

AP-1 consensus site is bound specifically by nuclear factors Fos and Jun
Initial EMSA studies to demonstrate specific binding of AP-1 to the p67phox promoter were performed using HL-60 nuclear extracts. Although a band was shifted and competed away with the cold AP-1 site, the band intensity was not sufficient to allow further super-shift analysis (unpublished results). Therefore, nuclear extracts from 3T3SR cells, which contain high levels of activated AP-1 factors, were used for subsequent AP-1 EMSA analysis. The p67phox AP-1 site shifted a band (Fig. 6 , lane 1) that was competed away with the cold p67phox-AP-1 site and the cold wild-type AP-1 DNA consensus site (Geneka Biotechnology; lanes 2 and 4) but not with cold gp91phox PU.1 or mutant AP-1 sites (lanes 3 and 5). To further demonstrate the specificity of AP-1 binding to this site, super-shift analysis was performed using anti-c-Fos, c-Jun, FosB, JunB, and JunD antibodies with or without blocking peptides. Super-shifts were observed for c-Fos, c-Jun, FosB, and JunB but not JunD antibodies (lanes 6, 9, 12, 15, and 18) and could be inhibited with specific blocking peptides (lanes 7, 10, 13, and 16). Because Fos can bind DNA only as a heterodimer with Jun, we conclude that Fos/Jun heterodimers are able to bind this putative AP-1 site of the p67phox promoter. The FosB and JunB antibodies super-shift more of the AP-1-specific band (lanes 12 and 15) than the c-Fos and c-Jun antibodies (lanes 6 and 9), suggesting that a FosB/JunB heterodimer binds this site more efficiently or that there is more FosB/JunB complex in the extract. Importantly, these data directly demonstrate that members of the AP-1 family of transcription factors do indeed recognize the AP-1 site in the promoter of p67phox.



View larger version (82K):
[in this window]
[in a new window]
 
Figure 6. AP-1 nuclear factors Fos and Jun specifically bind to the p67phox promoter AP-1 consensus site. Labeled p67phox AP-1 consensus site (ATGGTAGGGTTATAAATCAGTTGCCAAAAG)was used as a probe for EMSA analysis. The labeled probe was incubated with serum responsive (SR) 3T3 nuclear extract in the absence (lane 1) or presence of 200-fold excess of p67phox AP-1 site (p67 AP-1, lane 2); wild type AP-1 site 5'-CGCTTGATGAGTCAGCCGGAA-3' (WT AP-1, lane 4); mutant gp91phox PU.1 site (MUT gp91 PU.1, lane 3); or mutant AP-1 5'-CGCTTGATGACCCAGCCGGAA-3' (MUT AP-1, lane 5)-competing oligonucleotide. Where indicated, antibodies against cFos, c-Jun, FosB, JunB, and JunD were added in the absence (lanes 6, 9, 12, 15, 18) or presence of specific antibody-blocking peptides (lanes 7, 10, 13, 16, 19). Anti-PU.1 antibody was included as a negative control (lanes 8, 11, 14, 17, 20) to demonstrate the specificity of the super-shift by these antibodies. Procedures were similar to those for Figures 4 and 5 . The arrows and arrowheads indicate the specific PU.1-shifted complex and the super-shifted complex, respectively.


arrow
DISCUSSION
 
The difference in timing of expression of the oxidase components gp91phox, p67phox, and p47phox on myeloid differentiation suggests that the promoters of these genes are regulated differently [17 18 19 ]. Although it appears the myeloid-specific transcription factor PU.1 is important in the regulation of all three genes, disruption of the PU.1 consensus site has variable effects on the basal transcriptional activity of their respective promoters. It has been demonstrated that a functional PU.1 site is necessary for the basal transcription of gp91phox and p47phox but not for p67phox [26 , 27 ]. These data suggest that there are additional regulatory elements within the p67phox promoter that are important for regulation of transcriptional activity. Indeed, the results shown here demonstrate that an AP-1 consensus site within the p67phox promoter is essential for basal transcription of this promoter in myeloid cells.

The promoter deletion studies described here identified the promoter sequence between -500 bp and the ATG start site as necessary for maximal basal transcriptional activity, suggesting that important regulatory elements are located within this region. Mutagenesis of an AP-1 site within this region completely abrogated basal transcriptional activity for the 500 bp promoter fragment, and EMSA studies demonstrated that Fos/Jun heterodimers specifically bind to this site. Our results, however, do not rule out the possibility that Jun homodimers or other AP-1 family members also bind this site. It is possible that Fos/Jun heterodimers and Jun homodimers bind to and/or compete for the p67phox AP-1 consensus site. Which dimer actually binds in vivo may be determined in part by the levels of each factor, which in turn may depend on the differentiation state of the cell, the cell type, or by the different binding affinities observed for the various AP-1 dimers [44 , 45 ]. It has been demonstrated previously that heterodimers formed between the different Jun and Fos proteins have better binding activity than Jun/Jun homodimers and that Jun/Fos/DNA complexes are more stable than Jun/Jun/DNA complexes [45 ]. AP-1 factors have also been shown to confer positive and negative transcriptional regulation depending on which AP-1 complex is occupying the DNA binding site. For example, the human proenkephalin promoter is activated by a JunD homodimer [46 ]. Although a JunB homodimer cannot bind the AP-1 site in the proenkephalin promoter, it can bind with high affinity as a JunB/c-Fos heterodimer, thereby inhibiting activation by JunD. AP-1 factors do not need to compete for DNA binding to have antagonistic effects on promoter activity, as demonstrated for several marker genes of epidermal keratinocytes [47 ]. For example, c-Jun/c-Fos heterodimers activated gene expression by binding at AP-1 sites, however JunB repression and JunD activation of these promoters did not involve c-Fos and were not dependent on interactions with the AP-1 site [47 ]. Which of the AP-1 family members are involved and their effect on p67phox promoter activity in myeloid cells remain to be determined.

In addition to the PU.1 consensus site at position -176 demonstrated by Eklund and Kakar [26 ], we have identified two additional putative PU.1 binding sites at positions -283 and -328 bp from the TLS. The -283 PU.1 consensus site specifically and avidly interacted with PU.1 from HL-60 nuclear extracts and with in vitro-synthesized PU.1. EMSA analysis using in vitro-synthesized PU.1, but not HL-60 nuclear extracts, suggested the two remaining sites also interacted with PU.1 but with much lower affinity. The difference in binding affinity may be caused by the difference in nucleotide sequence flanking the core PU.1 binding site as demonstrated by Li et al. [40 ]. A requirement for multiple binding sites for the same transcription factor has been shown and that the binding of the factor to multiple sites can be cooperative. For example, WT1 binds to high- and low-affinity sites within the insulin-like growth factor II promoter, and binding of even-skipped to high-affinity binding sites of the ultra-bithorax gene promoter facilitates subsequent binding of even-skipped to low-affinity binding sites [48 , 49 ]. Similarly, cooperative interactions between PU.1 molecules bound to the p67phox promoter may stabilize their binding and enhance the ability of PU.1 to regulate p67phox gene expression. The complete loss of promoter activity observed when all three sites are mutated certainly suggests that each site plays some role in p67phox promoter activity. Another explanation for the difference in PU.1 binding to the various consensus sites is that PU.1 could be binding to the various sites in conjunction with different cofactors that are present only in certain cell types and under certain cell conditions or differentiation states or that need to be activated in response to specific signals. This would suggest that the different PU.1 sites could regulate p67phox promoter activity by responding differently to different stimuli possibly in different cell types. The studies shown to date suggest that there are different mechanisms for PU.1 regulation of gp91phox, p47phox, and p67phox [24 , 26 , 27 ]. Promoter mutations that abolish PU.1 binding to the promoters of gp91phox and p47phox also abolished promoter function. In contrast, PU.1 enhanced but was not essential for p67phox-promoter function. These findings are consistent with the observation that PU.1 knockout mice contain a p67phox message [50 ], which suggests that PU.1 is not necessary for basal transcription of p67phox but does not rule out the possibility that PU.1 is involved in the induction of p67phox by inflammatory mediators. Also, PU.1 alone was able to confer lineage-inappropriate expression of p47phox, however p67phox and gp91phox required additional lineage-specific factors, IRF-1 and ICSBP, with PU.1 for enhanced promoter function in response to INF-{gamma}. It will be of interest to determine if the PU.1 consensus binding sites at positions -329 and -284 require the lineage-specific factors IRF-1 and ICSBP along with PU.1 to affect p67phox promoter activity, as that demonstrated for the PU.1 binding sites of the gp91phox and p67phox (-176) promoters [24 , 26 , 51 , 52 ]. In the present studies, we have determined that none of the PU.1 consensus sites in the p67phox promoter are individually responsible for basal p67phox promoter activity. However, when all were mutated, no promoter activity was detected, suggesting some role for all three sites in promoter activity. Further characterization of the PU.1 binding sites within the p67phox promoter is necessary to fully understand the role of PU.1 in p67phox gene expression.

It has recently been shown that CBP (CREB-binding protein) may also play a role in co-activation of p67phox. Eklund and Kakar [26 ] demonstrated that PU.1, IRF-1, and ICSBP recruit CBP to the p67phox promoter at a putative PU.1 consensus site at position -176, suggesting that this is the mechanism by which PU.1 activates transcription of p67phox. Although it has been proposed that CBP participates in the activities of hundreds of different transcription factors by bringing histone acetyltransferase (HAT) activity to the promoter [53 ], the exact role of CBP in transcriptional regulation remains unclear (for review, see [54 ]). CBP has also been shown to regulate transcriptional activity by acetylating transcription factors to increase their binding affinities for DNA [55 ]. It is interesting that CBP has been shown to interact directly with PU.1 and c-Fos using the yeast two-hybrid system [56 ], and it was suggested that the limiting amounts of CBP in the cell may mediate synergistic and antagonistic interactions between PU.1 and other transcription factors. CBP has also been shown to stimulate Fos/Jun activity via its interaction with c-Fos [57 ]. Considering the close juxtaposition of the AP-1 site and PU.1 sites in the p67phox promoter, the possibility exists that there may be cross-talk (positive or negative) between factors binding the AP-1 and PU.1 sites.

There are examples of AP-1 and PU.1 cooperating to regulate cell-specific gene expression. PU.1 and c-Jun are necessary for basal promoter function of the macrophage-specific macrosialin gene and act synergistically to activate its promoter [58 ]. Additionally, the macrophage scavenger receptor gene, which is highly expressed during monocyte-to-macrophage differentiation, is regulated by PU.1 and AP-1 [59 ]. It is interesting that both of these factors have also been shown to regulate the monocyte-specific macrophage colony-stimulating factor (M-CSF) receptor, which has a PU.1 but not an AP-1 DNA binding site [60 ]. In this case, c-Jun apparently does not bind directly to the M-CSF receptor promoter but interacts with the ETS domain of PU.1 to act as a co-activator of PU.1, resulting in the expression of the M-CSF receptor gene. Also, it has been demonstrated that PU.1 binding to the Ig{kappa} 3' enhancer region recruits other transcription factors including c-Fos and c-Jun to form a multi-protein-complex that synergistically activates transcription [61 ]. However, mutants of PU.1 lacking the transactivation domain are still able to cooperate synergistically to activate this promoter [62 ]. In this case, it has been proposed that the role of PU.1 is to serve as an architectural protein by inducing DNA bending, which promotes binding of other transcription factors to nearby regulatory elements and allows the formation of a higher-order protein complex. It is interesting that AP-1 factors have also been shown to induce DNA bending [63 , 64 ]. Similar to PU.1, it was suggested that the AP-1-induced changes in DNA structure may promote cooperative binding of factors to nearby binding sites and mediate interactions between these regulatory proteins [65 ].

The expression of p67phox has been shown to be up-regulated by lipopolysaccharide binding protein (LPS) and TNF-{alpha} [66 , 67 ]. It is interesting that AP-1 has been shown to be important in the expression of certain genes when cells are exposed to LPS, TNF-{alpha}, and INF-{gamma}. For example, LPS induction of promoter activity of the kappa immunoglobulin light-chain gene in pre-B cells requires an intact AP-1 DNA-binding site [68 ], and the binding of AP-1 to an AP-1 consensus site within the IL-18 gene promoter was increased upon IFN-{gamma} or LPS treatment [69 ]. AP-1 is also activated by TNF in the inflammatory response, resulting in the expression of proinflammatory cell-adhesion molecules and tissue-remodeling proteases [41 , 42 ]. Considering the role AP-1 plays in the expression of genes involved in the inflammatory response and the role that neutrophils play in inflammation, it will now be important to determine if the AP-1 site in the promoter of p67phox is responsive to the inflammatory mediators TNF-{alpha}, IFN-{gamma}, or LPS and whether PU.1 and AP-1 can functionally cooperate to stimulate p67phox promoter activity.


arrow
ACKNOWLEDGEMENTS
 
This work was supported in part by NIH RO1 AR42426 and HL66575, USDA NRICGP equipment grant 00-01138, and the Montana State University Agricultural Experimental Station. K. A. G. is supported by an Arthritis Foundation Postdoctoral Fellowship. M. T. Q. is an Established Investigator of the American Heart Association. This is manuscript 2001-27 from the Montana Agricultural Experiment Station, Montana State University-Bozeman. We thank Dr. George Gauss for reviewing this manuscript and providing helpful suggestions.

Received June 16, 2001; revised August 6, 2001; accepted August 7, 2001.


arrow
REFERENCES
 
    1
  1. DeLeo, F. R., Quinn, M. T. (1996) Assembly of the phagocyte NADPH oxidase: molecular interaction of oxidase proteins J. Leukoc. Biol. 60,677-691[Abstract]
  2. 2
  3. Chanock, S. J., El Benna, J., Smith, R. M., Babior, B. M. (1994) The respiratory burst oxidase J. Biol. Chem. 269,24519-24522[Free Full Text]
  4. 3
  5. Clark, R. A. (1999) Activation of the neutrophil respiratory burst oxidase J. Infect. Dis. 179,S309-S317
  6. 4
  7. Miller, R. A., Britigan, B. E. (1995) The formation and biologic significance of phagocyte-derived oxidants J. Investig. Med. 43,39-49[Medline]
  8. 5
  9. Dinauer, M. C. (1993) The respiratory burst oxidase and the molecular genetics of chronic granulomatous disease Crit. Rev. Clin. Lab. Sci. 30,329-369[Medline]
  10. 6
  11. Meischl, C., Roos, D. (1998) The molecular basis of chronic granulomatous disease Springer Semin. Immunopathol. 19,417-434[Medline]
  12. 7
  13. Parkos, C. A., Allen, R. A., Cochrane, C. G., Jesaitis, A. J. (1987) Purified cytochrome b from human granulocyte plasma membrane is composed of two polypeptides with relative molecular weights of 91,000 and 22,000 J. Clin. Investig. 80,732-742
  14. 8
  15. Segal, A. W. (1989) The electron transport chain of the microbicidal oxidase of phagocytic cells and its involvement in the molecular pathology of chronic granulomatous disease J. Clin. Investig. 83,1785-1793
  16. 9
  17. Leusen, J. H. W., Verhoeven, A. J., Roos, D. (1996) Interactions between the components of the human NADPH oxidase: intrigues in the phox family J. Lab. Clin. Med. 128,461-476[Medline]
  18. 10
  19. Nauseef, W. M. (1999) The NADPH-dependent oxidase of phagocytes Proc. Assoc. Am. Physicians 111,373-382[Medline]
  20. 11
  21. Kitsis, E., Weissmann, G. (1991) The role of the neutrophil in rheumatoid arthritis Clin. Orthop. Relat. Res. 265,63-72
  22. 12
  23. Zimmerman, B. J., Granger, D. N. (1994) Mechanisms of reperfusion injury Am. J. Med. Sci. 307,284-292[Medline]
  24. 13
  25. Boxer, L. A., Axtell, R., Suchard, S. (1990) The role of the neutrophil in inflammatory diseases of the lung Blood Cells 16,25-42[Medline]
  26. 14
  27. Freeman, J. L., Lambeth, J. D. (1996) NADPH oxidase activity is independent of p47phox in vitro J. Biol. Chem. 271,22578-22582[Abstract/Free Full Text]
  28. 15
  29. Koshkin, V., Lotan, O., Pick, E. (1996) The cytosolic component p47phox is not a sine qua non participant in the activation of NADPH oxidase but is required for optimal superoxide production J. Biol. Chem. 271,30326-30329[Abstract/Free Full Text]
  30. 16
  31. Paclet, M. H., Coleman, A. W., Vergnaud, S., Morel, F. (2000) p67-phox-Mediated NADPH oxidase assembly: imaging of cytochrome b558 liposomes by atomic force microscopy Biochemistry 39,9302-9310[Medline]
  32. 17
  33. Levy, R., Rotrosen, D., Nagauker, O., Leto, T. L., Malech, H. L. (1990) Induction of the respiratory burst in HL-60 cells. Correlation of function and protein expression J. Immunol. 145,2595-2601[Abstract]
  34. 18
  35. Miyamoto, D., Someya, A., Nunoi, H., Nagaoka, I., Yamashita, T. (1994) Analysis of the NADPH oxidase components during differentiation of HL-60 cells to eosinophilic lineage Biochim. Biophys. Acta 1224,11-16[Medline]
  36. 19
  37. Hua, J., Hasebe, T., Someya, A., Nakamura, S., Sugimoto, K., Nagaoka, I. (2000) Evaluation of the expression of NADPH oxidase components during maturation of HL-60 cells to neutrophil lineage J. Leukoc. Biol. 68,216-224[Abstract/Free Full Text]
  38. 20
  39. Catt, D., Hawkins, S., Roman, A., Luo, W., Skalnik, D. G. (1999) Overexpression of CCAAT displacement protein represses the promiscuously active proximal gp91phox promoter Blood 94,3151-3160[Abstract/Free Full Text]
  40. 21
  41. Luo, W., Skalnik, D. G. (1996) Interferon regulatory factor-2 directs transcription from the gp91phox promoter J. Biol. Chem. 271,23445-23451[Abstract/Free Full Text]
  42. 22
  43. Skalnik, D. G., Strauss, E. C., Orkin, S. H. (1991) CCAAT displacement protein as a repressor of the myelomonocytic-specific gp91-phox gene promoter J. Biol. Chem. 266,16736-16744[Abstract/Free Full Text]
  44. 23
  45. Eklund, E. A., Jalava, A., Kakar, R. (2000) Tyrosine phosphorylation of HoxA10 decreases DNA binding and transcriptional repression during interferon gamma-induced differentiation of myeloid leukemia cell lines J. Biol. Chem. 275,20117-20126[Abstract/Free Full Text]
  46. 24
  47. Eklund, E. A., Jalava, A., Kakar, R. (1998) PU.1, interferon regulatory factor 1, and interferon consensus sequence-binding protein cooperate to increase gp91(phox) expression J. Biol. Chem. 273,13957-13965[Abstract/Free Full Text]
  48. 25
  49. Voo, K. S., Skalnik, D. G. (1999) Elf-1 and PU.1 induce expression of gp91phox via a promoter element mutated in a subset of chronic granulomatous disease patients Blood 93,3512-3520[Abstract/Free Full Text]
  50. 26
  51. Eklund, E. A., Kakar, R. (1999) Recruitment of CREB-binding protein by PU.1, IFN-regulatory factor-1, and the IFN consensus sequence-binding protein is necessary for IFN-{gamma}-induced p67phox and gp91phox expression J. Immunol. 163,6095-6105[Abstract/Free Full Text]
  52. 27
  53. Li, S. L., Valente, A. J., Zhao, S. J., Clark, R. A. (1997) PU.1 is essential for p47(phox) promoter activity in myeloid cells J. Biol. Chem. 272,17802-17809[Abstract/Free Full Text]
  54. 28
  55. Jarstrand, C., Akerlund, B. (1994) Oxygen radical release by neutrophils of HIV-infected patients Chem. Biol. Interact. 91,141-146[Medline]
  56. 29
  57. Ueda, T., Ishikawa, Y., Takekoshi, N. (1999) Ultracytochemistry for detection of O2- in polymorphonuclear leukocytes using the tetrazolium method: comparison of various tetrazolium salts Acta Histochem. Cytochem. 32,351-357
  58. 30
  59. Himmelmann, A., Thevenin, C., Harrison, K., Kehrl, J. H. (1996) Analysis of the Bruton’s tyrosine kinase gene promoter reveals critical PU.1 and SP1 sites Blood 87,1036-1044[Abstract/Free Full Text]
  60. 31
  61. Kenney, R. T., Malech, H. L., Epstein, N. D., Roberts, R. L., Leto, T. L. (1993) Characterization of the p67phox gene: genomic organization and restriction fragment length polymorphism analysis for prenatal diagnosis in chronic granulomatous disease Blood 82,3739-3744[Abstract/Free Full Text]
  62. 32
  63. Chen, C. Y., Gherzi, R., Andersen, J. S., Gaietta, G., Jurchott, K., Royer, H. D., Mann, M., Karin, M. (2000) Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization during T-cell activation Genes Dev. 14,1236-1248[Abstract/Free Full Text]
  64. 33
  65. Derrigo, M., Cestelli, A., Savettieri, G., Di, L.I (2000) RNA-protein interactions in the control of stability and localization of messenger RNA Int. J. Mol. Med. 5,111-123[Medline]
  66. 34
  67. Fiaschi, T., Chiarugi, P., Veggi, D., Raugei, G., Ramponi, G. (2000) The inhibitory effect of the 5' untranslated region of muscle acylphosphatase mRNA on protein expression is relieved during cell differentiation FEBS Lett 473,42-46[Medline]
  68. 35
  69. Aso, T., Conaway, J. W., Conaway, R. C. (1995) The RNA polymerase II elongation complex FASEB J. 9,1419-1428[Abstract]
  70. 36
  71. Quandt, K., Frech, K., Karas, H., Wingender, E., Werner, T. (1995) MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data Nucleic Acids Res 23,4878-4884[Abstract/Free Full Text]
  72. 37
  73. Suzuki, S., Kumatori, A., Haagen, I. A., Fujii, Y., Sadat, M. A., Jun, H. L., Tsuji, Y., Roos, D., Nakamura, M. (1998) PU.1 as an essential activator for the expression of gp91phox gene in human peripheral neutrophils, monocytes, and B lymphocytes Proc. Natl. Acad. Sci. USA 95,6085-6090[Abstract/Free Full Text]
  74. 38
  75. Srikanth, S., Rado, T. A. (1998) PU.1 regulates the expression of the human neutrophil elastase gene Biochim. Biophys. Acta 1398,215-223[Medline]
  76. 39
  77. Li, S. L., Schlegel, W., Valente, A. J., Clark, R. A. (1999) Critical flanking sequences of PU.1 binding sites in myeloid-specific promoters J. Biol. Chem. 274,32453-32460[Abstract/Free Full Text]
  78. 40
  79. Hu, Y. F., Luscher, B., Admon, A., Mermod, N., Tjian, R. (1990) Transcription factor AP-4 contains multiple dimerization domains that regulate dimer specificity Genes Dev 4,1741-1752[Abstract/Free Full Text]
  80. 41
  81. Karin, M., Liu, Z., Zandi, E. (1997) AP-1 function and regulation Curr. Opin. Cell Biol. 9,240-246[Medline]
  82. 42
  83. Wisdom, R. (1999) AP-1: one switch for many signals Exp. Cell Res. 253,180-185[Medline]
  84. 43
  85. Mermod, N., Williams, T. J., Tjian, R. (1988) Enhancer binding factors AP-4 and AP-1 act in concert to activate SV40 late transcription in vitro Nature 332,557-561[Medline]
  86. 44
  87. Lopez-Rodriguez, C., Kluin-Nelemans, H. C., Corbi, A. L. (1996) AP-1 regulates the basal and developmentally induced transcription of the CD11c leukocyte integrin gene J. Immunol. 156,3780-3787[Abstract]
  88. 45
  89. Ryseck, R. P., Bravo, R. (1991) c-JUN, JUN B, and JUN D differ in their binding affinities to AP-1 and CRE consensus sequences: effect of FOS proteins Oncogene 6,533-542[Medline]
  90. 46
  91. Kobierski, L. A., Chu, H. M., Tan, Y., Comb, M. J. (1991) cAMP-dependent regulation of proenkephalin by JunD and JunB: positive and negative effects of AP-1 proteins Proc. Natl. Acad. Sci. U. S. A 88,10222-10226[Abstract/Free Full Text]
  92. 47
  93. Rossi, A., Jang, S. I., Ceci, R., Steinert, P. M., Markova, N. G. (1998) Effect of AP1 transcription factors on the regulation of transcription in normal human epidermal keratinocytes J. Invest Dermatol. 110,34-40[Medline]
  94. 48
  95. Drummond, I. A., Madden, S. L., Rohwer-Nutter, P., Bell, G. I., Sukhatme, V. P., Rauscher, F. J., III (1992) Repression of the insulin-like growth factor II gene by the Wilms tumor suppressor WT1 Science 257,674-678[Abstract/Free Full Text]
  96. 49
  97. TenHarmsel, A., Austin, R. J., Savenelli, N., Biggin, M. D. (1993) Cooperative binding at a distance by even-skipped protein correlates with repression and suggests a mechanism of silencing Mol. Cell Biol. 13,2742-2752[Abstract/Free Full Text]
  98. 50
  99. Anderson, K. L., Smith, K. A., Pio, F., Torbett, B. E., Maki, R. A. (1998) Neutrophils deficient in PU.1 do not terminally differentiate or become functionally competent Blood 92,1576-1585[Abstract/Free Full Text]
  100. 51
  101. Eklund, E. A., Skalnik, D. G. (1995) Characterization of a gp91-phox promoter element that is required for interferon gamma-induced transcription J. Biol. Chem. 270,8267-8273[Abstract/Free Full Text]
  102. 52
  103. Eklund, E. A., Luo, W., Skalnik, D. G. (1996) Characterization of three promoter elements and cognate DNA binding protein(s) necessary for IFN-gamma induction of gp91-phox transcription J. Immunol. 157,2418-2429[Abstract]
  104. 53
  105. Korzus, E., Torchia, J., Rose, D. W., Xu, L., Kurokawa, R., McInerney, E. M., Mullen, T. M., Glass, C. K., Rosenfeld, M. G. (1998) Transcription factor-specific requirements for coactivators and their acetyltransferase functions Science 279,703-707[Abstract/Free Full Text]
  106. 54
  107. Cheung, P., Tanner, K. G., Cheung, W. L., Sassone-Corsi, P., Denu, J. M., Allis, C. D. (2000) Synergistic coupling of histone H3 phosphorylation and acetylation in response to epidermal growth factor stimulation Mol. Cell 5,905-915[Medline]
  108. 55
  109. Gu, W., Roeder, R. G. (1997) Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain Cell 90,595-606[Medline]
  110. 56
  111. Yamamoto, H., Kihara-Negishi, F., Yamada, T., Hashimoto, Y., Oikawa, T. (1999) Physical and functional interactions between the transcription factor PU.1 and the coactivator CBP Oncogene 18,1495-1501[Medline]
  112. 57
  113. Bannister, A. J., Kouzarides, T. (1995) CBP-induced stimulation of c-Fos activity is abrogated by E1A EMBO J 14,4758-4762[Medline]
  114. 58
  115. Li, A. C., Guidez, F. R., Collier, J. G., Glass, C. K. (1998) The macrosialin promoter directs high levels of transcriptional activity in macrophages dependent on combinatorial interactions between PU.1 and c-Jun J. Biol. Chem. 273,5389-5399[Abstract/Free Full Text]
  116. 59
  117. Moulton, K. S., Semple, K., Wu, H., Glass, C. K. (1994) Cell-specific expression of the macrophage scavenger receptor gene is dependent on PU.1 and a composite AP-1/ets motif Mol. Cell Biol. 14,4408-4418[Abstract/Free Full Text]
  118. 60
  119. Behre, G., Whitmarsh, A. J., Coghlan, M. P., Hoang, T., Carpenter, C. L., Zhang, D. E., Davis, R. J., Tenen, D. G. (1999) c-Jun is a JNK-independent coactivator of the PU.1 transcription factor J. Biol. Chem. 274,4939-4946[Abstract/Free Full Text]
  120. 61
  121. Pongubala, J. M., Atchison, M. L. (1997) PU.1 can participate in an active enhancer complex without its transcriptional activation domain Proc. Natl. Acad. Sci. USA 94,127-132[Abstract/Free Full Text]
  122. 62
  123. Erman, B., Sen, R. (1996) Context dependent transactivation domains activate the immunoglobulin mu heavy chain gene enhancer EMBO J 15,4565-4575[Medline]
  124. 63
  125. Kerppola, T. K., Curran, T. (1991) DNA bending by Fos and Jun: the flexible hinge model Science 254,1210-1214[Abstract/Free Full Text]
  126. 64
  127. Kerppola, T. K., Curran, T. (1991) Fos-Jun heterodimers and Jun homodimers bend DNA in opposite orientations: implications for transcription factor cooperativity Cell 66,317-326[Medline]
  128. 65
  129. Rajaram, N., Kerppola, T. K. (1997) DNA bending by Fos-Jun and the orientation of heterodimer binding depend on the sequence of the AP-1 site EMBO J 16,2917-2925[Medline]
  130. 66
  131. Teshima, S., Tsunawaki, S., Rokutan, K. (1999) Helicobacter pylori lipopolysaccharide enhances the expression of NADPH oxidase components in cultured guinea pig gastric mucosal cells FEBS Lett 452,243-246[Medline]
  132. 67
  133. Green, S. P., Hamilton, J. A., Uhlinger, D. J., Phillips, W. A. (1994) Expression of p47-phox and p67-phox proteins in murine bone marrow-derived macrophages: enhancement by lipopolysaccharide and tumor necrosis factor alpha but not colony stimulating factor J. Leukoc. Biol. 55,530-535[Abstract]
  134. 68
  135. Schanke, J. T., Marcuzzi, A., Podzorski, R. P., Van Ness, B. (1994) An AP1 binding site upstream of the kappa immunoglobulin intron enhancer binds inducible factors and contributes to expression Nucleic Acids Res 22,5425-5432[Abstract/Free Full Text]
  136. 69
  137. Kim, Y. M., Im, J. Y., Han, S. H., Kang, H. S., Choi, I. (2000) IFN-gamma up-regulates IL-18 gene expression via IFN consensus sequence-binding protein and activator protein-1 elements in macrophages J. Immunol. 165,3198-3205[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Manea, S. A. Manea, A. V. Gafencu, M. Raicu, and M. Simionescu
AP-1-Dependent Transcriptional Regulation of NADPH Oxidase in Human Aortic Smooth Muscle Cells: Role of p22phox Subunit
Arterioscler Thromb Vasc Biol, May 1, 2008; 28(5): 878 - 885.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
W. Ni, Y. Zhan, H. He, E. Maynard, J. A. Balschi, and P. Oettgen
Ets-1 Is a Critical Transcriptional Regulator of Reactive Oxygen Species and p47phox Gene Expression in Response to Angiotensin II
Circ. Res., November 9, 2007; 101(10): 985 - 994.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
K. Bedard and K.-H. Krause
The NOX Family of ROS-Generating NADPH Oxidases: Physiology and Pathophysiology
Physiol Rev, January 1, 2007; 87(1): 245 - 313.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. A. Gauss, P. L. Bunger, T. C. Larson, C. J. Young, L. K. Nelson-Overton, D. W. Siemsen, and M. T. Quinn
Identification of a novel tumor necrosis factor {alpha}-responsive region in the NCF2 promoter
J. Leukoc. Biol., February 1, 2005; 77(2): 267 - 278.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. T. Quinn and K. A. Gauss
Structure and regulation of the neutrophil respiratory burst oxidase: comparison with nonphagocyte oxidases
J. Leukoc. Biol., October 1, 2004; 76(4): 760 - 781.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. L. Throm and M. J. Klemsz
PU.1 regulates glutathione peroxidase expression in neutrophils
J. Leukoc. Biol., July 1, 2003; 74(1): 111 - 117.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S.-L. Li, A. J. Valente, M. Qiang, W. Schlegel, M. Gamez, and R. A. Clark
Multiple PU.1 sites cooperate in the regulation of p40phox transcription during granulocytic differentiation of myeloid cells
Blood, May 29, 2002; 99(12): 4578 - 4587.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gauss, K. A.
Right arrow Articles by Quinn, M. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gauss, K. A.
Right arrow Articles by Quinn, M. T.