Veterans Affairs Medical Center and Rheumatology-Allergy/Immunology Division, Department of Medicine, University of California, San Diego
Correspondence: Robert Terkeltaub M.D., VASDHCS, 3350 La Jolla Village Drive, San Diego, CA 92161. E-mail: rterkeltaub{at}ucsd.edu
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B
and suppressed IB kinase (IKK) activation and NF-B binding to the
IL-8 promoter, signals that mediate MSU-induced IL-8 expression.
Transfection of the native Src inhibitor, C-terminal Src kinase (Csk),
also suppressed crystal-induced c-Src, ERK1/2, and IB
phosphorylation and IL-8 expression. We conclude that Src family
tyrosine kinase signaling plays a significant role in MSU
crystal-induced IL-8 expression via stimulation of ERK1/2 pathway and
NF-B activation.
Key Words: chemokine • inflammation • leukocyte • gout
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The potential for monosodium urate (MSU) crystals to induce inflammation in the joint reflects the capacity of the crystals to directly activate articular resident cells, including cells of the fibroblastic and monocyte/macrophage lineages [2 3 4 ]. Significantly, MSU crystals rapidly induce cultured monocytes to express the chemokine interleukin (IL)-8, a potent neutrophil chemoattractant that plays a central role in many forms of neutrophil-mediated inflammation [3 , 4 ]. IL-8 accounts for the majority of the neutrophil chemotactic activity released from adherent cultured human monocytes incubated with MSU crystals in vitro [4 ]. IL-8 also becomes abundant in the synovial fluid in acute gout [4 ]. Furthermore, IL-8 and closely related GRO chemokines that also are ligands of the IL-8 receptor CXCR2 play a critical role in neutrophil ingress in experimental models of acute gouty arthritis in vivo [2 , 3 ].
IL-8 expression is transcriptionally regulated [5
]. We
recently demonstrated that MSU crystals induce IL-8 promoter activation
and IL-8 expression in monocytic THP-1 cells via a mechanism mediated
by activation of the mitogen-activated protein kinase (MAPK) ERK1/2
signaling pathway and by activation of the transcription factors,
nuclear factor-B (NF-B) and AP-1 [6
]. With respect
to NF-B activation, the cytosol contains NF-B in the cytoplasm in
an inactive complex bound to the inhibitory protein IB
[7
8
9
]. Activation of the NF-B signaling cascade
results from phosphorylation and degradation of IB, allowing nuclear
translocation of NF-B complexes. The key regulatory step in this
pathway involves activation of the high molecular weight IB kinase
(IKK) complex. IKK contains two catalytic subunits, IKK and IKKß,
both of which are able to correctly phosphorylate IB
[7
8
9
].
The elucidation of upstream signals that inflammatory crystals use to
transduce NF-B activation, ERK1/2 activation, and IL-8 expression in
inflammatory cells is pertinent to understanding the basis for
crystal-induced inflammation. MSU crystals physically perturb the lipid
bilayer of the plasma membrane, bind and cross-link a variety of plasma
membrane proteins, and induce the rapid activation of a variety of
signaling pathways in phagocytes [1
,
10
11
12
13
14
15
16
17
18
19
20
21
]. Calcium pyrophosphate (CPPD) crystals, which
trigger pseudogout (bouts of IL-8 mediated neutrophil-dependent joint
inflammation similar to gout [22
]), also perturb the
plasma membrane and stimulate protein kinase signaling and IL-8
expression in phagocytes, and they do so in a manner comparable to that
induced by MSU crystals [6
, 14
,
15
, 17
]. It is interesting that protein
kinase signaling has been observed to be mechanistically distinct in
response to inflammatory crystals such as MSU and CPPD in leukocytes
when compared with signaling by soluble chemotactic factors
[13
, 15
, 21
]. In this regard,
MSU crystal binding to the leukocyte integrin CD11b/CD18 and the Fc
receptor CD16 modulate MSU crystal-induced phosphorylation of at least
one Src family nonreceptor protein tyrosine kinase (PTK), Lyn, in
neutrophils [20
]. Moreover, MSU and CPPD crystals also
rapidly induce activation of several other Src family PTKs in
phagocytes [14
, 15
]. Src family PTKs
selectively participate [23
, 24
] in the
relay of a variety of signals from the membrane to transducers of cell
activation and gene expression, including the ERK1/2 pathway, AP-1, and
NF-B [24
25
26
27
28
].
CPPD crystals also have been shown to induce activation in leukocytes of a serine/threonine kinase related to protein kinase C (PKC), the ribosomal protein S6 kinase p70 (p70s6k) [29 ]. Significantly, p70s6k can modulate cell growth and increase the translation of a family of mRNAs that encode essential components of the protein synthetic apparatus [30 , 31 ].
Our goal in this study was to further define the basic mechanism by
which MSU crystals transduce IL-8 expression in monocytic cells,
including ERK1/2 and NF-B activation. We focused particularly on the
potential roles of Src family PTK and p70s6k signaling in MSU
crystal-induced IL-8 expression, including possible mediation of MSU
crystal-induced ERK1/2 pathway and NF-B activation. To accomplish
our objectives, we used a previously validated approach in the human
monocytic leukemia cell line THP-1 [6
], a strategy
advantageous because of the use of phenotypically stable mononuclear
phagocytic cells with sufficient cell yield and the ability to be
transfected to achieve selective regulation of signal transduction for
our studies. Results presented below revealed that Src family
PTK-mediated signaling played a greater role than p70s6k signaling in
transducing IL-8 expression in response to MSU crystals. Our results
also implicated Src family PTK signaling in the ERK1/2 pathway and
NF-B activation in this process.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Antibodies
To study MAPK activation, ERK1/2 (Thr202/Tyr206), JNK
(Thr183/Tyr185), and p38 (Thr180/Tyr182) phosphospecific and
phosphorylation state-independent polyclonal antibodies were purchased
from New England Biolabs (Beverly, MA). The anti-phosphotyrosine
monoclonal antibody and the anti-Lyn, anti-Hck, anti-c-Src, and
anti-Fyn polyclonal antibodies were obtained from Santa Cruz
Biotechnology (Santa Cruz, CA). Phosphospecific antibody to c-Src
(Tyr418) was from Biosource International (Camarillo, CA). Antibodies
to tubulin were from Sigma Chemical Co. (St. Louis, MO). The
phosphospecific antibodies for p70s6k (Thr421/Ser424) and
phosphorylation state-independent p70s6k were from New England Biolabs,
as were phosphospecific (Ser32) and phosphorylation state-independent
antibodies to IB.
Cell culture, transfection of THP-1 cells
Human monocytic leukemia THP-1 cells were cultured as previously
described [6
]. In each experiment, cells were
serum-starved for 18 h, then MSU crystals (0.5 mg/ml) were added
to 5 x 105 cells/ml in serum-free RPMI 1640
containing 5 x 10-5 M 2-mercaptoethanol,
10 mM HEPES, 2 mM L-glutamine, 100 g/ml streptomycin, and
100 units/ml penicillin for the indicated times and with the indicated
inhibitors.
Where indicated, THP-1 cells were transfected with HA-tagged Csk in a pEFneo vector (from Dr. T. Hunter, Salk Institute, La Jolla, CA) or as a control, empty vector, using the Effectene reagent (Qiagen, Valencia, CA) according to the manufacturer’s protocol. Thirty-six hours after transfection, G418 Sulfate (Calbiochem) was used to select neomycin-resistant cell clones, after which single neomycin-resistant clones were selected by limiting dilution and used for further studies. Densitometric analyses to estimate the change in expression of Csk (and, where indicated, to estimate changes in mRNA expression) were performed as previously described [32 ].
Cell lysate, cytosolic, and nuclear protein preparation
For each preparation, 5 x 106 THP-1 cells were
harvested and then washed with cold phosphate-buffered saline (PBS).
Cell pellets were resuspended in RIPA buffer [50 mM
Tris•HCl, pH 7.4, 50 mM NaCl, 0.5% Nonident P-40
(NP-40), 1 mM ethylenediaminetetraacetate (EDTA), 1 mM NaF, 1 mM sodium
orthovanadate, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 1 g/ml
each pepstatin, aprotinin, and leupeptin] and incubated on ice for 15
min. After centrifugation at 14,000 rpm for 15 min, the supernatant
(cell lysate) was collected.
For preparation of cytosolic proteins, the cell pellets were resuspended in 50 µl buffer A [10 mM HEPES, pH 8.0; 1.5 mM MgCl2; 10 mM KCl; 0.5 mM dithiothreitol (DTT); 300 mM sucrose; 0.1% NP-40; 1 g/ml pepstatin, anti-pain, chymostatin, and aprotinin; 0.1 µg/ml leupeptin; and 0.5 mM PMSF] and incubated on ice for 5 min. After centrifugation, the supernatant (cytosolic protein) was collected, nuclear pellets were collected, and nuclear protein was isolated as previously described [6 ].
Western blotting, assessment of tyrosine phosphorylation, and
immunprecipitation
Aliquots of cell lysates or cytosolic protein (30 µg) were
separated by 10% sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) and then transferred onto nitrocellulose
membranes (Bio-Rad, Hercules, CA). After transfer, the membranes were
incubated in blocking buffer TBST (50 mM Tris•HCl, pH
7.6, 150 mM NaCl, 0.1% Tween 20) containing 5% nonfat dry milk for
1 h. The membranes were washed with TBST and then incubated in
TBST-containing primary antibody for 1 h. Washed membranes were
incubated with horseradish peroxidase (HRP)-conjugated secondary
antibody in blocking buffer for 1 h and then washed again followed
by detection of immunoreactive products by chemiluminescence with an
enhanced chemiluminescence system (ECL; Amersham Pharmacia, Piscataway,
NJ).
For the studies of tyrosine phosphorylation, cell lysates (aliquots of 30 µg protein) were prepared in RIPA buffer prior to analysis by SDS-PAGE and Western blotting. We used the anti-phosphotyrosine antibody pY99 (Santa Cruz Biotechnology). To immunoprecipitate specific signal transduction molecules, cell lysates (200 µg protein) were pre-cleared with mouse immunoglobulin G (IgG) or rabbit IgG before incubation with 2 µg mouse or rabbit antibody to the target of interest at 4°C overnight and then mixed with 20 µl Protein A/G Plus-Agarose beads (Santa Cruz Biotechnology; 1:1) at 4°C for 3 h. The beads then were washed four times with RIPA buffer and resuspended in 2x sample buffer (40 µl). After boiling for 5 min, the samples were separated on 10% SDS gels prior to Western blotting, which used antibodies as indicated.
Electrophoretic mobility shift assay (EMSA)
Aliquots of nuclear protein (5 µg) were incubated with
radiolabeled DNA probes (
105 cpm per ng) for 20 min at
room temperature in binding buffer [50 mM KCl, 40 mM HEPES, pH 7.9,
0.5 mM EDTA, 5% glycerol, 1 mg/ml bovine serum albumin (BSA), 0.1%
NP-40, 1 mM DTT, 0.5 mM PMSF] containing 1 µg poly dIdC. The DNA
probes were prepared by annealing complementary oligonucleotide
followed by fill-in with the Klenow fragment of DNA polymerase I in the
presence of (-32P) dATP or dCTP. Protein-DNA complexes
were separated from the free DNA probes by electrophoresis on a 6%
polyacrylamide gel. The sequences of the IL-8 promoter DNA probes were
IL-8 promoter NF-B site probe: 5' CGTGGAATTTCCT 3' and 3'
GCACCTTAAAGGA 5'; IL-8 promoter AP-1 site probe: 5'
CTAGTGATGAGTCAGCCGGATGATC 3' and 3' GATCACTACTCAGTCGGCCTACTAG 5'.
IKK assay
Aliquots of cell lysates (200 µg protein) were
immunoprecipitated using anti-IKK2-C-terminus-specific polyclonal
antibody (from Dr. G. Firestein, University of California, San Diego,
CA) in buffer C containing 20 mM Tris • HCl, pH 8.0, 250
mM NaCl, 0.05% NP-40, 3 mM EDTA, 3 mM EGTA, 30 µM
Na3VO4, 20 mM ß glycerophosphate, 5 mM NaF, 1
mM Benzamidine, 1 µg/ml pepstatin and aprotinin, and 0.1 µg/ml
leupeptin. The immunoprecipitated complexes were pulled down with
protein A/G Plus-Agarose beads. The beads were then washed three times
with buffer C, resuspended in 35 µl kinase buffer (containing 20 mM
HEPES, pH 7.5, 20 mM glycerophosphate, 1 mM MgCl2, 1 mM
MnCl2, 2 mM DTT, 30 µM
Na3VO4, 5 mM NaF, 1 mM Benzamidine, 1 µg/ml
pepstatin and aprotinin, 0.1 µg/ml leupeptin, 2 mM DTT, and 20 M ATP)
with addition of 2 µg substrate GST-IB and 5 µCi (1 µCi=37
GBq) [
-32P]ATP, followed by incubation at 30°C for
20 min. The samples were boiled in 2 x sample buffer and
separated on 10% SDS polyacrylamide gel. The activity of IKK was
visualized as the phosphorylation of GST-IB using
autoradiography.
Assessment of IL-8 expression
IL-8 protein in conditioned media was quantified by commercial
enzyme-linked immunosorbent assay (ELISA; Biosource International).
IL-8 transcription was evaluated by reverse transcriptase-polymerase
chain reaction (RT-PCR), as previously described in detail using
IL-8-specific primers and glyceraldehyde-3-phosphate dehydrogenase
(G3PDH) as the housekeeping gene control [6
].
Densitometric analysis of PCR products was performed as previously
described [32
].
Statistics
Where indicated, error bars represent SD.
Statistical analysis was performed using the Student’s
t-test (paired 2-sample testing for means) applied on
Microsoft Excel 5.0.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
 View larger version (62K): [in a new window] |
Figure 1. Stimulation of protein tyrosine phosphorylation by MSU crystals in
THP-1 cells. Cell lysates (30 µg) were prepared from THP-1 cells that
were stimulated with MSU crystals (0.5 mg/ml) for the times indicated
(A) or for 10 min with or without pretreatment (B) with increasing
doses (10, 25, 50 µM) of PP1, a selective inhibitor for the Src
family of protein tyrosine kinases PP1. (C) The comparative results for
MSU crystal-induced protein tyrosine phosphorylation in THP-1 cells
pretreated with rapamycin (10 µM), a selective inhibitor of p70s6k,
and PP1 (50 µM). The results presented (A–C) are for Western
blotting with anti-phosphotyrosine antibody (pY99) as described in
Materials and Methods.
|
 View larger version (18K): [in a new window] |
Figure 2. Induction of tyrosine phosphorylation of Src tyrosine kinases by MSU
crystals in THP-1 cells. Cell lysates (200 µg protein) were prepared
from THP-1 cells that were stimulated with MSU crystals (0.5 mg/ml) for
10 min with or without pretreatment with PP1 (50 µM). The lysates
were immunoprecipitated with anti-c-Src, anti-Hck, anti-Lyn, and
anti-Fyn antibodies, as indicated. The immunoprecipitates were then
subjected to SDS-PAGE for Western blotting with anti-phosphotyrosine
antibody. Unstimulated cells were used as the negative control.
Approximate molecular weight (in kDa) for each PTK: c-Src (60), Hck
(59/56), Lyn (56/53), and Fyn (59).
|
 View larger version (35K): [in a new window] |
Figure 3. Phosphorylation of the p85 and p70 isoforms of p70s6k induced by MSU
crystals in THP-1 cells. Results of a time course study (A) in which
cell lysates (30 µg) were prepared from THP-1 cells stimulated with
MSU crystals (0.5 mg/ml). Samples were subjected to SDS-PAGE and
Western blotting with phosphospecific p70s6k antibody (Thr421/Ser424)
and antibody to total p70s6k, as described in Materials and Methods.
Results of Western blotting for phosphorylation of p70s6k isoforms (B
and C, respectively) performed on lysates of THP-1 cells after 2 min of
stimulation by MSU crystals, with and without pretreatment with PP1 (50
µM) or rapamycin (10 µM).
|
 View larger version (44K): [in a new window] |
Figure 4. Effect of PP1 and rapamycin on MSU crystal-induced IL-8 expression in
THP-1 cells. THP-1 cells were pretreated for 1 h with 50 µM PP1
or 10 µM rapamycin and in PP1 dose-response studies, with 10–50 µM
PP1. Cells were then stimulated for 4 h with MSU crystals (0.5
mg/ml) where indicated. Total RNA was then prepared and subjected to
RT-PCR for IL-8 mRNA and the mRNA of the housekeeping gene control
G3PDH (A and B). The supernatants were collected for analysis of IL-8
production by ELISA (C and D). n = 3 each; *,
P < 0.05.
|
Src family PTK signaling in MSU crystal-induced IL-8 expression
Previously, we demonstrated that MSU crystal-induced IL-8
expression is dependent on ERK1/2 pathway activation and NF-B
activation in THP-1 cells [6
]. Thus, we first determined
if inhibition of Src family PTKs affected MSU crystal-induced ERK1/2
activation and NF-B activation. We observed that PP1 (25 µM)
markedly inhibited MSU crystal-induced phosphorylation of ERK1/2 in
THP-1 cells (Fig. 5
). Because PP1 has been shown to have weak inhibitory activity for
the p38 MAPK in vitro [34
], we concurrently assessed for
MSU crystal-induced phosphorylation of the MAPKs p38 and JNK. The PP1
pretreatment did not appear to significantly affect phosphorylation of
p38 or JNK in response to MSU crystals (Fig. 5) .
 View larger version (15K): [in a new window] |
Figure 5. MAPK-selective inhibitory effect of PP1 for MSU crystal-induced
phosphorylation of ERK1/2. Cell lysates (30 µg), prepared from THP-1
cells stimulated for 20 min with MSU crystals (0.5 mg/ml), were
subjected to SDS-PAGE and Western blotting with phosphospecific and
phosphorylation state-independent antibodies for the MAPKs ERK1/2, JNK,
and p38, as described in Materials and Methods. Where indicated, cells
were pretreated with PP1 (25 µM) for 1 h.
|
B
(Fig. 6 A
), and PP1 inhibited IKK activity (Fig. 6B)
. Furthermore, PP1
markedly inhibited MSU crystal-induced NF-B binding to an IL-8
promoter NF-B binding-site probe (Fig. 7
). This effect was selective, because PP1 did not
significantly alter MSU crystal-induced AP-1 binding to an IL-8
promoter AP-1 binding-site probe (Fig. 7) .
 View larger version (19K): [in a new window] |
Figure 6. Phosphorylation of IB (and confirmation of IKK activity) induced
by MSU crystals. Aliquots of cytosolic protein (30 µg) prepared from
THP-1 cells stimulated by MSU crystals (0.5 mg/ml) were subjected to
SDS-PAGE and Western blotting using phosphospecific antibodies for
IB, phosphorylation state-independent antibodies for IB,
and anti-tubulin antibodies as a control, as described in Materials and
Methods. Where indicated, cells were pretreated with PP1 (25 µM) as
described above (A). Cell lysates (200 µg) prepared from THP-1 cells
stimulated with MSU crystals (0.5 mg/ml; B) were immunoprecipitated
with antibody for IKK2. The immunoprecipitates were then subjected to
in vitro kinase assay, using GST-IB substrate as described in
Materials and Methods.
|
 View larger version (65K): [in a new window] |
Figure 7. Effects of PP1 on MSU crystal-induced NF-B and AP-1 binding to the
IL-8 promoter in THP-1 cells. Nuclear proteins were prepared from THP-1
cells stimulated for 2 h with MSU crystals (0.5 mg/ml) with or
without PP1 (50 µM) pretreatment, and EMSAs were carried out using
nuclear proteins (5 µg), IL-8 promoter NF-B, and AP-1 binding site
probes, as described in Materials and Methods. The lanes showing
NF-B binding were spliced from the same gel.
|
B phosphorylation
as well as significantly decreased IL-8 expression in response to MSU
crystals (Fig. 9
A-C
).
 View larger version (43K): [in a new window] |
Figure 8. Suppression of MSU crystal-induced c-Src phosphorylation in THP-1 cells
with augmented Csk expression. HA-tagged Csk was stably transfected
into THP-1 cells, as described in Materials and Methods. Cell lysates
(30 µg protein) from parental (untransfected), vector control
(transfected with empty vector), and the HA-Csk-expressing THP-1 cells
were subjected to SDS-PAGE and Western blotting using antibodies
specific for Csk and the HA tag, as described in Materials and Methods
(A). Cell lysates (30 µg protein) from aliquots of each of these
populations of cells [after stimulation with MSU crystals (0.5 mg/ml)
or buffer alone for 10 min] were subjected to SDS-PAGE and Western
blotting using phosphospecific antibody to c-Src (Y418) and
phosphorylation state-independent antibody to c-Src (B).
|
 View larger version (44K): [in a new window] |
Figure 9. Effects of increased Csk expression on signaling in induction of IL-8
expression in response to MSU crystals in THP-1 cells. Parental, vector
control, and HA-Csk-transfected THP-1 cells were stimulated with MSU
crystals for the time indicated. (A) Effect of Csk on phosphorylation
of ERK1/2 in THP-1 cells stimulated with MSU crystals. Aliquots of the
lysates (30 µg) of cells stimulated with MSU crystals for 20 min were
subjected to SDS-PAGE and Western blotting with antibodies for
phosphospecific ERK1/2 and total (phosphorylation state-independent)
ERK2. Unstimulated cells were used as the negative control. (B) Effect
of Csk on phosphorylation of IB in THP-1 cells stimulated with
MSU crystals. Cell lysates (30 µg) prepared from cells stimulated for
45 and 90 min with MSU crystals (0.5 mg/ml) were subjected to SDS-PAGE
and Western blotting with antibodies for phosphospecific and
phosphorylation state-independent IB. Unstimulated cells were
used as the negative control. (C) Effect of Csk on IL-8 production in
THP-1 cells stimulated with MSU crystals. IL-8 concentrations in the
conditioned media of cells, stimulated with MSU crystals [or
unstimulated cells (-)] for 4 h, were measured by ELISA.
n=3; *, P < 0.05.
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
 View larger version (17K): [in a new window] |
Figure 10. Proposed moel for regulation of MSU crystal-induced IL-8 expression by
Src family tyrosine kinase signaling in monocytic cells. The paradigm
presented is based on the results obtained in this study, which
indicated a greater role in MSU crystal-induced IL-8 expression of Src
family tyrosine kinase signaling in comparison to p70s6k signaling.
|
In this study, MSU crystal-stimulated threonine and serine phosphorylation of the 85-kDa isoform of p70s6k was suppressed by PP1, but MSU crystal-induced stimulation of the 70-kDa isoform of p70s6k was not affected by PP1. Results of studies in which MSU crystals were present with rapamycin-treated THP-1 cells over a limited period (4 h) suggested that the role of p70s6k activation in IL-8 expression was relatively limited. But the functions of p70s6k include regulation of cell growth and stimulation of an increase in the translation of related mRNAs that encode essential components of the protein synthetic apparatus [30 , 31 ]. It will be of interest to determine what role activation and subcellular localization of each isoform of p70s6k might play in more prolonged in vitro and in vivo inflammatory reactions stimulated by MSU crystals.
Our results indicated that Src family PTK signaling played a major role
in the transduction of MSU crystal-induced IL-8 expression in THP-1
cells. We also established a role for MSU crystal-induced Src family
PTK signaling in ERK1/2 and IKK activation. In these studies,
inhibitory effects of PP1 on MSU crystal-induced NF-B binding to the
IL-8 promoter and on phosphorylation of MAPK family members were
partially selective. In this regard, PP1 has been shown to weakly
inhibit p38 [34
], which bears a threonine at residue
338. Yet, we did not observe inhibitory effects of PP1 on p38
activation by MSU crystals in this study. However, PP1 can also
significantly inhibit the activity of at least one other cellular
protein kinase that bears a threonine at position 338, the non-Src
family PTK c-Abl [34
]. Thus, we directly tested a role
for Src family PTKs in MSU crystal-induced THP-1 cell activation by
investigating the effects of up-regulated expression of Csk, a native,
intracellular inhibitor of Src family PTKs. Csk selectively
phosphorylates a C-terminal tyrosine residue in c-Src and other PTKs of
the Src family, including Lyn and Fyn [35
,
36
].
Constitutive Csk expression was present in the THP-1 cell line used in
this study but was markedly up-regulated by stable transfection of
HA-tagged Csk. Under these conditions, elevated Csk expression was
associated with suppression of MSU crystal-induced IL-8 expression and
the phosphorylation of ERK1/2 and IB.
There were differences in the results of the pharmacologic and Csk transfection approaches to Src family PTK inhibition. In this context, we observed between 40% and 50% inhibition of MSU crystal-induced IL-8 production in THP-1 cells that stably expressed increased Csk. In contrast, PP1 suppressed MSU crystal-induced IL-8 expression by more than 80% in THP-1 cells. The differential inhibition of IL-8 expression achieved by the two approaches to Src family PTK inhibition in this study was likely multifactorial. First, the constitutive level of Csk may have been sufficient to dampen further effects of additional Csk expression via transfection. Second, the potential exists for distinct inhibitory profiles of PP1 and Csk for individual Src family PTKs and consequently for cell functions, a possibility whose pertinence is illustrated by the differential effects of Src family PTKs on Fc receptor-mediated phagocytosis in leukocytes [27 ]. Third, differential inhibitory effects of PP1 and Csk also could have potentially reflected nonspecific inhibitory effects of PP1 on cell activation. Fourth, it is conceivable that compensatory changes occurred in cell-functional properties in response to suppression of activation of Src family PTKs in THP-1 cells following stable transfection and selection for increased Csk expression.
Inhibition of MSU crystal-induced Src family PTK phosphorylation by PP1 or Csk was not absolute in this study, which leaves open the possibility that more effective inhibition of Src family PTK signaling might have produced greater suppression of MSU crystal-induced IL-8 expression in THP-1 cells. Study of MSU crystal-induced leukocyte activation, chemokine expression, and inflammation using cells genetically deficient in one or more of the Src family PTKs [25 ] might help to further elucidate the extent to which Src family PTK signaling is required for inflammatory responses to MSU crystals. However, functional redundancy within the Src PTK family might preserve a threshold of Src kinase activity sufficient to drive IL-8 expression in response to MSU crystals in genetically Src-deficient mice.
We speculate that even complete inhibition of signaling by the Src family PTKs may not be able to totally shut down MSU crystal-induced signaling that leads to IL-8 expression. In this regard, MSU crystals activate several signal-transduction pathways in phagocytes, including tyrosine phosphorylation of Syk tyrosine kinase and the Cbl proto-oncogene and activation of phosphatidylinositol-3 kinase [1 , 9 10 11 12 13 14 15 16 17 18 19 20 21 ]. One or more of these pathways might be used by activated Src family kinases as signaling partners to promote ERK1/2 and IKK activation in MSU crystal-induced cell activation, as appears to be the case with certain stimuli other than MSU crystals [37 38 39 ].
We conclude that Src family PTK signaling played a major role in signal
transduction that promoted IL-8 expression in monocytic lineage cells
activated by MSU crystals. The demonstration of a role of Src family
PTKs in MSU crystal-induced activation of IKK is significant in part
because IKK activation appears to play a major role in MSU
crystal-induced IL-8 expression (as observed in human fibroblasts;
unpublished observations) and in part because of potential effects on
survival and the expression of a variety of NF-B-regulated genes by
cells that encounter MSU crystals in the joint [1
,
40
]. Src family PTK-mediated activation of the ERK1/2
pathway also may modulate cell growth and viability in the course of
gouty inflammation [1
, 6
]. It will be of
interest to assess if MSU crystal-induced activation of the ERK1/2
pathway mediates IKK activation [41
].
Administration of pharmacologic Src family PTK inhibitors may have a therapeutic potential for refractory MSU crystal-induced joint inflammation. In addition, it should be noted that Csk is regulated not only at the level of gene expression [42 ] but also at the level of intramolecular and intermolecular binding interactions that regulate affinity for substrate and the efficacy of inhibitory activity for Src family PTKs [36 ]. Therefore, alteration in Csk expression and changes in Csk activity in cells in the joint space also have the potential to modulate the development and the variable and naturally self-limited course [1 ] of acute gouty arthritis.
Received March 8, 2001; revised August 6, 2001; accepted August 6, 2001.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B activity Annu. Rev. Immunol. 18,621-663[Medline]B is activated: the role of the IB kinase (IKK) complex Oncogene 18,6867-6874[Medline]B Trends Cell Biol 10,129-133[Medline]RIIIB (CD16) and CD11b in response to inflammatory microcrystals FASEB J 12,209-220This article has been cited by other articles:
 |
|
 |
|
  D. Li and A. W. Taylor Diminishment of {alpha}-MSH anti-inflammatory activity in MC1r siRNA-transfected RAW264.7 macrophages J. Leukoc. Biol., July 1, 2008; 84(1): 191 - 198. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Y. Eum, G. B. Rha, B. Hennig, and M. Toborek c-Src Is the Primary Signaling Mediator of Polychlorinated Biphenyl-Induced Interleukin-8 Expression in a Human Microvascular Endothelial Cell Line Toxicol. Sci., July 1, 2006; 92(1): 311 - 320. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Kang, H. J. Jung, K. Lee, and H. R. Kim Src Tyrosine Kinases Mediate Crystalline Silica-Induced NF-{kappa}B Activation through Tyrosine Phosphorylation of I{kappa}B-{alpha} and p65 NF-{kappa}B in RAW 264.7 Macrophages Toxicol. Sci., April 1, 2006; 90(2): 470 - 477. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. K. Choi, D. B. Mount, and A. M. Reginato Pathogenesis of Gout Ann Intern Med, October 4, 2005; 143(7): 499 - 516. [Full Text] [PDF]
|
|
|
|
 |
|
 N. Dalbeth and D. O. Haskard Mechanisms of inflammation in gout Rheumatology, September 1, 2005; 44(9): 1090 - 1096. [Full Text] [PDF]
|
|
|
|
 |
|
 R. Liu-Bryan, K. Pritzker, G. S. Firestein, and R. Terkeltaub TLR2 Signaling in Chondrocytes Drives Calcium Pyrophosphate Dihydrate and Monosodium Urate Crystal-Induced Nitric Oxide Generation J. Immunol., April 15, 2005; 174(8): 5016 - 5023. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jaramillo, M. Godbout, P. H. Naccache, and M. Olivier Signaling Events Involved in Macrophage Chemokine Expression in Response to Monosodium Urate Crystals J. Biol. Chem., December 10, 2004; 279(50): 52797 - 52805. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Ovrevik, M. Lag, P. Schwarze, and M. Refsnes p38 and Src-ERK1/2 Pathways Regulate Crystalline Silica-Induced Chemokine Release in Pulmonary Epithelial Cells Toxicol. Sci., October 1, 2004; 81(2): 480 - 490. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Ryckman, C. Gilbert, R. de Medicis, A. Lussier, K. Vandal, and P. A. Tessier Monosodium urate monohydrate crystals induce the release of the proinflammatory protein S100A8/A9 from neutrophils J. Leukoc. Biol., August 1, 2004; 76(2): 433 - 440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Yeh, N. M. Gharavi, J. Choi, X. Hsieh, E. Reed, K. P. Mouillesseaux, A. L. Cole, S. T. Reddy, and J. A. Berliner Oxidized Phospholipids Increase Interleukin 8 (IL-8) Synthesis by Activation of the c-src/Signal Transducers and Activators of Transcription (STAT)3 Pathway J. Biol. Chem., July 16, 2004; 279(29): 30175 - 30181. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
