Pepro Tech

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, R.
Right arrow Articles by Terkeltaub, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, R.
Right arrow Articles by Terkeltaub, R.
(Journal of Leukocyte Biology. 2001;70:961-968.)
© 2001 by Society for Leukocyte Biology

Src family protein tyrosine kinase signaling mediates monosodium urate crystal-induced IL-8 expression by monocytic THP-1 cells

Ru Liu, Karl Aupperle and Robert Terkeltaub

Veterans Affairs Medical Center and Rheumatology-Allergy/Immunology Division, Department of Medicine, University of California, San Diego

Correspondence: Robert Terkeltaub M.D., VASDHCS, 3350 La Jolla Village Drive, San Diego, CA 92161. E-mail: rterkeltaub{at}ucsd.edu


arrow
ABSTRACT
 
Neutrophil-dependent inflammation dependent on monosodium urate (MSU) crystal-induced IL-8 expression occurs in gout. MSU crystals activate phagocyte Src family tyrosine kinases and the serine/threonine kinase p70s6k. Thus, using monocytic THP-1 cells, we assessed the potential for Src family kinases and p70s6k to mediate MSU-induced IL-8 expression. MSU crystals induced phosphorylation of p70s6k and the Src kinases c-Src, Lyn, Hck, and Fyn. IL-8 expression was attenuated more by the Src kinase inhibitor PP1 than by the p70s6k inhibitor rapamycin. PP1 inhibited crystal-induced phosphorylation of ERK1/2 and I{kappa}B{alpha} and suppressed I{kappa}B kinase (IKK) activation and NF-{kappa}B binding to the IL-8 promoter, signals that mediate MSU-induced IL-8 expression. Transfection of the native Src inhibitor, C-terminal Src kinase (Csk), also suppressed crystal-induced c-Src, ERK1/2, and I{kappa}B{alpha} phosphorylation and IL-8 expression. We conclude that Src family tyrosine kinase signaling plays a significant role in MSU crystal-induced IL-8 expression via stimulation of ERK1/2 pathway and NF-{kappa}B activation.

Key Words: chemokine • inflammation • leukocyte • gout


arrow
INTRODUCTION
 
Acute gouty arthritis is a stereotypic example of a robust neutrophilic tissue inflammatory response [1 ]. In acute gout, intra-articular MSU crystals can trigger the ingress into the synovial joint of neutrophils, which are normally absent from the joint space and are required for the development of the full-blown acute inflammatory syndrome [1 , 2 ]. The perpetuation of joint inflammation in acute gout also appears to be mediated by crystal-induced activation of phagocytes attracted into the joint space [2 , 3 ].

The potential for monosodium urate (MSU) crystals to induce inflammation in the joint reflects the capacity of the crystals to directly activate articular resident cells, including cells of the fibroblastic and monocyte/macrophage lineages [2 3 4 ]. Significantly, MSU crystals rapidly induce cultured monocytes to express the chemokine interleukin (IL)-8, a potent neutrophil chemoattractant that plays a central role in many forms of neutrophil-mediated inflammation [3 , 4 ]. IL-8 accounts for the majority of the neutrophil chemotactic activity released from adherent cultured human monocytes incubated with MSU crystals in vitro [4 ]. IL-8 also becomes abundant in the synovial fluid in acute gout [4 ]. Furthermore, IL-8 and closely related GRO chemokines that also are ligands of the IL-8 receptor CXCR2 play a critical role in neutrophil ingress in experimental models of acute gouty arthritis in vivo [2 , 3 ].

IL-8 expression is transcriptionally regulated [5 ]. We recently demonstrated that MSU crystals induce IL-8 promoter activation and IL-8 expression in monocytic THP-1 cells via a mechanism mediated by activation of the mitogen-activated protein kinase (MAPK) ERK1/2 signaling pathway and by activation of the transcription factors, nuclear factor-{kappa}B (NF-{kappa}B) and AP-1 [6 ]. With respect to NF-{kappa}B activation, the cytosol contains NF-{kappa}B in the cytoplasm in an inactive complex bound to the inhibitory protein I{kappa}B [7 8 9 ]. Activation of the NF-{kappa}B signaling cascade results from phosphorylation and degradation of I{kappa}B, allowing nuclear translocation of NF-{kappa}B complexes. The key regulatory step in this pathway involves activation of the high molecular weight I{kappa}B kinase (IKK) complex. IKK contains two catalytic subunits, IKK{alpha} and IKKß, both of which are able to correctly phosphorylate I{kappa}B [7 8 9 ].

The elucidation of upstream signals that inflammatory crystals use to transduce NF-{kappa}B activation, ERK1/2 activation, and IL-8 expression in inflammatory cells is pertinent to understanding the basis for crystal-induced inflammation. MSU crystals physically perturb the lipid bilayer of the plasma membrane, bind and cross-link a variety of plasma membrane proteins, and induce the rapid activation of a variety of signaling pathways in phagocytes [1 , 10 11 12 13 14 15 16 17 18 19 20 21 ]. Calcium pyrophosphate (CPPD) crystals, which trigger pseudogout (bouts of IL-8 mediated neutrophil-dependent joint inflammation similar to gout [22 ]), also perturb the plasma membrane and stimulate protein kinase signaling and IL-8 expression in phagocytes, and they do so in a manner comparable to that induced by MSU crystals [6 , 14 , 15 , 17 ]. It is interesting that protein kinase signaling has been observed to be mechanistically distinct in response to inflammatory crystals such as MSU and CPPD in leukocytes when compared with signaling by soluble chemotactic factors [13 , 15 , 21 ]. In this regard, MSU crystal binding to the leukocyte integrin CD11b/CD18 and the Fc receptor CD16 modulate MSU crystal-induced phosphorylation of at least one Src family nonreceptor protein tyrosine kinase (PTK), Lyn, in neutrophils [20 ]. Moreover, MSU and CPPD crystals also rapidly induce activation of several other Src family PTKs in phagocytes [14 , 15 ]. Src family PTKs selectively participate [23 , 24 ] in the relay of a variety of signals from the membrane to transducers of cell activation and gene expression, including the ERK1/2 pathway, AP-1, and NF-{kappa}B [24 25 26 27 28 ].

CPPD crystals also have been shown to induce activation in leukocytes of a serine/threonine kinase related to protein kinase C (PKC), the ribosomal protein S6 kinase p70 (p70s6k) [29 ]. Significantly, p70s6k can modulate cell growth and increase the translation of a family of mRNAs that encode essential components of the protein synthetic apparatus [30 , 31 ].

Our goal in this study was to further define the basic mechanism by which MSU crystals transduce IL-8 expression in monocytic cells, including ERK1/2 and NF-{kappa}B activation. We focused particularly on the potential roles of Src family PTK and p70s6k signaling in MSU crystal-induced IL-8 expression, including possible mediation of MSU crystal-induced ERK1/2 pathway and NF-{kappa}B activation. To accomplish our objectives, we used a previously validated approach in the human monocytic leukemia cell line THP-1 [6 ], a strategy advantageous because of the use of phenotypically stable mononuclear phagocytic cells with sufficient cell yield and the ability to be transfected to achieve selective regulation of signal transduction for our studies. Results presented below revealed that Src family PTK-mediated signaling played a greater role than p70s6k signaling in transducing IL-8 expression in response to MSU crystals. Our results also implicated Src family PTK signaling in the ERK1/2 pathway and NF-{kappa}B activation in this process.


arrow
MATERIALS AND METHODS
 
Reagents
Sterile, pyrogen-free MSU crystals were prepared as previously described [5 ]. Rapamycin was obtained from Calbiochem (La Jolla, CA), and PP1 was purchased from Alexis Biochemicals (San Diego, CA).

Antibodies
To study MAPK activation, ERK1/2 (Thr202/Tyr206), JNK (Thr183/Tyr185), and p38 (Thr180/Tyr182) phosphospecific and phosphorylation state-independent polyclonal antibodies were purchased from New England Biolabs (Beverly, MA). The anti-phosphotyrosine monoclonal antibody and the anti-Lyn, anti-Hck, anti-c-Src, and anti-Fyn polyclonal antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Phosphospecific antibody to c-Src (Tyr418) was from Biosource International (Camarillo, CA). Antibodies to tubulin were from Sigma Chemical Co. (St. Louis, MO). The phosphospecific antibodies for p70s6k (Thr421/Ser424) and phosphorylation state-independent p70s6k were from New England Biolabs, as were phosphospecific (Ser32) and phosphorylation state-independent antibodies to I{kappa}B{alpha}.

Cell culture, transfection of THP-1 cells
Human monocytic leukemia THP-1 cells were cultured as previously described [6 ]. In each experiment, cells were serum-starved for 18 h, then MSU crystals (0.5 mg/ml) were added to 5 x 105 cells/ml in serum-free RPMI 1640 containing 5 x 10-5 M 2-mercaptoethanol, 10 mM HEPES, 2 mM L-glutamine, 100 g/ml streptomycin, and 100 units/ml penicillin for the indicated times and with the indicated inhibitors.

Where indicated, THP-1 cells were transfected with HA-tagged Csk in a pEFneo vector (from Dr. T. Hunter, Salk Institute, La Jolla, CA) or as a control, empty vector, using the Effectene reagent (Qiagen, Valencia, CA) according to the manufacturer’s protocol. Thirty-six hours after transfection, G418 Sulfate (Calbiochem) was used to select neomycin-resistant cell clones, after which single neomycin-resistant clones were selected by limiting dilution and used for further studies. Densitometric analyses to estimate the change in expression of Csk (and, where indicated, to estimate changes in mRNA expression) were performed as previously described [32 ].

Cell lysate, cytosolic, and nuclear protein preparation
For each preparation, 5 x 106 THP-1 cells were harvested and then washed with cold phosphate-buffered saline (PBS). Cell pellets were resuspended in RIPA buffer [50 mM TrisHCl, pH 7.4, 50 mM NaCl, 0.5% Nonident P-40 (NP-40), 1 mM ethylenediaminetetraacetate (EDTA), 1 mM NaF, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 1 g/ml each pepstatin, aprotinin, and leupeptin] and incubated on ice for 15 min. After centrifugation at 14,000 rpm for 15 min, the supernatant (cell lysate) was collected.

For preparation of cytosolic proteins, the cell pellets were resuspended in 50 µl buffer A [10 mM HEPES, pH 8.0; 1.5 mM MgCl2; 10 mM KCl; 0.5 mM dithiothreitol (DTT); 300 mM sucrose; 0.1% NP-40; 1 g/ml pepstatin, anti-pain, chymostatin, and aprotinin; 0.1 µg/ml leupeptin; and 0.5 mM PMSF] and incubated on ice for 5 min. After centrifugation, the supernatant (cytosolic protein) was collected, nuclear pellets were collected, and nuclear protein was isolated as previously described [6 ].

Western blotting, assessment of tyrosine phosphorylation, and immunprecipitation
Aliquots of cell lysates or cytosolic protein (30 µg) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto nitrocellulose membranes (Bio-Rad, Hercules, CA). After transfer, the membranes were incubated in blocking buffer TBST (50 mM TrisHCl, pH 7.6, 150 mM NaCl, 0.1% Tween 20) containing 5% nonfat dry milk for 1 h. The membranes were washed with TBST and then incubated in TBST-containing primary antibody for 1 h. Washed membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody in blocking buffer for 1 h and then washed again followed by detection of immunoreactive products by chemiluminescence with an enhanced chemiluminescence system (ECL; Amersham Pharmacia, Piscataway, NJ).

For the studies of tyrosine phosphorylation, cell lysates (aliquots of 30 µg protein) were prepared in RIPA buffer prior to analysis by SDS-PAGE and Western blotting. We used the anti-phosphotyrosine antibody pY99 (Santa Cruz Biotechnology). To immunoprecipitate specific signal transduction molecules, cell lysates (200 µg protein) were pre-cleared with mouse immunoglobulin G (IgG) or rabbit IgG before incubation with 2 µg mouse or rabbit antibody to the target of interest at 4°C overnight and then mixed with 20 µl Protein A/G Plus-Agarose beads (Santa Cruz Biotechnology; 1:1) at 4°C for 3 h. The beads then were washed four times with RIPA buffer and resuspended in 2x sample buffer (40 µl). After boiling for 5 min, the samples were separated on 10% SDS gels prior to Western blotting, which used antibodies as indicated.

Electrophoretic mobility shift assay (EMSA)
Aliquots of nuclear protein (5 µg) were incubated with radiolabeled DNA probes (~105 cpm per ng) for 20 min at room temperature in binding buffer [50 mM KCl, 40 mM HEPES, pH 7.9, 0.5 mM EDTA, 5% glycerol, 1 mg/ml bovine serum albumin (BSA), 0.1% NP-40, 1 mM DTT, 0.5 mM PMSF] containing 1 µg poly dIdC. The DNA probes were prepared by annealing complementary oligonucleotide followed by fill-in with the Klenow fragment of DNA polymerase I in the presence of ({alpha}-32P) dATP or dCTP. Protein-DNA complexes were separated from the free DNA probes by electrophoresis on a 6% polyacrylamide gel. The sequences of the IL-8 promoter DNA probes were IL-8 promoter NF-{kappa}B site probe: 5' CGTGGAATTTCCT 3' and 3' GCACCTTAAAGGA 5'; IL-8 promoter AP-1 site probe: 5' CTAGTGATGAGTCAGCCGGATGATC 3' and 3' GATCACTACTCAGTCGGCCTACTAG 5'.

IKK assay
Aliquots of cell lysates (200 µg protein) were immunoprecipitated using anti-IKK2-C-terminus-specific polyclonal antibody (from Dr. G. Firestein, University of California, San Diego, CA) in buffer C containing 20 mM Tris HCl, pH 8.0, 250 mM NaCl, 0.05% NP-40, 3 mM EDTA, 3 mM EGTA, 30 µM Na3VO4, 20 mM ß glycerophosphate, 5 mM NaF, 1 mM Benzamidine, 1 µg/ml pepstatin and aprotinin, and 0.1 µg/ml leupeptin. The immunoprecipitated complexes were pulled down with protein A/G Plus-Agarose beads. The beads were then washed three times with buffer C, resuspended in 35 µl kinase buffer (containing 20 mM HEPES, pH 7.5, 20 mM glycerophosphate, 1 mM MgCl2, 1 mM MnCl2, 2 mM DTT, 30 µM Na3VO4, 5 mM NaF, 1 mM Benzamidine, 1 µg/ml pepstatin and aprotinin, 0.1 µg/ml leupeptin, 2 mM DTT, and 20 M ATP) with addition of 2 µg substrate GST-I{kappa}B{alpha} and 5 µCi (1 µCi=37 GBq) [{gamma}-32P]ATP, followed by incubation at 30°C for 20 min. The samples were boiled in 2 x sample buffer and separated on 10% SDS polyacrylamide gel. The activity of IKK was visualized as the phosphorylation of GST-I{kappa}B{alpha} using autoradiography.

Assessment of IL-8 expression
IL-8 protein in conditioned media was quantified by commercial enzyme-linked immunosorbent assay (ELISA; Biosource International). IL-8 transcription was evaluated by reverse transcriptase-polymerase chain reaction (RT-PCR), as previously described in detail using IL-8-specific primers and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) as the housekeeping gene control [6 ]. Densitometric analysis of PCR products was performed as previously described [32 ].

Statistics
Where indicated, error bars represent SD. Statistical analysis was performed using the Student’s t-test (paired 2-sample testing for means) applied on Microsoft Excel 5.0.


arrow
RESULTS
 
MSU crystal-induced protein tyrosine phosphorylation and serine/threonine phosphorylation of p70s6k in THP-1 cells
We first determined the substrate pattern of tyrosine kinase phosphorylation in monocyte lineage cells stimulated by MSU crystals. To do so, we studied THP-1 cell lysates by SDS-PAGE and Western blotting using anti-phosphotyrosine antibody. Time course studies demonstrated that protein tyrosine phosphorylation induced by MSU crystals was rapid and broad with respect to substrates (Fig. 1 A ). The onset was detectable within 2 min, a further peak was reached by 10 min and a decline, by 20 min. The most prominent newly tyrosine-phosphorylated proteins were in the regions of 55–60 kDa, 70–80 kDa, and 110–130 kDa (Fig. 1A) . Pretreatment of THP-1 cells with the pyrazolopyrimidine PP1 (50 µM), a selective inhibitor of Src family PTKs [33 , 34 ], reduced tyrosine phosphorylation of most proteins in these size ranges in THP-1 cells (Fig. 1B) . Unlike PP1, rapamycin (10 µM), a selective inhibitor of p70s6k [31 ], did not appreciably alter the overall pattern of protein tyrosine phosphorylation induced by MSU crystals in THP-1 cells (Fig. 1C) .



View larger version (62K):
[in this window]
[in a new window]
 
Figure 1. Stimulation of protein tyrosine phosphorylation by MSU crystals in THP-1 cells. Cell lysates (30 µg) were prepared from THP-1 cells that were stimulated with MSU crystals (0.5 mg/ml) for the times indicated (A) or for 10 min with or without pretreatment (B) with increasing doses (10, 25, 50 µM) of PP1, a selective inhibitor for the Src family of protein tyrosine kinases PP1. (C) The comparative results for MSU crystal-induced protein tyrosine phosphorylation in THP-1 cells pretreated with rapamycin (10 µM), a selective inhibitor of p70s6k, and PP1 (50 µM). The results presented (A–C) are for Western blotting with anti-phosphotyrosine antibody (pY99) as described in Materials and Methods.

Immunoprecipitated Src family PTKs from MSU crystal-stimulated THP-1 cells were studied by SDS-PAGE and Western blotting using anti-phosphotyrosine antibody. We observed that Lyn, Hck, Fyn, and c-Src were among the tyrosine-phosphorylated proteins in the 55–60 kDa size range in cells stimulated by MSU crystals (Fig. 2 ). Furthermore, MSU crystal-stimulated tyrosine phosphorylation of each of these Src family PTKs was confirmed to be inhibited by pretreatment of THP-1 cells with PP1 (Fig. 2) .



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. Induction of tyrosine phosphorylation of Src tyrosine kinases by MSU crystals in THP-1 cells. Cell lysates (200 µg protein) were prepared from THP-1 cells that were stimulated with MSU crystals (0.5 mg/ml) for 10 min with or without pretreatment with PP1 (50 µM). The lysates were immunoprecipitated with anti-c-Src, anti-Hck, anti-Lyn, and anti-Fyn antibodies, as indicated. The immunoprecipitates were then subjected to SDS-PAGE for Western blotting with anti-phosphotyrosine antibody. Unstimulated cells were used as the negative control. Approximate molecular weight (in kDa) for each PTK: c-Src (60), Hck (59/56), Lyn (56/53), and Fyn (59).

Western blot analysis of cell lysates of THP-1 cells treated with MSU crystals (Fig. 3 A ) indicated that MSU crystals induced phosphorylation of the 70-kDa isoform and the nuclear translocation signal-containing 85-kDa isoform (termed p85s6k) of p70s6k [30 ]. The MSU crystal-induced phosphorylation occurred as early as within 2 min, was sustained at 30 min, and then declined to basal level at 60 min. PP1 inhibited phosphorylation of the p85 but not the p70 isoform of p70s6k (Fig. 3B) under conditions where rapamycin (10 µM) was confirmed to markedly suppress phosphorylation of both isoforms of p70s6k (Fig. 3C) . Under these same conditions, rapamycin (10 µM) moderately but significantly inhibited MSU crystal-induced IL-8 expression at the mRNA level (36% inhibition estimated by densitometry) and the protein level (17% inhibition; Fig. 4 ).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Phosphorylation of the p85 and p70 isoforms of p70s6k induced by MSU crystals in THP-1 cells. Results of a time course study (A) in which cell lysates (30 µg) were prepared from THP-1 cells stimulated with MSU crystals (0.5 mg/ml). Samples were subjected to SDS-PAGE and Western blotting with phosphospecific p70s6k antibody (Thr421/Ser424) and antibody to total p70s6k, as described in Materials and Methods. Results of Western blotting for phosphorylation of p70s6k isoforms (B and C, respectively) performed on lysates of THP-1 cells after 2 min of stimulation by MSU crystals, with and without pretreatment with PP1 (50 µM) or rapamycin (10 µM).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4. Effect of PP1 and rapamycin on MSU crystal-induced IL-8 expression in THP-1 cells. THP-1 cells were pretreated for 1 h with 50 µM PP1 or 10 µM rapamycin and in PP1 dose-response studies, with 10–50 µM PP1. Cells were then stimulated for 4 h with MSU crystals (0.5 mg/ml) where indicated. Total RNA was then prepared and subjected to RT-PCR for IL-8 mRNA and the mRNA of the housekeeping gene control G3PDH (A and B). The supernatants were collected for analysis of IL-8 production by ELISA (C and D). n = 3 each; *, P < 0.05.

PP1 also suppressed MSU crystal-induced IL-8 expression at the mRNA level and protein level in THP-1 cells (Fig. 4) . The effects of PP1 were observed to be dose-dependent between 10 and 50 µM, such that blunting of MSU crystal-induced IL-8 mRNA expression and suppression of MSU crystal-induced IL-8 production by more than 60% were observed in cells pretreated with 25 µM PP1 (Fig. 4) . Thus, we focused further study on how Src family PTK signaling helped to transduce MSU crystal-induced IL-8 expression in THP-1 cells.

Src family PTK signaling in MSU crystal-induced IL-8 expression
Previously, we demonstrated that MSU crystal-induced IL-8 expression is dependent on ERK1/2 pathway activation and NF-{kappa}B activation in THP-1 cells [6 ]. Thus, we first determined if inhibition of Src family PTKs affected MSU crystal-induced ERK1/2 activation and NF-{kappa}B activation. We observed that PP1 (25 µM) markedly inhibited MSU crystal-induced phosphorylation of ERK1/2 in THP-1 cells (Fig. 5 ). Because PP1 has been shown to have weak inhibitory activity for the p38 MAPK in vitro [34 ], we concurrently assessed for MSU crystal-induced phosphorylation of the MAPKs p38 and JNK. The PP1 pretreatment did not appear to significantly affect phosphorylation of p38 or JNK in response to MSU crystals (Fig. 5) .



View larger version (15K):
[in this window]
[in a new window]
 
Figure 5. MAPK-selective inhibitory effect of PP1 for MSU crystal-induced phosphorylation of ERK1/2. Cell lysates (30 µg), prepared from THP-1 cells stimulated for 20 min with MSU crystals (0.5 mg/ml), were subjected to SDS-PAGE and Western blotting with phosphospecific and phosphorylation state-independent antibodies for the MAPKs ERK1/2, JNK, and p38, as described in Materials and Methods. Where indicated, cells were pretreated with PP1 (25 µM) for 1 h.

PP1 also suppressed MSU crystal-induced phosphorylation of I{kappa}B{alpha} (Fig. 6 A ), and PP1 inhibited IKK activity (Fig. 6B) . Furthermore, PP1 markedly inhibited MSU crystal-induced NF-{kappa}B binding to an IL-8 promoter NF-{kappa}B binding-site probe (Fig. 7 ). This effect was selective, because PP1 did not significantly alter MSU crystal-induced AP-1 binding to an IL-8 promoter AP-1 binding-site probe (Fig. 7) .



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. Phosphorylation of I{kappa}B{alpha} (and confirmation of IKK activity) induced by MSU crystals. Aliquots of cytosolic protein (30 µg) prepared from THP-1 cells stimulated by MSU crystals (0.5 mg/ml) were subjected to SDS-PAGE and Western blotting using phosphospecific antibodies for I{kappa}B{alpha}, phosphorylation state-independent antibodies for I{kappa}B{alpha}, and anti-tubulin antibodies as a control, as described in Materials and Methods. Where indicated, cells were pretreated with PP1 (25 µM) as described above (A). Cell lysates (200 µg) prepared from THP-1 cells stimulated with MSU crystals (0.5 mg/ml; B) were immunoprecipitated with antibody for IKK2. The immunoprecipitates were then subjected to in vitro kinase assay, using GST-I{kappa}B{alpha} substrate as described in Materials and Methods.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 7. Effects of PP1 on MSU crystal-induced NF-{kappa}B and AP-1 binding to the IL-8 promoter in THP-1 cells. Nuclear proteins were prepared from THP-1 cells stimulated for 2 h with MSU crystals (0.5 mg/ml) with or without PP1 (50 µM) pretreatment, and EMSAs were carried out using nuclear proteins (5 µg), IL-8 promoter NF-{kappa}B, and AP-1 binding site probes, as described in Materials and Methods. The lanes showing NF-{kappa}B binding were spliced from the same gel.

Despite the fact that THP-1 cells constitutively expressed the native Src family kinase inhibitor Csk (Fig. 8 A ), the pharmacologic Src family kinase inhibitor PP1 significantly affected MSU crystal-induced signaling and IL-8 expression in our studies to this point. Thus, experiments to induce a "gain of function" of Csk were undertaken to test if enhancement of native Src family PTK inhibition would also suppress MSU crystal-induced IL-8 expression. First, we stably transfected HA-tagged Csk into THP-1 cells and achieved an estimated 65% rise in cellular Csk above baseline levels in the selected cell population, as assessed by Western blotting (Fig. 8A) and densitometric analysis (not shown). Next, using phosphospecific c-Src (Y418) antibody, we demonstrated suppression of MSU crystal-induced c-Src phosphorylation in the selected HA-Csk-expressing cells (Fig. 8B) . The stable Csk-overexpressing cells also demonstrated decreased ERK1/2 and I{kappa}B{alpha} phosphorylation as well as significantly decreased IL-8 expression in response to MSU crystals (Fig. 9 A-C ).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 8. Suppression of MSU crystal-induced c-Src phosphorylation in THP-1 cells with augmented Csk expression. HA-tagged Csk was stably transfected into THP-1 cells, as described in Materials and Methods. Cell lysates (30 µg protein) from parental (untransfected), vector control (transfected with empty vector), and the HA-Csk-expressing THP-1 cells were subjected to SDS-PAGE and Western blotting using antibodies specific for Csk and the HA tag, as described in Materials and Methods (A). Cell lysates (30 µg protein) from aliquots of each of these populations of cells [after stimulation with MSU crystals (0.5 mg/ml) or buffer alone for 10 min] were subjected to SDS-PAGE and Western blotting using phosphospecific antibody to c-Src (Y418) and phosphorylation state-independent antibody to c-Src (B).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 9. Effects of increased Csk expression on signaling in induction of IL-8 expression in response to MSU crystals in THP-1 cells. Parental, vector control, and HA-Csk-transfected THP-1 cells were stimulated with MSU crystals for the time indicated. (A) Effect of Csk on phosphorylation of ERK1/2 in THP-1 cells stimulated with MSU crystals. Aliquots of the lysates (30 µg) of cells stimulated with MSU crystals for 20 min were subjected to SDS-PAGE and Western blotting with antibodies for phosphospecific ERK1/2 and total (phosphorylation state-independent) ERK2. Unstimulated cells were used as the negative control. (B) Effect of Csk on phosphorylation of I{kappa}B{alpha} in THP-1 cells stimulated with MSU crystals. Cell lysates (30 µg) prepared from cells stimulated for 45 and 90 min with MSU crystals (0.5 mg/ml) were subjected to SDS-PAGE and Western blotting with antibodies for phosphospecific and phosphorylation state-independent I{kappa}B{alpha}. Unstimulated cells were used as the negative control. (C) Effect of Csk on IL-8 production in THP-1 cells stimulated with MSU crystals. IL-8 concentrations in the conditioned media of cells, stimulated with MSU crystals [or unstimulated cells (-)] for 4 h, were measured by ELISA. n=3; *, P < 0.05.


arrow
DISCUSSION
 
In this study, we dissected how MSU crystals transduce expression of IL-8 by monocytic THP-1 cells [6 ] (Fig. 10 ). We focused on the potential roles of p70s6k and of Src family PTKs. We studied the cells in the absence of serum to assess the effects of crystals without crystal-adsorbed receptor-binding proteins [1 ]. Previous studies using nonselective tyrosine kinase inhibitors had suggested that tyrosine kinase signaling mediated leukocyte activation by MSU crystals [19 , 20 ]. In this study, we first used the Src family-selective pharmacologic inhibitor PP1, which potently inhibits the function of cellular Src family kinases in a manner dependent on the presence of a threonine residue at position 338 of the predicted ATP binding site common to Src family PTKs [34 ]. Significantly, the threonine at position 338 is not shared by v-Src, which appears to account for weak inhibitory effects of PP1 on the oncogenic protein v-Src, which is otherwise nearly identical structurally to c-Src [34 ].



View larger version (17K):
[in this window]
[in a new window]
 
Figure 10. Proposed moel for regulation of MSU crystal-induced IL-8 expression by Src family tyrosine kinase signaling in monocytic cells. The paradigm presented is based on the results obtained in this study, which indicated a greater role in MSU crystal-induced IL-8 expression of Src family tyrosine kinase signaling in comparison to p70s6k signaling.

MSU crystals directly and rapidly induced PP1-sensitive tyrosine phosphorylation of not only the Src family PTK members c-Src, Lyn, Fyn, and Hck but also a variety of other, unidentified proteins. Further studies will be of interest to more broadly identify tyrosine-phosphorylated substrates for Src family PTKs and which of these proteins are stimulated by tyrosine phosphorylation to promote IL-8 expression in MSU crystal-stimulated cells.

In this study, MSU crystal-stimulated threonine and serine phosphorylation of the 85-kDa isoform of p70s6k was suppressed by PP1, but MSU crystal-induced stimulation of the 70-kDa isoform of p70s6k was not affected by PP1. Results of studies in which MSU crystals were present with rapamycin-treated THP-1 cells over a limited period (4 h) suggested that the role of p70s6k activation in IL-8 expression was relatively limited. But the functions of p70s6k include regulation of cell growth and stimulation of an increase in the translation of related mRNAs that encode essential components of the protein synthetic apparatus [30 , 31 ]. It will be of interest to determine what role activation and subcellular localization of each isoform of p70s6k might play in more prolonged in vitro and in vivo inflammatory reactions stimulated by MSU crystals.

Our results indicated that Src family PTK signaling played a major role in the transduction of MSU crystal-induced IL-8 expression in THP-1 cells. We also established a role for MSU crystal-induced Src family PTK signaling in ERK1/2 and IKK activation. In these studies, inhibitory effects of PP1 on MSU crystal-induced NF-{kappa}B binding to the IL-8 promoter and on phosphorylation of MAPK family members were partially selective. In this regard, PP1 has been shown to weakly inhibit p38 [34 ], which bears a threonine at residue 338. Yet, we did not observe inhibitory effects of PP1 on p38 activation by MSU crystals in this study. However, PP1 can also significantly inhibit the activity of at least one other cellular protein kinase that bears a threonine at position 338, the non-Src family PTK c-Abl [34 ]. Thus, we directly tested a role for Src family PTKs in MSU crystal-induced THP-1 cell activation by investigating the effects of up-regulated expression of Csk, a native, intracellular inhibitor of Src family PTKs. Csk selectively phosphorylates a C-terminal tyrosine residue in c-Src and other PTKs of the Src family, including Lyn and Fyn [35 , 36 ].

Constitutive Csk expression was present in the THP-1 cell line used in this study but was markedly up-regulated by stable transfection of HA-tagged Csk. Under these conditions, elevated Csk expression was associated with suppression of MSU crystal-induced IL-8 expression and the phosphorylation of ERK1/2 and I{kappa}B{alpha}.

There were differences in the results of the pharmacologic and Csk transfection approaches to Src family PTK inhibition. In this context, we observed between 40% and 50% inhibition of MSU crystal-induced IL-8 production in THP-1 cells that stably expressed increased Csk. In contrast, PP1 suppressed MSU crystal-induced IL-8 expression by more than 80% in THP-1 cells. The differential inhibition of IL-8 expression achieved by the two approaches to Src family PTK inhibition in this study was likely multifactorial. First, the constitutive level of Csk may have been sufficient to dampen further effects of additional Csk expression via transfection. Second, the potential exists for distinct inhibitory profiles of PP1 and Csk for individual Src family PTKs and consequently for cell functions, a possibility whose pertinence is illustrated by the differential effects of Src family PTKs on Fc receptor-mediated phagocytosis in leukocytes [27 ]. Third, differential inhibitory effects of PP1 and Csk also could have potentially reflected nonspecific inhibitory effects of PP1 on cell activation. Fourth, it is conceivable that compensatory changes occurred in cell-functional properties in response to suppression of activation of Src family PTKs in THP-1 cells following stable transfection and selection for increased Csk expression.

Inhibition of MSU crystal-induced Src family PTK phosphorylation by PP1 or Csk was not absolute in this study, which leaves open the possibility that more effective inhibition of Src family PTK signaling might have produced greater suppression of MSU crystal-induced IL-8 expression in THP-1 cells. Study of MSU crystal-induced leukocyte activation, chemokine expression, and inflammation using cells genetically deficient in one or more of the Src family PTKs [25 ] might help to further elucidate the extent to which Src family PTK signaling is required for inflammatory responses to MSU crystals. However, functional redundancy within the Src PTK family might preserve a threshold of Src kinase activity sufficient to drive IL-8 expression in response to MSU crystals in genetically Src-deficient mice.

We speculate that even complete inhibition of signaling by the Src family PTKs may not be able to totally shut down MSU crystal-induced signaling that leads to IL-8 expression. In this regard, MSU crystals activate several signal-transduction pathways in phagocytes, including tyrosine phosphorylation of Syk tyrosine kinase and the Cbl proto-oncogene and activation of phosphatidylinositol-3 kinase [1 , 9 10 11 12 13 14 15 16 17 18 19 20 21 ]. One or more of these pathways might be used by activated Src family kinases as signaling partners to promote ERK1/2 and IKK activation in MSU crystal-induced cell activation, as appears to be the case with certain stimuli other than MSU crystals [37 38 39 ].

We conclude that Src family PTK signaling played a major role in signal transduction that promoted IL-8 expression in monocytic lineage cells activated by MSU crystals. The demonstration of a role of Src family PTKs in MSU crystal-induced activation of IKK is significant in part because IKK activation appears to play a major role in MSU crystal-induced IL-8 expression (as observed in human fibroblasts; unpublished observations) and in part because of potential effects on survival and the expression of a variety of NF-{kappa}B-regulated genes by cells that encounter MSU crystals in the joint [1 , 40 ]. Src family PTK-mediated activation of the ERK1/2 pathway also may modulate cell growth and viability in the course of gouty inflammation [1 , 6 ]. It will be of interest to assess if MSU crystal-induced activation of the ERK1/2 pathway mediates IKK activation [41 ].

Administration of pharmacologic Src family PTK inhibitors may have a therapeutic potential for refractory MSU crystal-induced joint inflammation. In addition, it should be noted that Csk is regulated not only at the level of gene expression [42 ] but also at the level of intramolecular and intermolecular binding interactions that regulate affinity for substrate and the efficacy of inhibitory activity for Src family PTKs [36 ]. Therefore, alteration in Csk expression and changes in Csk activity in cells in the joint space also have the potential to modulate the development and the variable and naturally self-limited course [1 ] of acute gouty arthritis.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by a University of California, San Diego, MERF scholarship and Stein Institute Award (to R. L.), a Merit Review Award from the Department of Veterans Affairs (to R. T.), Arthritis Foundation Awards (to R. T. and K. A.), and NIH grant PO1AG07996 (to R. T.).

Received March 8, 2001; revised August 6, 2001; accepted August 6, 2001.


arrow
REFERENCES
 
    1
  1. Terkeltaub, R. (2001) Pathogenesis and treatment of crystal-induced inflammation Arthritis & Allied Conditions 14th ed.
  2. 2
  3. Terkeltaub, R., Baird, S., Sears, P., Santiago, R., Boisvert, W. (1998) The murine homolog of the interleukin-8 receptor CXCR2 is essential for the occurrence of neutrophilic inflammation in the air pouch model of acute urate-induced gouty synovitis Arthritis Rheum 41,900-909[Medline]
  4. 3
  5. Nishimura, A., Akahoshi, T., Takahashi, M., Takagishi, K., Itoman, M., Kondo, H., Takahashi, Y., Mukaida, N., Matsushima, K. (1997) Attenuation of monosodium urate crystal-induced arthritis in rabbits by a neutralizing antibody against interleukin-8 J. Leukoc. Biol. 62,444-449[Abstract]
  6. 4
  7. Terkeltaub, R., Zachariae, C., Santoro, D., Martin, J., Peveri, P., Matsushima, K. (1991) IL-8 is a potemtial mediator of crystal-induced inflammation Arthritis Rheum 34,894-903[Medline]
  8. 5
  9. Mukaida, N., Okamoto, S., Ishikawa, Y., Matsushima, K. (1994) Molecular mechanism of interleukin-8 gene expression J. Leukoc. Biol. 56,554-558[Abstract]
  10. 6
  11. Liu, R., O’Connell, M., Johnson, K., Pritzker, K., Macman, N., Terkeltaub, R. (2000) Extracellular signal-regulated kinase 1/extracellular signal-regulated kinase 2 mitogen-activated protein kinase signaling and activation of activator protein 1 and nuclear factor kappaB transcription factors play central roles in interleukin-8 expression stimulated by monosodium urate monohydrate and calcium pyrophosphate crystals in monocytic cells Arthritis Rheum 43,1145-1155[Medline]
  12. 7
  13. Karin, M., Ben-Neriah, Y. (2000) Phosphorylation meets ubiquitination: the control of NF-{kappa}B activity Annu. Rev. Immunol. 18,621-663[Medline]
  14. 8
  15. Karin, M. (1999) How NF-{kappa}B is activated: the role of the I{kappa}B kinase (IKK) complex Oncogene 18,6867-6874[Medline]
  16. 9
  17. Israel, A. (2000) The IKK complex: an integrator of all signals that activate NF-{kappa}B Trends Cell Biol 10,129-133[Medline]
  18. 10
  19. Terkeltaub, R., Sklar, L. A., Mueller, H. (1990) Neutrophil activation by inflammatory microcrystals of monosodium urate monohydrate utilizes pertussis toxin-insensitive and -sensitive pathways J. Immunol. 144,2719-2724[Abstract]
  20. 11
  21. Onello, E., Kaplan, A., Sklar, L., Terkeltaub, R. (1991) Mechanism of neutrophil activation by an unopsonized inflammatory particulate: urate crystals induce pertussis toxin-insensitive hydrolysis of phophatidylinositol 4,5-bisphosphate J. Immunol. 146,4289-4299[Abstract]
  22. 12
  23. Bomalaski, J. S., Baker, D. G., Brophy, L. M., Clark, M. A. (1990) Monosodium urate crystals stimulate phopholipase A2 enzyme activities and the synthesis of a phospholipase A2-activating protein J. Immunol. 145,3391-3397[Abstract]
  24. 13
  25. Marcil, J., Harbour, D., Houle, M. G., Naccache, P. H., Bourgoin, S. (1999) Monosodium urate crystal-stimulated phospholipase D in human neutrophil Biochem. J. 337,185-192
  26. 14
  27. Gaudry, M., Gilbert, C., Poubelle, P. E., Naccache, P. H. (1995) Activation of Lyn is a common element of stimulation of neutrophils by soluble and particulate agonists Blood 86,3567-3574[Abstract/Free Full Text]
  28. 15
  29. Roberge, C., Gaudry, M., Medicis, R., Lussier, A., Poubelle, P., Naccache, P. (1993) Crystal-induced neutrophil activation, IV. Specific inhibition of tyrosine phophorylation by colchicine J. Clin. Investig. 92,17223-17229
  30. 16
  31. Pouliot, M., James, M. J., McColl, S. R., Naccache, P. H., Cleland, L. G. (1998) Monosodium urate microcrystals induce cyclooxygenase-2 in human monocytes Blood 91,1769-1776[Abstract/Free Full Text]
  32. 17
  33. Jackson, J. K., Lauener, R., Duronio, V., Burt, H. M. (1997) The involvement of phosphatidylinositol 3-kinase in crystal induced human neutrophil activation J. Rheumatol. 24,341-348[Medline]
  34. 18
  35. Naccache, P. H., Gilbert, C., Barabe, F., Al-Shami, A., Mahana, W., Bourgoin, S. G. (1997) Agonist-specific tyrosine phosphorylation of Cbl in human neutrophils J. Leukoc. Biol. 62,901-910[Abstract]
  36. 19
  37. Burt, H. M., Jackson, J. K., Salari, H. (1994) Inhibition of crystal-induced neutrophil activation by a protein tyrosine kinase inhibitor J. Leukoc. Biol. 55,112-119[Abstract]
  38. 20
  39. Burt, H. M., Jackson, J. K., Dryden, P., Salari, H. (1993) Crystal-induced protein tyrosine phosphorylation in neutrophils and the effect of a tyrosine kinase inhibitor on neutrophil responses Mol. Pharmacol. 43,30-36[Abstract]
  40. 21
  41. Barabe, F., Gilbert, C., Liao, N., Bourgoin, S. G., Naccache, P. H. (1998) Crystal-induced neutrophil activation VI. Involvement of Fc{gamma}RIIIB (CD16) and CD11b in response to inflammatory microcrystals FASEB J 12,209-220[Abstract/Free Full Text]
  42. 22
  43. Miller, E. J., Brelsford, W. G. (1993) Interleukin 8: the major neutrophil chemotaxin in a case of pseudogout J. Rheumatol. 20,1250-1251[Medline]
  44. 23
  45. Cambien, B., Pomeranz, M., Millet, M-A., Rossi, B., Schmid-Alliana, A. (2001) Signal transduction involved in MCP-1-mediated monocytic transendothelial migration Blood 97,359-366[Abstract/Free Full Text]
  46. 24
  47. Lee, A. W., States, D. J. (2000) Both src-dependent and -independent mechanisms mediate phosphatidylinositol 3-kinase regulation of colony-stimulating factor 1-activated mitogen-activated protein kinases in myeloid progenitors Mol. Cell. Biol. 20,6779-6798[Abstract/Free Full Text]
  48. 25
  49. Fitzer-Attas, C. J., Lowry, M., Crowley, M. T., Finn, A. J., Meng, F., DeFranco, A. L., Lowell, C. A. (2000) Fcgamma receptor-mediated phagocytosis in macrophages lacking the Src family tyrosine kinases Hck, Fgr, and Lyn J. Exp. Med. 191,669-682[Abstract/Free Full Text]
  50. 26
  51. Mocsai, A., Jakus, Z., Vantus, T., Berton, G., Lowell, C. A., Ligeti, E. (2000) Kinase pathways in chemoattractant-induced degranulation of neutrophils: the role of p38 mitogen-activated protein kinase activated by Src family kinases J. Immunol. 164,4321-4331[Abstract/Free Full Text]
  52. 27
  53. Suzuki, T., Kono, H., Hirose, N., Okada, M., Yamamoto, T., Yamamoto, K., Honda, Z. (2000) Differential involvement of Src family kinases in Fc gamma receptor-mediated phagocytosis J. Immunol. 165,473-482[Abstract/Free Full Text]
  54. 28
  55. Fukai,, I., Hussey, R. E., Sunder-Plassmann, R., Reinherz, E. L. (2000) A critical role for p59fyn in CD2-based signal transduction Eur. J. Immunol. 30,3507-3515[Medline]
  56. 29
  57. Turdan, C., Jackson, J. K., Charlton, L., Pelech, S. L., Burt, H. M. (1998) Activation of S6 kinase in human neutrophils by calcium pryophosphate dihydrate crystals: protein kinase C-dependent and phosphatidylinositol 3-kinase-dependent pathways Biochem. J. 331,531-537
  58. 30
  59. Pullen, N., Thomas, G. (1997) The modular phosphorylation and activation of p70s6k FEBS Lett 410,78-82[Medline]
  60. 31
  61. Harold, B. J., Jefferies, H. B. J., Fumagalli, S., Dennis, P. B., Reinhard, C., Pearson, R. B., Thomas, G. (1997) Rapamycin suppresses 5'TOP mRNA translation through inhibition of p70s6k EMBO J 16,3693-3704[Medline]
  62. 32
  63. Goomer, R., Johnson, K., Burton, D., Amiel, D., Maris, T., Gujral, A., Deftos, L. J., Terkeltaub, R. (2000) The tetrabasic KKKK(147-150) motif determines intracrine regulatory effects of PthrP 1-173 on chondrocyte PPi metabolism and matrix synthesis Endocrinology 141,4613-4622[Abstract/Free Full Text]
  64. 33
  65. Hanke, J. H., Gardner, J. P., Dow, R. L., Changelian, P. S., Brissette, W. H., Weringer, E. J., Pollok, B. A., Connelly, P. A. (1996) Discovery of a novel, potent, and Src family-selective tyrosine kinase inhibitor J. Biol. Chem. 271,695-701[Abstract/Free Full Text]
  66. 34
  67. Liu, Y., Bishop, A., Witucki, L., Kraybill, B., Shimizu, E., Tsien, J., Ubersax, J., Blethrow, J., Morgan, D. O., Shokat, K. M. (1999) Structural basis for selective inhibition of Src family kinases by PP1 Chem. Biol. 6,671-678[Medline]
  68. 35
  69. Okada, M., Nada, S., Yamanashi, Y., Yamamoto, T., Nakagawa, H. (1991) CSK: a protein-tyrosine kinase involved in regulation of src family kinases J. Biol. Chem. 266,24249-24252[Abstract/Free Full Text]
  70. 36
  71. Sondhi, D., Cole, P. A. (1999) Domain interactions in protein tyrosine kinase Csk Biochemistry 38,11147-11155[Medline]
  72. 37
  73. Versteeg, H. H., Hoedemaeker, I., Diks, S. H., Stam, J. C., Spaargaren, M., van Bergen, E., Henegouwen, P. M., van Deventer, S. J., Peppelenbosch, M. P. (2000) Factor VIIa/tissue factor-induced signaling via activation of Src-like kinases, phosphatidylinositol 3-kinase, and Rac J. Biol. Chem. 275,28750-28756[Abstract/Free Full Text]
  74. 38
  75. Carey, K. D., Dillon, T. J., Schmitt, J. M., Baird, A. M., Holdorf, A. D., Straus, D. B., Shaw, A. S., Stork, P. J. S. (2000) CD28 and the tyrosine kinase Lck stimulate mitogen-activated protein kinase activity in T cells via inhibition of the small G protein Rap1 Mol. Cell. Biol. 20,8409-8419[Abstract/Free Full Text]
  76. 39
  77. Wooten, M. W., Seibenhener, M. L., Neidigh, K. B. W., Vandenplas, M. L. (2000) Mapping of atypical protein kinase C within the nerve growth factor signaling cascade: relationship to differentiation and survival of PC12 cells Mol. Cell. Biol. 20,4494-4504[Abstract/Free Full Text]
  78. 40
  79. Yamamoto, Y., Gaynor, R. B. (2001) Therapeutic potential of inhibition of the NF-kappaB pathway in the treatment of inflammation and cancer J. Clin. Investig. 107,135-142[Medline]
  80. 41
  81. Lee, F. S., Peters, R. T., Dang, L. C., Maniatis, T. (1998) MEKK1 activates both IkappaB kinase alpha and IkappaB kinase beta Proc. Natl. Acad. Sci. USA 95,9319-9324[Abstract/Free Full Text]
  82. 42
  83. Rolli-Derkinderen, M., Gaestel, M. (2000) p38/SAPK2-dependent gene expression in Jurkat T cells Biol. Chem. 381,193-198[Medline]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
D. Li and A. W. Taylor
Diminishment of {alpha}-MSH anti-inflammatory activity in MC1r siRNA-transfected RAW264.7 macrophages
J. Leukoc. Biol., July 1, 2008; 84(1): 191 - 198.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
S. Y. Eum, G. B. Rha, B. Hennig, and M. Toborek
c-Src Is the Primary Signaling Mediator of Polychlorinated Biphenyl-Induced Interleukin-8 Expression in a Human Microvascular Endothelial Cell Line
Toxicol. Sci., July 1, 2006; 92(1): 311 - 320.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. L. Kang, H. J. Jung, K. Lee, and H. R. Kim
Src Tyrosine Kinases Mediate Crystalline Silica-Induced NF-{kappa}B Activation through Tyrosine Phosphorylation of I{kappa}B-{alpha} and p65 NF-{kappa}B in RAW 264.7 Macrophages
Toxicol. Sci., April 1, 2006; 90(2): 470 - 477.
[Abstract] [Full Text] [PDF]


Home page
ANN INTERN MEDHome page
H. K. Choi, D. B. Mount, and A. M. Reginato
Pathogenesis of Gout
Ann Intern Med, October 4, 2005; 143(7): 499 - 516.
[Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
N. Dalbeth and D. O. Haskard
Mechanisms of inflammation in gout
Rheumatology, September 1, 2005; 44(9): 1090 - 1096.
[Full Text] [PDF]


Home page
J. Immunol.Home page
R. Liu-Bryan, K. Pritzker, G. S. Firestein, and R. Terkeltaub
TLR2 Signaling in Chondrocytes Drives Calcium Pyrophosphate Dihydrate and Monosodium Urate Crystal-Induced Nitric Oxide Generation
J. Immunol., April 15, 2005; 174(8): 5016 - 5023.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Jaramillo, M. Godbout, P. H. Naccache, and M. Olivier
Signaling Events Involved in Macrophage Chemokine Expression in Response to Monosodium Urate Crystals
J. Biol. Chem., December 10, 2004; 279(50): 52797 - 52805.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. Ovrevik, M. Lag, P. Schwarze, and M. Refsnes
p38 and Src-ERK1/2 Pathways Regulate Crystalline Silica-Induced Chemokine Release in Pulmonary Epithelial Cells
Toxicol. Sci., October 1, 2004; 81(2): 480 - 490.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. Ryckman, C. Gilbert, R. de Medicis, A. Lussier, K. Vandal, and P. A. Tessier
Monosodium urate monohydrate crystals induce the release of the proinflammatory protein S100A8/A9 from neutrophils
J. Leukoc. Biol., August 1, 2004; 76(2): 433 - 440.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Yeh, N. M. Gharavi, J. Choi, X. Hsieh, E. Reed, K. P. Mouillesseaux, A. L. Cole, S. T. Reddy, and J. A. Berliner
Oxidized Phospholipids Increase Interleukin 8 (IL-8) Synthesis by Activation of the c-src/Signal Transducers and Activators of Transcription (STAT)3 Pathway
J. Biol. Chem., July 16, 2004; 279(29): 30175 - 30181.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, R.
Right arrow Articles by Terkeltaub, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, R.
Right arrow Articles by Terkeltaub, R.