|
|
||||||||








* Facultad de Ciencias, Universidad Nacional Autónoma de México, and
Instituto Nacional de Enfermedades Respiratorias, México City, Mexico; and
DNAX Research Institute, Palo Alto, California 94304
Correspondence: Moisés Selman, M.D., Instituto Nacional de Enfermedades Respiratorias Tlalpan 4502, Col. Sección XVI México DF, CP 14080, Mexico. E-mail: mselman{at}conacyt.mx
| ABSTRACT |
|---|
|
|
|---|
Key Words: chemokines T lymphocytes cell trafficking allergic alveolitis
| INTRODUCTION |
|---|
|
|
|---|
30% of patients with subacute/chronic disease
[2
, 3
]. Although significant progress has
been made recently in our understanding of the pathology of HP
[3
4
5
6
], the mechanisms responsible for lymphocyte
recruitment in this ailment remain to be elucidated.
The chemokines are a superfamily of small, secreted proteins that
regulate leukocyte migration. Many new members of this superfamily have
been described in the last few years [7
], and several of
them have been associated with various diseases [8
,
9
]. Some chemokines have been reported to be expressed in
the lung, including interleukin (IL)-8/CXCL8, eotaxin/CCL11,
macrophage-inflammatory protein (MIP)-3
/CCL20, and DC-CK1/pulmonary-
and activation-related chemokine (PARC)/alternative macrophage
activation-associated CC-chemokine (AMAC)-1/CCL18 [9
].
It is interesting that there is even one reported chemokine that is
specifically expressed in the lung, lungkine/CXCL15
[10
]. For this report, we used the new chemokine
nomenclature recently proposed [7
].
Because HP is characterized by a strong accumulation of lymphocytes in the lung parenchyma, we hypothesized that some chemokines play a critical role in this disease. To test this hypothesis, we performed a comprehensive analysis of the expression of chemokines and their receptors in HP-affected lungs using real-time PCR via TaqMan [9 ], and the results were compared with those obtained from lungs affected by idiopathic pulmonary fibrosis (IPF), a prototype of a chronic interstitial lung disease [11 ], and control lungs. Our findings indicate that one chemokine in particular, CCL18, is associated with the development of HP. CCL18 was originally reported as a DC product [12 ], but it has subsequently been shown to be produced by monocytes induced by IL-4 [13 ]. Another report explains that CCL18 is strongly expressed in the lung and is therefore called PARC by its authors [14 ]. However, the role of this chemokine in human lung diseases remains unexplored. Here we report that increased CCL18 expression was associated with HP and might represent an important mediator in the pathology of this disease.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Diagnosis of IPF was supported by clinical, radiological, and functional findings and by computerized-tomographic (CT) scans; diagnosis was further corroborated by open-lung biopsy [2 , 11 , 15 ]. Morphologic diagnosis was based on typical microscopic findings of usual interstitial pneumonia, and criteria included presence of patchy, nonuniform alveolar septal fibrosis and interstitial inflammation, consisting mostly of mononuclear cells but also of neutrophils and eosinophils. A variable macrophage accumulation in the alveolar spaces and cuboidalization of the alveolar epithelium were observed. Analysis of the biopsies by polarized-light microscopy indicated that they lacked granulomas, vasculitis, microorganisms, and inorganic material.
Lung samples were taken from patients with HP and IPF by open-lung biopsy, usually 1 week after hospital admission. None of the patients had been treated with corticosteroids or immunosuppressive drugs at the time of biopsy. A portion of the biopsy was immediately frozen in liquid nitrogen for RNA extraction and subsequent expression analysis by TaqMan.
In the TaqMan analyses, control lung tissues included lung parenchyma from transplant donors (n=11) and autopsy donors (n=2) or normal adjacent tissue from patients undergoing surgery for lung cancer (n=5). The available clinical history of the 13 transplant and autopsy donors indicated no known infections or lung diseases. One donor had a history of smoking. In addition, two RNAs from normal lungs were purchased from Clontech (Palo Alto, CA). One was from an individual, and the other was from a pool of RNA from five individuals. These control lung RNAs were from 10 females and 9 males, with a mean age of 39.2 ± 22.1 years old, whose ages ranged from 14 months to 76 years. The Clontech pool had lung RNA from both males and females, ranging from 1440 years old. The control lung tissues for TaqMan analyses were obtained from the National Disease Research Interchange (Philadelphia, PA). For immunohistochemistry and in situ hybridization studies, control lung tissue samples were obtained from autopsies of patients who died from causes unrelated to lung disease (n=6; four males and two females; mean age, 43.2±11.1 years). Selected lung fragments that appeared macroscopically and microscopically normal were used.
Semiquantitative histological assessment
The amount of fibrosis present in lung samples was analyzed as
described elsewhere [2
, 3
]. Briefly, this
assessment was done on a slide, which was scanned completely in a
zigzag fashion, first at 25x and then at 100x magnification. In each
case, two slides, one stained with Massons trichrome and the other
with hematoxylin and eosin, were analyzed. We first determined the
percentage of the lung biopsy that had abnormal tissue, indicating
either inflammation or fibrosis or both (i.e., "extent of the
lesion") and then the percentage of the abnormal lung with fibrosis.
At a magnification of 25x, a slide comprised
810 fields, and the
extent of the lesion was evaluated. At a magnification of 100x, the
percentage of the lung with fibrosis was evaluated in an average of 40
fields and was expressed in multiples of 10. The assessment of fibrotic
changes included examination of young connective tissue rich in
fibroblasts and relatively poor in mature collagen as well as areas
with well-developed collagenization [16
].
BAL
BAL was performed using a standard technique
[17
]. Briefly, a fiber-optic bronchoscope was wedged in
two separate segments of the right middle lobe or lingula, and 300 mL
of normal saline were instilled in 50-mL aliquots, with an average
return of 6570%. The recovered BAL fluid was filtered through
sterile gauze, measured, and then centrifuged at 250 g for
10 min at 4°C. The cell pellet was resuspended in 1 mL of
phosphate-buffered saline, and an aliquot was used to evaluate the
total number of cells. Other aliquots were fixed in carbowax, and three
slides per sample were stained with hematoxylin and eosin, Giemsa, and
toluidine blue and used for differential cell count. The samples were
counted in a double-blind fashion.
RNA Preparation and real-time PCR
analysis (TaqMan)
RNA was extracted from lung tissue using guanidinium thiocyanate
and then centrifugation in cesium chloride or RNA STAT-60 (Tel-Test
Inc., Friendswood, TX). RNA quality was assessed with agarose gel
electrophoresis. Total RNA (5 µg) was treated with RNase-free DNase I
(Boehringer Mannheim, Indianapolis, IN) in First-Strand
synthesis buffer in the presence of RNasin (Promega, Madison, WI). The
samples were incubated for 20 min at 37°C, heated for 10 min at
70°C, and then immediately chilled on ice. A mixture of 2.5 µg of
oligo(dT)1215 (Boehringer Mannheim) and 250 ng of random
hexamers (Promega) were added to each sample. The samples were heated
to 70°C for 10 min, rapidly chilled on ice, and then briefly spun in
a microfuge (Gibco-BRL, Rockville, MD). cDNA was generated from the RNA
using Superscript II reverse transcriptase (Gibco-BRL) according to the
manufacturers instructions in a final volume of 100 µL.
Ten nanograms of cDNA per sample were analyzed for expression of CCL18 and ubiquitin on a GeneAmp 5700 sequence detector (PE Applied Biosystems, Foster City, CA) in a 25-µL reaction mixture. CCL18 was detected using primers and probe with TaqMan Universal Master Mix (all from PE Applied Biosystems) or primers alone and SYBR Green PCR Master Mix (PE Applied Biosystems). Ubiquitin was detected using 200 nM primers (forward: CACTTGGTCCTGCGCTTGA; reverse: CAATTGGGAATGCAACAACTTTAT) with SYBR Green PCR Master Mix. The data were analyzed to calculate a cycle threshold value (Ct) for each sample, with GeneAmp 5700 SDS software (PE Applied Biosystems). The samples were assayed three times for CCL18 and twice for ubiquitin, and the average of the readings for both genes was used to calculate the relative level of CCL18 mRNA in the tissue by the following formula: 2(Ct of ubiquitin - Ct of CCL18) x 10,000 for each sample. The means and standard errors were calculated for each group.
Monoclonal antibody production
Mouse anti-CCL18 monoclonal antibodies were produced in BALB/c
mice. Mice were immunized intraperitoneally with 25 µg of
CCL18/immunoglobulin (Ig) fusion protein emulsified in complete
Freunds adjuvant and then boosted every 23 weeks with 15 µg of
the same protein in incomplete Freunds adjuvant. The final boost was
performed with cleaved CCL18. Splenocytes from the immunized animals
were fused with mouse myeloma SP2/0. Hybridoma supernatants were
screened by enzyme-linked immunosorbent assay on cleaved CCL18-coated
plates and by Western blot analysis. Positive hybridomas were cloned
and rescreened.
Immunohistochemistry
Tissue sections were deparaffinized, rehydrated, and then
blocked with 3% H2O2 in methanol
for 30 min. Then antigen retrieval was performed with 10 mM citrate
buffer (pH 6.0) for 5 min in a microwave. Tissue sections were then
incubated with an antibody diluent with background-reducing components
(Dako, Carpinteria, CA) diluted 1/100 in phosphate-buffered saline for
45 min. Mouse anti-CCL18 monoclonal antibody was applied and incubated
at 4°C overnight. A secondary biotinylated anti-Ig and then
horseradish peroxidase-conjugated streptavidin (BioGenex, San Ramon,
CA) were used according to the manufacturers instructions.
3-Amino-9-ethyl-carbazole (BioGenex) in acetate buffer containing
0.05% H2O2 was used as substrate
[18
]. The sections were counterstained with hematoxylin.
The primary antibody was replaced by nonimmune serum for negative
control slides. To identify macrophages and DCs, parallel sections were
stained with HAM56 (7.5 µg/mL) and S-100 antibodies (11 µg/mL),
respectively (DAKO) [19
, 20
].
In situ hybridization
Riboprobes for in situ hybridization were generated from human
cDNA CCL18 cloned into pSPORT vector (Gibco-BRL). The plasmid was
linearized before translation with KpnI. An antisense 628-bp
fragment was transcribed with T7, and a sense 150-bp fragment was
transcribed with SP6 RNA polymerases. The transcription of sense and
antisense transcripts was performed with a labeling mixture containing
digoxigenin-UTP (Boehringer Mannheim, Germany).
In situ hybridization was performed on 4-µm sections as previously described [18 , 19 ]. Briefly, the sections mounted on siliconized slides were incubated in 0.001% proteinase K (Sigma Chemical Co., St. Louis, MO) for 20 min at 37°C. After acetylation with acetic anhydride, the sections were prehybridized for 1 h at 45°C in hybridization buffer and then were incubated with the digoxigenin-labeled probes at 45°C overnight. Some sections were hybridized with digoxigenin-labeled sense RNA probe. The tissues were incubated with a polyclonal sheep anti-digoxigenin antibody coupled with alkaline phosphatase (Boehringer Mannheim Co., Indianapolis, IN) for 1 h at room temperature. The color reaction was performed by incubation with fast red chromogen (Biomeda Corp., Foster City, CA). The sections were lightly counterstained with hematoxylin.
Statistical analysis of TaqMan data
Statistical analysis was performed with JMP version 3.2.2 (SAS
Institute, Inc., Cary, NC). The TaqMan data for the relative level of
CCL18 were log transformed, and a one-way analysis of variance was
performed. The log-transformed CCL18 level was used as the dependent
variable, and results from the disease group were used as the
independent variable. All pair-wise comparisons were made using
Students t-test. Correction for multiple comparisons was
accomplished using the Bonferroni method. The association between the
level of CCL18 and the percentage of lymphocytes present in the BAL
fluid was assessed with Pearsons correlation. Finally, to evaluate a
possible relationship between the CC18 level and the degree of lung
fibrosis described by the pathologist, a Spearman correlation was used.
| RESULTS |
|---|
|
|
|---|
|
/CCL3, MIP-1ß/CCL4, regulated on activation normal T
expressed and secreted/CCL5, MCP-3/CCL7, eotaxin/CCL11, thymus- and
activation-regulated chemokine/CCL17, DC-CK1/CCL18, MIP-3ß/CCL19,
MIP-3
/CCL20, monocyte chemoattractant protein 1/CCL22, very
important chemokine/CCL28, epithelial neutrophil-activating peptide
78/CXCL5, interleukin (IL)-8/CXCL8, lymphotactin/XCL1, CC chemokine
receptor (CCR) 3, CCR4, CCR5, CCR6, CCR7, CCR8, CXC chemokine receptor
(CXCR) 3, CXCR4, and CXCR6/STRL33. The level of each chemokine or chemokine receptor was calculated relative to the level of ubiquitin expressed in that sample. Of all the genes tested, CCL18 was the most strikingly and consistently increased chemokine in lung parenchyma from HP patients and, to a lesser degree, in IPF patients compared with the lung parenchyma from controls (2,085±392 vs. 1,023±110 and 466±94, respectively; P<0.01) (Fig. 1 ). In addition, CCL18 levels in the lungs of HP patients were significantly higher than those in the lungs of IPF patients (P<0.05).
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
CCL18 is known to act on some T cell subsets [11
12
13
],
and it is interesting that it exists in humans but not in mice. The
latter observation is explained by the finding that CCL18 likely arose
recently (in evolutionary terms) from the fusion of two MIP-1
/CCL3
genes [22
]. Despite its strong similarity to
MIP-1
/CCL3, CCL18 does not bind to CCR1, CCR3, or CCR5 [A.
Zlotnick, DNAX Research Institute, unpublished results].
Here we demonstrated that lungs from patients with subacute/chronic HP strongly overexpress CCL18 compared with normal lung parenchyma. It is interesting that the expression of this chemokine was more abundant during the subacute state of the disease, which is characterized by severe inflammation affecting mainly the alveolar walls. These patients also exhibited the highest numbers of lymphocytes in their BAL fluid, supporting the hypothesis that CCL18 expression in the lung might mediate the recruitment of T lymphocytes during the development of the inflammatory process.
Regarding the cellular source, CCL18 was produced primarily by interstitial macrophages and occasionally by DCs and reactive type 2 pneumocytes, as shown by in situ hybridization and immunochemistry. Cells expressing this chemokine were often observed close to clusters of lymphocytes.
Compared with CCL18 in control lungs, CCL18 was also up-regulated in lungs affected by IPF, although the levels were significantly lower than in HP-affected lungs. IPF is a lung disorder in which the inflammatory process is usually moderate and mainly involves lymphocytes, although plasma cells, neutrophils, and eosinophils might also be present [11 ]. Actually, CCL18 levels in lungs with IPF were similar to those found in chronic (fibrotic) HP. Therefore, it can be hypothesized that there is a strong up-regulation of CCL18 primarily in lung diseases characterized by an exuberant T-lymphocytic alveolitis. Supporting this view, there was a strong correlation between the levels of CCL18 in the lungs of HP and IPF patients and the percentage of lymphocytes in BAL fluid. In patients with chronic hepatitis C, this chemokine was also expressed by mononuclear cells, and it was found in association with naive T cell infiltration [21 ].
On the other hand, HP is believed to be a predominantly T-helper (Th) type 1 lung disorder [23 ], whereas IPF is a Th2 lung disorder [24 , 25 ]. In this context, our findings might also suggest that CCL18 has a role in regulating T cell function in the lung, because the correlation found between CCL18 and the number of lymphocytes in BAL fluid was positive in both groups of patients taken together. This concept is supported on one hand by the findings of Adema et al. [12 ], who determined that this chemokine is part of the immunostimulatory arsenal of DCs during the development of naive T cells into Th1 effector cells. On the other hand, results obtained by Kodelja et al. [13 ] suggest that CCL18 is induced, at least in vitro, in alternatively activated macrophages by Th2-associated cytokines.
Although the receptor for this chemokine is currently unknown [7 ], our results strongly suggest that lymphocytes found in the BAL fluid of HP patients are chemoattracted to the lung at least partially by CCL18. Thus, our data suggest that T cells in BAL fluid express the CCL18 receptor. Finally, these observations suggest that inhibitors of CCL18/receptor interaction might have therapeutic effects in patients with HP and perhaps in other interstitial lung diseases characterized by lymphocytic alveolitis such as sarcoidosis. Future experiments will explore in more detail the questions arising from these findings.
| ACKNOWLEDGEMENTS |
|---|
Received January 13, 2001; revised May 4, 2001; accepted May 11, 2001.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Pochetuhen, I. G. Luzina, V. Lockatell, J. Choi, N. W. Todd, and S. P. Atamas Complex Regulation of Pulmonary Inflammation and Fibrosis by CCL18 Am. J. Pathol., August 1, 2007; 171(2): 428 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wimmer, S. K. Khaldoyanidi, M. Judex, N. Serobyan, R. G. DiScipio, and I. U. Schraufstatter CCL18/PARC stimulates hematopoiesis in long-term bone marrow cultures indirectly through its effect on monocytes Blood, December 1, 2006; 108(12): 3722 - 3729. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. G. Luzina, K. Highsmith, K. Pochetuhen, N. Nacu, J. N. Rao, and S. P. Atamas PKC{alpha} Mediates CCL18-Stimulated Collagen Production in Pulmonary Fibroblasts Am. J. Respir. Cell Mol. Biol., September 1, 2006; 35(3): 298 - 305. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. d. Nadai, A.-S. Charbonnier, C. Chenivesse, S. Senechal, C. Fournier, J. Gilet, H. Vorng, Y. Chang, P. Gosset, B. Wallaert, et al. Involvement of CCL18 in Allergic Asthma J. Immunol., May 15, 2006; 176(10): 6286 - 6293. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kulka, N. Fukuishi, M. Rottem, Y. A. Mekori, and D. D. Metcalfe Mast cells, which interact with Escherichia coli, up-regulate genes associated with innate immunity and become less responsive to Fc{epsilon}RI-mediated activation J. Leukoc. Biol., February 1, 2006; 79(2): 339 - 350. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Schutyser, A. Richmond, and J. Van Damme Involvement of CC chemokine ligand 18 (CCL18) in normal and pathological processes J. Leukoc. Biol., July 1, 2005; 78(1): 14 - 26. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. van der Voort, M. Kramer, E. Lindhout, R. Torensma, D. Eleveld, A. W. T. van Lieshout, M. Looman, T. Ruers, T. R. D. J. Radstake, C. G. Figdor, et al. Novel monoclonal antibodies detect elevated levels of the chemokine CCL18/DC-CK1 in serum and body fluids in pathological conditions J. Leukoc. Biol., May 1, 2005; 77(5): 739 - 747. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gunther, C. Bello-Fernandez, T. Kopp, J. Kund, N. Carballido-Perrig, S. Hinteregger, S. Fassl, C. Schwarzler, G. Lametschwandtner, G. Stingl, et al. CCL18 Is Expressed in Atopic Dermatitis and Mediates Skin Homing of Human Memory T Cells J. Immunol., February 1, 2005; 174(3): 1723 - 1728. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pivarcsi, M. Gombert, M.-C. Dieu-Nosjean, A. Lauerma, R. Kubitza, S. Meller, J. Rieker, A. Muller, L. Da Cunha, A. Haahtela, et al. CC Chemokine Ligand 18, An Atopic Dermatitis-Associated and Dendritic Cell-Derived Chemokine, Is Regulated by Staphylococcal Products and Allergen Exposure J. Immunol., November 1, 2004; 173(9): 5810 - 5817. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. G. Boot, M. Verhoek, M. de Fost, C. E. M. Hollak, M. Maas, B. Bleijlevens, M. J. van Breemen, M. van Meurs, L. A. Boven, J. D. Laman, et al. Marked elevation of the chemokine CCL18/PARC in Gaucher disease: a novel surrogate marker for assessing therapeutic intervention Blood, January 1, 2004; 103(1): 33 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Atamas, I. G. Luzina, J. Choi, N. Tsymbalyuk, N. H. Carbonetti, I. S. Singh, M. Trojanowska, S. A. Jimenez, and B. White Pulmonary and Activation-Regulated Chemokine Stimulates Collagen Production in Lung Fibroblasts Am. J. Respir. Cell Mol. Biol., December 1, 2003; 29(6): 743 - 749. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Struyf, E. Schutyser, M. Gouwy, K. Gijsbers, P. Proost, Y. Benoit, G. Opdenakker, J. Van Damme, and G. Laureys PARC/CCL18 Is a Plasma CC Chemokine with Increased Levels in Childhood Acute Lymphoblastic Leukemia Am. J. Pathol., November 1, 2003; 163(5): 2065 - 2075. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Senechal, P. de Nadai, N. Ralainirina, A. Scherpereel, H. Vorng, P. Lassalle, A.-B. Tonnel, A. Tsicopoulos, and B. Wallaert Effect of Diesel on Chemokines and Chemokine Receptors Involved in Helper T Cell Type 1/Type 2 Recruitment in Patients with Asthma Am. J. Respir. Crit. Care Med., July 15, 2003; 168(2): 215 - 221. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vulcano, S. Struyf, P. Scapini, M. Cassatella, S. Bernasconi, R. Bonecchi, A. Calleri, G. Penna, L. Adorini, W. Luini, et al. Unique Regulation of CCL18 Production by Maturing Dendritic Cells J. Immunol., April 1, 2003; 170(7): 3843 - 3849. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Schutyser, S. Struyf, P. Proost, G. Opdenakker, G. Laureys, B. Verhasselt, L. Peperstraete, I. Van de Putte, A. Saccani, P. Allavena, et al. Identification of Biologically Active Chemokine Isoforms from Ascitic Fluid and Elevated Levels of CCL18/Pulmonary and Activation-regulated Chemokine in Ovarian Carcinoma J. Biol. Chem., June 28, 2002; 277(27): 24584 - 24593. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |