PeproTech Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cao, J.
Right arrow Articles by Cousins, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cao, J.
Right arrow Articles by Cousins, R. J.
(Journal of Leukocyte Biology. 2001;70:559-566.)
© 2001 by Society for Leukocyte Biology

Effects of intracellular zinc depletion on metallothionein and ZIP2 transporter expression and apoptosis

Jay Cao, Jeffrey A. Bobo, Juan P. Liuzzi and Robert J. Cousins

Food Science and Human Nutrition Department and Center for Nutritional Sciences, University of Florida, Gainesville 32611-0370

Correspondence: Robert J. Cousins, Food Science and Human Nutrition Department, University of Florida, 201 FSHN, P.O. Box 110370, Gainesville, FL 32611-0370. E-mail: cousins{at}ufl.edu


arrow
ABSTRACT
 
Zinc is critical for the functional and structural integrity of cells. We have used the monocytic cell line THP-1 as a model in which to study both the responsiveness of metallothionein and ZIP2 transporter expression to zinc depletion induced by the intracellular zinc chelator TPEN [N,N,N',N'-tetrakis(2-pyridylmethyl) ethylenediamine] and the extent of concomitant apoptosis. Metallothionein expression increased proportionately with the addition of zinc to the medium and decreased with TPEN treatment. When treated with TPEN, both THP-1 cells and human peripheral blood mononuclear cells exhibited marked decreases in cellular zinc concentrations and increases in ZIP2 mRNA expression. These results suggest that cells attempt to homeostatically adjust to zinc depletion. When THP-1 cells were treated with >5 µM TPEN, cell viability decreased, and cells entered the early stages of apoptosis. These data show that metallothionein and ZIP2 expression are inversely related during zinc depletion and that apoptosis is concurrent with these changes.

Key Words: monocytes • PCR • regulation


arrow
INTRODUCTION
 
Zinc is critical for the functional and structural integrity of cells and contributes to a number of important processes including gene expression [1 2 3 ]. Pools used to supply zinc for these functions are regulated by transporters at the plasma membrane as well as at intracellular sites [reviewed in ref. 4 ]. Studies with intact animals and cells have delineated a scenario of regulation including glucocorticoid hormones and those hormones mediated via cAMP- and cytokine-induced changes [1 ]. At the hepatic level, the glucocorticoid, insulin and glucagon produce transient dysregulation of zinc metabolism, which produces a decrease in plasma zinc concentrations. Similarly, immune-regulatory peptides, including interleukins 1 and 6, produce tissue-specific changes in zinc metabolism [1 ]. The liver is also a key component of this metabolic response to infection and oxidative stress. Expression of metallothionein (MT), a cysteine-rich zinc-binding protein, appears to be linked to these metabolic changes [5 6 ]. Much less is known about zinc metabolism and function in rapidly growing cells, including reticulocytes and stem cell precursors of leukocytes, or how MT and/or zinc transporters regulate zinc metabolism and function in such cells.

Our experiments with human subjects have shown that MT expression is altered when the dietary zinc supply is restricted or supplemented. Erythrocyte MT protein concentrations, as measured by enzyme-linked immunosorbent assay (ELISA), are reduced or elevated, after a lag period of ~6 days, when the dietary zinc intake of these subjects is correspondingly adjusted [7 8 ]. Similar changes have been observed in red blood cells from zinc-deficient rats [9 ]. MT protein concentrations in human leukocyte populations are lower than those in red blood cells [10 ]; however, MT mRNA levels can be measured by competitive reverse transcriptase (RT)-PCR [8 11 ]. This approach has allowed direct measurement of MT mRNA abundance in purified monocytes (the type of leukocyte that has the highest MT expression), as well as in peripheral blood mononuclear cells (PBMCs) and in leukocytes on dried blood spots obtained from zinc-supplemented subjects [11 ]. MT mRNA levels are quite sensitive to increases in zinc supplementation, suggesting that leukocytes, particularly monocytes, are an attractive model in which to examine zinc function. This interest is enhanced by observations that zinc alters the susceptibility of cells to apoptosis [12 ], which may relate to a key function of this micronutrient.

We have been using THP-1 cells, a human monocytic cell line, as a model for studying zinc metabolism and function in immune cells [13 ]. One goal of our experiments is to develop a method that allows the use of leukocytes for assessing dietary zinc status in populations. There is evidence to suggest that marginal zinc deficiency, which has no recognized laboratory method for quantitation, is more widespread than previously believed and produces morbidity worldwide [14 15 ]. As has been shown previously [8 11 ], induction of MT mRNA expression in monocytes is influenced by the zinc supply. Furthermore, recent evidence has shown that zinc transporter expression in rat intestine, liver, and kidney is also zinc dependent [16 ]. Comparable information on leukocyte zinc transporters has not been obtained. Consequently, a second goal of the current experiments with THP-1 cells is to examine the responsiveness of the zinc transporter ZIP2 to decreased zinc levels. ZIP2 is a member of the ZIP (ZRT1, IRT1-like) family of proteins. Data from transfection studies with human cells strongly suggest that ZIP2 is an importer and that it is zinc regulated [17 ].

The purposes of the present studies were (1) to examine in both THP-1 cells and human PBMCs the effects of intracellular zinc depletion induced by a zinc chelator on MT and ZIP2 expression, the extent of apoptosis as a function of zinc depletion, and the relationship of MT and ZIP2 expression to apoptosis and (2) to correlate intracellular zinc levels, using a new cell-permeating zinc probe, with the measurable changes in MT and ZIP2 levels and apoptosis.


arrow
MATERIALS AND METHODS
 
Cells, cell culture, and general methods
PBMCs were isolated from healthy nonsmoking men between the ages of 19 and 31 years. Some were given 15 mg of zinc per day, and others (controls) received an equivalent amount of sucrose as the placebo. The study was approved by the University of Florida Institutional Review Board, and informed consent was obtained from all subjects. PBMC (about 85% lymphocytes and 15% monocytes) were isolated using Histopaque 1.077® (Sigma Diagnostics, St. Louis, MO) as described previously [11 ]. The interface containing mononuclear cells was removed, and the cells were washed twice with phosphate-buffered saline (PBS) solution and centrifuged at 250 g for 10 min. THP-1 cells, a leukemic human monocytic cell line, were obtained from the American Type Culture Collection (Manassas, VA). The THP-1 cells and PBMCs were cultured in RPMI 1640 medium (Gibco BRL, Grand Island, NY) with 5 µmol of 2-mercaptoethanol, 1x antibiotic/antimycotic combination (Sigma), and 10% fetal bovine serum. The zinc concentration in the basal culture medium after the addition of the serum was about 3 µM. Exposures to TPEN [N,N,N',N'-tetrakis(2-pyridylmethyl) ethylenediamine; Sigma] with a Kd of 1015.58 M-1 and to zinc were accomplished by addition of appropriate volumes of stock solutions to the culture medium. Under these conditions, the chelation of ions other than zinc is very low [18 19 ]. Cells were treated with elevated levels of zinc and/or TPEN in the medium for 4 or 18 h. Cells were assayed for viability by trypan blue exclusion using microscopy at x10 magnification. Cells were washed with 1x PBS twice and then digested with 0.2% sodium dodecyl sulfate in 0.2 M NaOH, and the zinc content was measured by atomic absorption spectrophotometry. Cell protein concentrations were measured colorimetrically [20 ] with bovine serum albumin as the standard.

MT protein and mRNA
MT protein was measured by a sandwich ELISA using monoclonal anti-human (h) MT and chicken egg yolk anti-hMT antibodies as described previously [8 11 ]. Total RNA was extracted from THP-1 cells and human PBMCs using TRIzol reagent (Life Technologies, Rockville, MD) according to the manufacturer’s protocol. The level of MT mRNA was determined by a competitive RT-PCR [8 11 ]. Reverse transcription was performed, and specific PCR primers were used to simultaneously amplify both the competitor cDNA (180 bp) and the target MT cDNA (201-bp) template. The RT-PCR products were separated, and the MT mRNA concentration was calculated as described previously [11 ].

Human ZIP2 mRNA
Quantitative real-time PCR (Q-PCR) was used to measure the level of hZIP2 mRNA with a sequence detection system (5700; Applied Biosystems, Foster City, CA). The following oligonucleotide primers specific for hZIP2 (GenBank accession no. AF186081) and ß-actin (accession no. X00351) were used: for hZIP2, GTTTGCCCTGTTGGCTCTCA (sense) and ATCAATCTGGAACCATTTGAAGC (antisense); for ß-actin, GACAGGATGCAGAAGGAGATCACT (sense) and GCTCAGGAGGAGCAATGATCTT (antisense). These primers were designed using Primer Express software (Applied Biosystems). Reverse transcription and PCRs were performed in one tube with the following components: 0.25 µg of total RNA, 1x SYBR Green PCR master mix, 0.25 U/µL of MultiScribe RT, 0.4 U/µL of RNase inhibitor, and 300 nM forward and reverse primers in a 25-µL reaction volume. These reagents were purchased from Applied Biosystems. The following protocol was used for both ZIP2 and ß-actin mRNA: reverse transcription at 48°C for 30 min; AmpliTaq Gold activation at 95°C for 10 min; and PCR amplification with 40 cycles of denaturation at 95°C for 15 s and annealing/extension at 60°C for 1 min. The fluorescence of the double-stranded products accumulated was monitored in real time. To account for differences in reverse transcription efficiency, variability in the initial concentration in samples, and quality of the total RNA, the relative ZIP2 mRNA levels were normalized to levels of ß-actin mRNA. Dissociation curves for ZIP2 and ß-actin were checked to verify the specificity of amplification, since both specific and nonspecific products generate signal.

Flow-cytometric detection of Annexin V-fluorescein isothiocyanate (FITC)- and propidium iodide-stained THP-1 cells
Annexin V-FITC and propidium iodide binding were measured with a commercially available kit (PharMingen, San Diego, CA). THP-1 cells were washed twice with cold PBS and then resuspended in binding buffer [10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl2 (pH 7.4)] at a concentration of ~1 x 106 cells/mL. An aliquot (100 µL) was mixed with Annexin V-FITC and propidium iodide as directed by the manufacturer. The solution was incubated for 15 min at room temperature in the dark. After more binding buffer was added, the cells were analyzed by flow cytometry within 1 h. The following controls were used to set up compensation and quadrants for staining controls: unstained cells, cells stained with Annexin V-FITC alone, cells stained with propidium iodide alone, and cells stained with both indicators. Flow-cytometric analysis of 3 x 104 labeled cells per sample was performed using a Becton-Dickinson (Franklin Lakes, NJ) FACScan instrument. Cell size and granularity were assessed by measuring mean forward scattering and mean side scattering, respectively. Early apoptotic cells were defined as Annexin V positive and propidium iodide negative, whereas dead cells were propidium iodide positive.

Fluorescence microscopy
THP-1 cells were incubated in medium containing zinc and/or TPEN as described above. At various times, cells were collected and washed rapidly in HEPES-buffered saline; 1 g/L of glucose at pH 7.4 with 10 mM EDTA to remove extracellular nonspecifically (loosely) bound zinc. The cells were then washed in the same buffer but without EDTA. The cells were suspended in 5 µM Zinpyr-1 (kindly provided by Dr. Stephen J. Lippard), a di-2-picolylamine/fluorescein-based cell-permeating fluorescent probe (Kd=2.11 nM) specific for Zn2+ [21 ], and incubated at 37°C for 30 min. Then the cells were transferred to microscope slides, and a coverslip was added. Digital images were obtained with a Zeiss Axiovert S100 microscope equipped with a charge-coupled device camera.

Statistical analysis
Data were analyzed using Statistical Analysis System software (Windows version 6.12; SAS Institute, Cary, NC). Treatment means were compared using a least-squares means statement [22 ].


arrow
RESULTS
 
Addition of zinc to the culture medium for 18 h increased both MT mRNA and MT protein levels in THP-1 cells (Fig. 1 ). When compared with levels in control cells, MT mRNA levels were significantly higher (2.5-fold) at 20 µM zinc. This effect may be biphasic, because MT mRNA levels were highest (249 amol/µg of RNA; 19-fold above control) when cells were supplemented with 80 µM zinc. MT protein in THP-1 cells showed the same response as MT mRNA. Compared with levels in cells with no zinc supplementation, MT protein levels were significantly higher at >=40 µM zinc. At 80 µM zinc, MT protein levels were highest (2.0 mg/g of cell protein). This amount of MT represents approximately 2.1 µmol of zinc (141 µg)/g of cell protein.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. Induction of MT expression in THP-1 cells in response to different zinc concentrations (0–160 µM) in the medium. MT mRNA and MT protein were measured by competitive RT-PCR and ELISA, respectively. Cells were cultured for 18 h under these conditions. Values are means ± SD; n = 5. Values are significantly different from control cultures (no zinc added) at P < 0.05 (20 and 40 µM) or P < 0.01 (80 and 160 µM).

As a comparison with the response observed for cells in culture, MT mRNA levels in PBMC from human subjects given 15 mg of Zn/day were increased nearly threefold (from 7.8 to 21.3 amol/µg of RNA) by 4 days after the start of supplementation (Fig. 2 ). During the supplementation period, plasma zinc concentrations for these subjects increased from an initial concentration of 14.3 µM to a maximum of 16.5 µM. These observations show that, in contrast to findings for cells in culture, the environment in which mononuclear cells develop (bone marrow) or function (peripheral circulation) during dietary zinc supplementation provides a stimulus that is sufficient for MT induction and that cannot be accounted for by the difference in circulating plasma zinc concentrations. Moreover, it is of interest that the MT mRNA levels in PBMCs isolated directly from venous blood were of the same magnitude as those in THP-1 cells cultured in medium (Fig. 1) . MT protein levels were not measured in PBMCs as they had been in THP-1 cells, because, as observed previously [8 ], a standard blood sample does not provide a sufficient amount of monocyte protein to measure MT protein by our sandwich ELISA.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Plasma zinc concentrations (A) and MT mRNA levels (B) of PBMCs derived from human subjects as induced by oral zinc supplementation. A zinc supplement of 15 mg/day was given for up to 10 days. PBMCs were isolated from venous blood as described in Materials and Methods at days 0, 4, and 10 of supplementation. Values are means ± SD; n = 8. Asterisks indicate values significantly different from those at day 0 (**, P<0.01).

Chelation of intracellular zinc by TPEN was examined by atomic absorption spectrophotometry. TPEN treatment markedly decreased cellular zinc concentrations (Fig. 3 ). THP-1 cells cultured in control medium without added zinc had 150 µg of zinc/g of protein. Cellular zinc levels were only slightly decreased when cells were treated with 5 µM TPEN. Because the zinc concentration of nonsupplemented medium is about 3 µM, TPEN added to the medium at 5 µM would create a mildly zinc-deficient condition for the cells, considering that TPEN yields a zinc/chelate ratio of 1:1. When cells were treated with 10 or 30 µM TPEN, zinc concentrations in cells were significantly (P<0.01) decreased, to 37 or 24 µg/g of protein, respectively. Zinc concentrations in human PBMCs after TPEN treatment followed the same trend as those in THP-1 cells (Fig. 3) . Cellular zinc levels decreased significantly (P<0.05) when PBMCs were treated with 5 µM TPEN. Addition of 10 or 30 µM TPEN further decreased (P<0.01) zinc concentrations in these cells. Zinc concentrations in THP-1 cells and PBMC were slightly increased (P>0.05) when 20 µM zinc was added to the culture medium. When TPEN was added together with an equimolar amount of zinc, the zinc concentrations were the same as in control THP-1 cells.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Influence of the intracellular zinc chelator TPEN and/or zinc on zinc concentrations in THP-1 cells and PBMCs. Cells were cultured with various concentrations of TPEN and/or zinc for 18 h. Zinc was measured by atomic absorption. Values are means ± SD; n = 5. Asterisks indicate values significantly different from those for control cultures (no zinc added) at P < 0.05 (*) or P < 0.01 (**).

MT mRNA and MT protein levels decreased when THP-1 cells were treated with TPEN overnight (Fig. 4A ). The cells had progressively lower MT mRNA and MT protein levels when treated with 5 and 10 µM TPEN, respectively. These values were roughly the same at 10 and 30 µM TPEN. THP-1 cells treated with 20 µM zinc alone had significantly more MT mRNA and MT protein. However, when the cells were treated with 20 µM zinc and 20 µM TPEN together, these increases were not observed, because the levels were comparable to those in untreated control cells. These data show that intracellular zinc chelation produces a marked depletion of cellular MT, perhaps as the result of decreased synthesis and/or increased degradation associated with zinc loss.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Influence of the intracellular zinc chelator TPEN and/or zinc on induction of MT expression in THP-1 cells (A) or PBMCs (B). Cells were cultured with various concentrations of TPEN and/or zinc for 18 h. MT mRNA and MT protein were measured by competitive RT-PCR and ELISA, respectively. Values are means ± SD; n = 5. Asterisks indicate values significantly different from those for control cultures (no zinc added) at P < 0.05 (*) or P < 0.01 (**).

Compared with those in THP-1 cells, MT mRNA levels in cultured, untreated PBMC were much higher (136 amol/µg of RNA) (Fig. 4B ). As mentioned above, we have consistently observed that MT mRNA levels are comparable in THP-1 cells (Fig. 4A) and freshly prepared PBMC (Fig. 2) . However, when PBMCs were cultured overnight, the level of MT mRNA increased by an order of magnitude (Fig. 4B) . MT mRNA levels decreased markedly by the addition of 5 µM TPEN to the medium (P<0.05) and decreased even further (P<0.01) when cells were treated with 10 or 30 µM TPEN. Supplemental zinc (20 µM) added to the medium increased MT mRNA levels almost threefold. These results show that, although the magnitudes of zinc inducibility of the MT gene are comparable in THP-1 cells and PBMCs, in actual amounts, as measured by competitive RT-PCR, PBMCs obtained by venipuncture and cultured overnight with additional zinc had about 10-fold more MT mRNA.

The observed reduction in MT mRNA levels resulting from intracellular zinc depletion for both THP-1 cells and PBMCs (Fig. 4A and 4B) answers one of our experimental questions. Specifically, levels of this mRNA can be reduced by zinc restriction, suggesting that studies to examine a comparable reduction due to dietary zinc depletion in human subjects are possible.

Chelation of intracellular zinc caused the death of THP-1 cells and PBMCs as measured by trypan blue exclusion analysis (Table 1 ). No significant increase in cell death was found when these cells were treated with 5 µM TPEN or 20 µM zinc overnight. However, when the cells were treated with 10 or 30 µM TPEN overnight, at least half of the cells died. These chelator concentrations reduced total cellular zinc concentrations to 15–25% of those in untreated cells (Fig. 3) . When an equimolar concentration of zinc was supplemented with TPEN, there was no increase in cell death in treated versus untreated THP-1 cells. Data from both cell types collectively describe an exponential function in which cellular zinc concentration in micrograms per gram of protein (y) is related to percent cell viability (x) as follows: y = 11e0.026x (r=0.90) (Fig. 5 ). This relationship suggests that monocytes can lose one-third of their zinc content and maintain a viability of >90%, but viability decreases markedly if zinc loss is more extensive. Furthermore, zinc depletion by TPEN decreased cell size and granularity as observed in scatter diagrams obtained by flow cytometry (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 1. Cell Viability after Treatment with the Intracellular Zinc Chelator TPEN and/or Zinc



View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. Relationship of cell viability to cellular zinc concentration. The plot shows that the cellular zinc concentration (y) from Figure 3 is related to percent cell viability (x) from Table 1 as the following exponential function: 11e0.026x.

To begin an appraisal of homeostatic responses of cells to zinc depletion, we measured ZIP2 expression in response to TPEN. Q-PCR analyses of ZIP2 mRNA levels were normalized to ß-actin mRNA levels. Amplification plots of PCR products as a function of cycle number in real time are shown in Figure 6A for total RNA derived from control and TPEN-treated cells. As shown in Figure 6B , relative expression of the ZIP2 gene in THP-1 cells and PBMCs was markedly up-regulated (as much as 4.1-fold) in response to intracellular zinc depletion by TPEN. For both cell populations, ZIP2 mRNA levels in cells treated with 5 or 10 µM TPEN were significantly greater (P<0.05) than those in control cells. These data provide the first evidence that cells attempt to correct an intracellular zinc deficit by increasing the expression of a transporter that may lead to increased zinc uptake. Our interpretation of this finding is that cells are attempting to rescue themselves from the cellular zinc deficit caused by TPEN.



View larger version (73K):
[in this window]
[in a new window]
 
Figure 6. Influence of zinc depletion of THP-1 cells and PBMCs using the intracellular zinc chelator TPEN on expression of the zinc transporter ZIP2. Cells were cultured for 18 h with 5 or 10 µM TPEN as described in the legends to Figures 3 and 4 . Total RNA was reverse transcribed, and the cDNA amplified by Q-PCR was detected with SYBR green fluorescence chemistry. (A) Representative amplification plots using primers for ß-actin and hZIP2 in which the intensity of the fluorescence product, RN, is plotted versus the PCR cycle number. Plots labeled "control" and "TPEN" represent ZIP2 cDNA fluorescence. (B) PCR values were normalized to those produced with primers for ß-actin. Values are means ± SD; n = 5. Asterisks indicate values significantly different from those for control cultures (no zinc added) at P < 0.05 (*) or P < 0.01 (**).

The considerable decrease in cell viability (Table 1) observed 18 h after TPEN was added to the cultures suggests that cell death could result from apoptotic or necrotic changes. The concomitant changes in MT and ZIP2 expression suggest that the cells respond to zinc depletion in ways that are predictable, based on the current literature. To relate these zinc-related aspects of cell function to cell viability, we used indicators of apoptotic changes to further explore the effects of intracellular zinc chelators on monocytes.

Annexin V and propidium iodide staining were used to identify cells in early stages of apoptosis. For this series of experiments, TPEN was added for a period of 4 h rather than 18 h, as used in the experiments above, to preclude the marked cell death found with the longer treatment. Flow-cytometric data with Annexin V showed <2% apoptotic cells with culture medium alone (Fig. 7A ). Cells treated with either 5 or 20 µM zinc showed no difference in apoptosis from cells treated with culture medium alone. However, when cells were treated with 10 or 30 µM TPEN for 4 h, 9.2% or 37.0%, respectively, became apoptotic based on the display of phosphotidylserine on the exterior of the cell membrane, as shown by the increase in Annexin V fluorescence. The proportion of cells that were dead (propidium iodide positive) remained relatively constant (upper right quadrants of inserts, Fig. 7A 7B 7C 7D 7E ).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 7. Flow-cytometric analysis and sorting of THP-1 cells stained with Annexin V and propidium iodide (PI) to assess the effect of the intracellular zinc chelator TPEN on early apoptosis. Insets show PI staining versus Annexin V staining. As shown in the panel A inset, untreated cells were primarily Annexin V and PI negative, indicating that they were viable and not undergoing apoptosis. Cells that are Annexin V positive and PI negative, as shown in the panel D inset, represent early apoptotic cells. The proportion of cells that were already dead (Annexin V and PI positive) was relatively low but was not influenced by either TPEN or zinc.

Early signs of apoptosis (Fig. 7) produced in 4 h with 10 µM TPEN were concurrent with a reduction in MT mRNA levels and an increase in ZIP2 mRNA levels (Fig. 8 ). These data demonstrate that both genes are very sensitive to zinc, such that transcription rates may change after the chelator has been added to the cell cultures. In contrast, intracellular zinc depletion with 5 µM TPEN for 4 h yielded a more modest reduction in MT mRNA levels than that observed with 10 µM TPEN (Fig. 8) ; moreover, the cells were not apoptotic, no changes in ZIP2 expression were observed, and measurable cellular zinc levels were not detected. This observation suggests that MT could play a role in the initial stages of apoptosis and in preventing cell apoptosis in a mildly zinc-deficient state.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 8. Influence of zinc depletion of THP-1 cells by the intracellular zinc chelator TPEN on expression of MT mRNA and zinc transporter ZIP2 mRNA. Cells were cultured for 4 h with 5 or 10 µM TPEN as described in the legends to Figures 3 and 4 . MT mRNA was measured as described in the legend to Figure 4 . Zip2 mRNA was measured as described in the legend to Figure 6 .

To explore the intracellular sites that are sensitive to TPEN, we used the cell-permeating fluorescent probe Zinpyr-1 to estimate intracellular free Zn2+ concentrations. As shown in Figure 9 , the major reduction in fluorescence with intracellular zinc depletion appeared to be from both the nuclei and the cytoplasm. Note the more defined nuclei of the zinc-depleted cells (Fig. 9A vs. B). Zinc-depleted cells also appeared larger than control cells, but this was likely produced by the irregular shape of the cell membrane in zinc-depleted cells. Fluorescence from zinc-treated cells was greater (Fig. 9C) than that from control cells, indicating greater zinc uptake and retention. This suggests that TPEN depletes Zn2+ from both a cytoplasmic free-zinc pool and a nuclear pool and that zinc loss from these pools leads to initiation of apoptosis.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 9. Subcellular distribution of labile Zn in THP-1 cells with either no treatment (A), 10 µM TPEN (B), or 20 µM Zn (C). THP-1 cells were cultured with either TPEN or Zn for 4 h. Cells were washed first with HEPES-buffered saline with EDTA and then with HEPES-buffered saline without EDTA. Zinpyr-1 (5 µM) was added for 30 min to visualize intracellular labile Zn.


arrow
DISCUSSION
 
Previously, we showed that zinc supplementation at 50 mg/day increased monocyte MT expression based on both ELISA, by which the protein was measured, and a competitive PCR method, by which MT mRNA levels were measured [8 ]. We extended the use of these techniques to include PBMCs and leukocytes on dried blood spots as the sources of the target mRNA in an experiment where subjects were given 15 mg of Zn/day [11 ]. Those experiments showed that both sources of RNA produced MT mRNA increases as a result of zinc supplementation at the 15-mg/day intake level. That level is similar to the new recommended daily allowance for zinc and is far below the new upper limit for zinc intake by humans; for adult males, these amounts are 11 and 40 mg/day, respectively [23 ].

The response of monocyte MT mRNA levels to dietary zinc depletion has yet to be examined in human subjects. The results presented here, however, clearly demonstrate by multiple lines of evidence, using THP-1 cells as a model for circulating monocytes in human subjects, that cellular zinc deprivation by TPEN chelation evokes many responses, including a reduction in MT mRNA levels. These experiments suggest that dietary zinc deprivation will produce similar changes in MT mRNA levels and therefore the response might be of value for zinc status assessment of human population groups. Furthermore, the responsiveness of ZIP2 expression to zinc deprivation of monocytes and the tendency of these cells to enter the early stages of apoptosis in response to such deprivation suggest that these parameters might also serve as biological markers for human zinc deficiency. Currently there is no clearly defined biochemical indicator for zinc status assessment [14 23 ], yet marginal zinc deficiency continues to be found in many parts of the world [15 ].

We found that MT mRNA levels in THP-1 cells were negatively related to the concentration of TPEN in the medium and also to the concentration of zinc in the cells. Furthermore, depletion of intracellular zinc by TPEN caused MT protein levels in cells to decrease. The latter observation suggests that MT protein turnover is a likely result of zinc depletion. Others have shown that MT in monocytes and lymphocytes is induced by zinc in culture [24 25 26 ]. The present studies are the first to show concurrent decreases in both mRNA and MT protein levels. The regulation of MT transcription by zinc is mediated by metal-responsive elements located upstream of the MT gene. Therefore, the decrease in MT expression from TPEN treatment in this study could be caused by the removal of zinc by the chelator from the zinc-binding transcription factor MTF1 [5 27 ], leading to decreased DNA-binding activity and decreased MT gene transcription. Alternatively, increased apo-MT formation produced upon the removal of zinc by the chelator would lead to MT degradation [6 ].

TPEN has been used in cells in experiments prior to ours that focused on zinc depletion as an inducer of apoptosis [18 19 28 ]. In those reports, DNA fragmentation or caspase activity was used as the index of apoptosis. These events occur at later and earlier stages in the apoptotic cell death process, respectively. Nevertheless, those results demonstrate that zinc depletion increases apoptosis in a variety of cell types. Our experiments used FITC-conjugated Annexin V, a Ca2+-dependent phospholipid-binding protein, to detect phosphatidylserine translocation to the plasma membrane exterior [29 ]. This change in the membrane is a morphological feature of early apoptosis, occurring in a time frame just after increased caspase-3 activity and at an earlier stage than DNA fragmentation. Consequently, our experiments show that deprivation of intracellular zinc by TPEN produces changes in monocytes earlier than those reported for thymocytes and lymphocytes [30 31 ], where DNA fragmentation was used.

Some of the protective effects of zinc appear to involve inhibition of caspases, such as caspase-3 [30 31 ] or caspase-1 [32 ]. Reactive oxygen species are also known to induce apoptosis [33 34 ]. Thus, cellular redox status may influence apoptosis. Ratan et al. [35 ] found that shunting cysteine from protein synthesis to glutathione prevents oxidative-stress-induced apoptosis in embryonic cortical neurons. Since many reports have demonstrated that the addition of exogenous zinc prevents the induction of apoptosis by a variety of agents in several cell types [36 37 38 39 40 ], MT, for which zinc is a potent inducer, may be a factor that influences apoptosis.

The mechanism(s) by which zinc is transferred across the plasma membrane of a cell to intracellular ligands remains to be elucidated. Zinc transporters undoubtedly are involved in translocation of zinc. Recently, we found that the zinc transporters ZnT-1 and ZnT-2 were up-regulated by zinc supplementation [4 16 ]. Both ZnT-1 and ZnT-2 are believed to be zinc exporters [reviewed in ref. 4 ]. In contrast, Gaither and Eide [17 ] have shown, through transfection studies using K562 erythroleukemic cells, that ZIP2 is a zinc importer protein that might be localized to the plasma membrane. Our results here provide the first evidence that ZIP2 expression is up-regulated in response to zinc deprivation and reduction in the intracellular zinc pool. Furthermore, Gaither and Eide hypothesized that ZIP2 expression might exhibit limited tissue distribution [17 ], and at levels that cannot be detected by Northern blotting. However, based on our Q-PCR data for ZIP2 mRNA, we conclude that, compared to MT mRNA expression, ZIP2 expression is relatively high in THP-1 cells and isolated human PBMC, whereas it may be low in K562 cells.

In summary, we conclude that depletion of intracellular zinc from cultured THP-1 cells and PBMCs from human subjects decreases MT expression, induces apoptosis, and increases ZIP2 transporter expression. MT expression is the most sensitive parameter examined during zinc depletion and occurs prior to detectable apoptosis. Overall, the results suggest that mononuclear cells are sensitive to zinc depletion and use homeostatic mechanisms to maintain normal cellular integrity during such a severe stress.


arrow
ACKNOWLEDGEMENTS
 
This project was supported by National Institutes of Health research grant DK 31127, Boston Family Endowment funds, and by the Florida Agricultural Experiment Station (and approved for publication as Journal Series No. R_08154). Flow cytometry was performed at University of Florida core facilities with the assistance of Melissa Chen. We thank Stephen J. Lippard and Shawn C. Burdette of the Massachusetts Institute of Technology for generously providing the Zinpyr-1 used in these studies.


arrow
FOOTNOTES
 
Present address: for J.C., Department of Medicine, University of California, San Francisco, CA 94121; for J.P.L., Institute de Biologis Experimental, Universidad Central de Venezuela, Caracas, Venezuela.

Received March 13, 2001; revised April 30, 2001; accepted May 1, 2001.


arrow
REFERENCES
 
    1
  1. Cousins, R. J. (1996) Zinc Filer, L. J. Ziegler, E. E. eds. Present Knowledge in Nutrition 7th ed. Washington DC.
  2. 2
  3. da Silva, J. J. R., Williams, R. J. P. (1991) Zinc: Lewis acid catalysis and regulation da Silva, J .J. R. Williams, R.J. P. eds. The Biological Chemistry of the Elements: The Inorganic Chemistry of Life Oxford UK.
  4. 3
  5. O’Halloran, T. V. (1993) Transition metals in control of gene expression Science 261,715-725[Abstract/Free Full Text]
  6. 4
  7. McMahon, R. J., Cousins, R. J. (1998) Mammalian zinc transporters J. Nutr. 128,667-670[Abstract/Free Full Text]
  8. 5
  9. Andrews, G. K. (2000) Regulation of metallothionein gene expression by oxidative stress and metal ions Biochem. Pharmacol. 59,95-104[Medline]
  10. 6
  11. Davis, S. R., Cousins, R. J. (2000) Metallothionein expression in animals: a physiological perspective on function J. Nutr. 130,1085-1088[Abstract/Free Full Text]
  12. 7
  13. Grider, A., Bailey, L. B., Cousins, R. J. (1990) Erythrocyte metallothionein as an index of zinc status in humans Proc. Natl. Acad. Sci. USA 87,1259-1262[Abstract/Free Full Text]
  14. 8
  15. Sullivan, V. K., Burnett, F. R., Cousins, R. J. (1998) Metallothionein expression is increased in monocytes and erythrocytes of young men during zinc supplementation J. Nutr. 128,707-713[Abstract/Free Full Text]
  16. 9
  17. Robertson, A., Morrison, J. N., Wood, A. M., Bremner, I. (1989) Effects of iron deficiency on metallothionein-I concentrations in blood and tissues of rats J. Nutr. 119,439-445
  18. 10
  19. Harley, C. B., Menon, C. R., Rachubinski, R. A., Nieboer, E. (1989) Metallothionein mRNA and protein induction by cadmium in peripheral-blood leucocytes Biochem. J. 262,873-879[Medline]
  20. 11
  21. Cao, J., Cousins, R. J. (2000) Metallothionein mRNA in monocytes and peripheral blood mononuclear cells and in cells from dried blood spots increases after zinc supplementation of men J. Nutr. 130,2180-2187[Abstract/Free Full Text]
  22. 12
  23. Truong-Tran, A. Q., Ho, L. H., Chai, F., Zalewski, P. D. (2000) Cellular zinc fluxes and the regulation of apoptosis/gene-directed cell death J. Nutr. 130,1459S-1466S[Abstract/Free Full Text]
  24. 13
  25. Khoo, C., Blanchard, R. K., Sullivan, V. K., Cousins, R. J. (1997) Human cysteine-rich intestinal protein: cDNA cloning and expression of recombinant protein and identification in human peripheral blood mononuclear cells Protein Expr. Purif. 9,379-387[Medline]
  26. 14
  27. King, J. C. (1990) Assessment of zinc status J. Nutr. 120,1474-1479
  28. 15
  29. Hambidge, M. (2000) Human zinc deficiency J. Nutr. 130,1344S-1349S[Abstract/Free Full Text]
  30. 16
  31. Liuzzi, J. P., Blanchard, R. K., Cousins, R. J. (2001) Differential regulation of zinc transporter 1, 2, and 4 mRNA expression by dietary zinc in rats J. Nutr. 131,46-52[Abstract/Free Full Text]
  32. 17
  33. Gaither, L. A., Eide, D. J. (2000) Functional expression of the human hZIP2 zinc transporter J. Biol. Chem. 275,5560-5564[Abstract/Free Full Text]
  34. 18
  35. McCabe, M. J., Jr, Jiang, S. A., Orrenius, S. (1993) Chelation of intracellular zinc triggers apoptosis in mature thymocytes Lab. Invest. 69,101-110[Medline]
  36. 19
  37. Treves, S., Trentini, P. L., Ascanelli, M., Bucci, G., Di Virgilio, F. (1994) Apoptosis is dependent on intracellular zinc and independent of intracellular calcium in lymphocytes Exp. Cell Res. 211,339-343[Medline]
  38. 20
  39. Lowry, O. H., Rosebrough, N. J., Farr, A. L., Randall, R. J. (1951) Protein measurement with the Folin phenol reagent J. Biol. Chem. 193,265-275[Free Full Text]
  40. 21
  41. Walkup, G. K., Burdette, S. C., Lippard, S. J., Tsein, R. Y. (2000) A new cell-permeable fluorescent probe for Zn2+ J. Am. Chem. Soc. 122,5644-5645
  42. 22
  43. . SAS Institute Inc. (1988) SAS/STAT User’s Guide: StatisticsRelease 6.03. Cary, NC.
  44. 23
  45. . Institute of Medicine (2001) Dietary Reference Intakes for Vitamin A, Vitamin K, Arsenic, Boron, Chromium, Copper, Iodine, Iron, Manganese, Molybdenum, Nickel, Silicon, Vanadium, and Zinc National Academy Press Washington, DC.
  46. 24
  47. Mesna, O. J., Steffensen, I. L., Melhuus, A., Hjertholm, H., Heier, H. E., Andersen, R. A. (1990) Induction of metallothionein production by zinc in human mononuclear cells Gen. Pharmacol. 21,909-917[Medline]
  48. 25
  49. Steffensen, I. L., Mesna, O. J., Melhuus, A., Hjertholm, H., Heier, H. E., Andersen, R. A. (1991) Mitogenicity and metallothionein induction: two separate effects of zinc ions on human mononuclear blood cells Pharmacol. Toxicol. 68,445-449[Medline]
  50. 26
  51. Yamada, H., Koizumi, S. (1991) Metallothionein induction in human peripheral blood lymphocytes by heavy metals Chem. Biol. Interact. 78,347-354[Medline]
  52. 27
  53. Verhaegh, G. W., Parat, M. O., Richard, M. J., Hainaut, P. (1998) Modulation of p53 protein conformation and DNA-binding activity by intracellular chelation of zinc Mol. Carcinog. 21,205-214[Medline]
  54. 28
  55. Ho, L. H., Ratnaike, R. N., Zalewski, P. D. (2000) Involvement of intracellular labile zinc in suppression of DEVD-caspase activity in human neuroblastoma cells Biochem. Biophys. Res. Commun. 268,148-154[Medline]
  56. 29
  57. Martin, S. J., Reutelingsperger, C. P., McGahon, A. J., Rader, J. A., van Schie, R. C., LaFace, D. M., Green, D. R. (1995) Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: inhibition by overexpression of Bcl-2 and Abl J. Exp. Med. 182,1545-1556[Abstract/Free Full Text]
  58. 30
  59. Perry, D. K., Smyth, M. J., Stennicke, H. R., Salvesen, G. S., Duriez, P., Poirier, G. G., Hannun, Y. A. (1997) Zinc is a potent inhibitor of the apoptotic protease, caspase-3 J. Biol. Chem. 272,18530-18533[Abstract/Free Full Text]
  60. 31
  61. Aiuchi, T., Mihara, S., Nakaya, M., Masuda, Y., Nakajo, S., Nakaya, K. (1998) Zinc ions prevent processing of caspase-3 during apoptosis induced by geranylgeraniol in HL-60 cells J. Biochem. 124,300-303[Abstract/Free Full Text]
  62. 32
  63. Hyun, H. J., Sohn, J., Ahn, Y. H., Shin, H. C., Koh, J. Y., Yoon, Y. H. (2000) Depletion of intracellular zinc induces macromolecule synthesis- and caspase-dependent apoptosis of cultured retinal cells Brain Res 869,39-48[Medline]
  64. 33
  65. Hawkins, R. A., Sangster, K., Arends, M. J. (1998) Apoptotic death of pancreatic cancer cells induced by polyunsaturated fatty acids varies with double bond number and involves an oxidative mechanism J. Pathol. 185,61-70[Medline]
  66. 34
  67. Buttke, T. M., Sandstrom, P. A. (1994) Oxidative stress as a mediator of apoptosis Immunol. Today 15,7-10[Medline]
  68. 35
  69. Ratan, R. R., Murphy, T. H., Baraban, J. M. (1994) Macromolecular synthesis inhibitors prevent oxidative stress-induced apoptosis in embryonic cortical neurons by shunting cysteine from protein synthesis to glutathione J. Neurosci. 14,4385-4392[Abstract]
  70. 36
  71. Meerarani, P., Ramadass, P., Toborek, M., Bauer, H. C., Bauer, H., Hennig, B. (2000) Zinc protects against apoptosis of endothelial cells induced by linoleic acid and tumor necrosis factor alpha Am. J. Clin. Nutr. 71,81-87[Abstract/Free Full Text]
  72. 37
  73. Giannakis, C., Forbes, I. J., Zalewski, P. D. (1991) Ca2+/Mg2+-dependent nuclease: tissue distribution, relationship to inter-nucleosomal DNA fragmentation and inhibition by Zn2+ Biochem. Biophys. Res. Commun. 181,915-920[Medline]
  74. 38
  75. Waring, P., Egan, M., Braithwaite, A., Mullbacher, A., Sjaarda, A. (1990) Apoptosis induced in macrophages and T blasts by the mycotoxin sporidesmin and protection by Zn2+ salts Int. J. Immunopharmacol. 12,445-457[Medline]
  76. 39
  77. Zalewski, P. D., Forbes, I. J., Giannakis, C. (1991) Physiological role for zinc in prevention of apoptosis (gene-directed death) Biochem. Int. 24,1093-1101[Medline]
  78. 40
  79. Ishido, M., Suzuki, T., Adachi, T., Kunimoto, M. (1999) Zinc stimulates DNA synthesis during its antiapoptotic action independently with increments of an antiapoptotic protein, Bcl-2, in porcine kidney LLC-PK(1) cells J. Pharmacol. Exp. Ther. 290,923-928[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
Z. Zhou, J. Liu, Z. Song, C. J. McClain, and Y. J. Kang
Zinc Supplementation Inhibits Hepatic Apoptosis in Mice Subjected to a Long-Term Ethanol Exposure
Experimental Biology and Medicine, May 1, 2008; 233(5): 540 - 548.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
S. J. Dainty, C. A. Kennedy, S. Watt, J. Bahler, and S. K. Whitehall
Response of Schizosaccharomyces pombe to Zinc Deficiency
Eukaryot. Cell, March 1, 2008; 7(3): 454 - 464.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Mao, B.-E. Kim, F. Wang, D. J. Eide, and M. J. Petris
A Histidine-rich Cluster Mediates the Ubiquitination and Degradation of the Human Zinc Transporter, hZIP4, and Protects against Zinc Cytotoxicity
J. Biol. Chem., March 9, 2007; 282(10): 6992 - 7000.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
P. Kaler and R. Prasad
Molecular cloning and functional characterization of novel zinc transporter rZip10 (Slc39a10) involved in zinc uptake across rat renal brush-border membrane
Am J Physiol Renal Physiol, January 1, 2007; 292(1): F217 - F229.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
P. J. Fraker
Roles for Cell Death in Zinc Deficiency
J. Nutr., March 1, 2005; 135(3): 359 - 362.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
B. Kindermann, F. Doring, M. Pfaffl, and H. Daniel
Identification of Genes Responsive to Intracellular Zinc Depletion in the Human Colon Adenocarcinoma Cell Line HT-29
J. Nutr., January 1, 2004; 134(1): 57 - 62.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Dufner-Beattie, S. J. Langmade, F. Wang, D. Eide, and G. K. Andrews
Structure, Function, and Regulation of a Subfamily of Mouse Zinc Transporter Genes
J. Biol. Chem., December 12, 2003; 278(50): 50142 - 50150.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. L Kelleher and B. Lonnerdal
Zn Transporter Levels and Localization Change Throughout Lactation in Rat Mammary Gland and Are Regulated by Zn in Mammary Cells
J. Nutr., November 1, 2003; 133(11): 3378 - 3385.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. J. Cousins, R. K. Blanchard, M. P. Popp, L. Liu, J. Cao, J. B. Moore, and C. L. Green
A global view of the selectivity of zinc deprivation and excess on genes expressed in human THP-1 mononuclear cells
PNAS, June 10, 2003; 100(12): 6952 - 6957.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
R. J. Cousins, R. K. Blanchard, J. B. Moore, L. Cui, C. L. Green, J. P. Liuzzi, J. Cao, and J. A. Bobo
Regulation of Zinc Metabolism and Genomic Outcomes
J. Nutr., May 1, 2003; 133(5): 1521S - 1526.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
A. Finamore, M. Roselli, N. Merendino, F. Nobili, F. Vignolini, and E. Mengheri
Zinc Deficiency Suppresses the Development of Oral Tolerance in Rats
J. Nutr., January 1, 2003; 133(1): 191 - 198.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cao, J.
Right arrow Articles by Cousins, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cao, J.
Right arrow Articles by Cousins, R. J.