Food Science and Human Nutrition Department and Center for Nutritional Sciences, University of Florida, Gainesville 32611-0370
Correspondence: Robert J. Cousins, Food Science and Human Nutrition Department, University of Florida, 201 FSHN, P.O. Box 110370, Gainesville, FL 32611-0370. E-mail: cousins{at}ufl.edu
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: monocytes • PCR • regulation
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Our experiments with human subjects have shown that MT expression is
altered when the dietary zinc supply is restricted or supplemented.
Erythrocyte MT protein concentrations, as measured by enzyme-linked
immunosorbent assay (ELISA), are reduced or elevated, after a lag
period of 
6 days, when the dietary zinc intake of these subjects is
correspondingly adjusted [7
8
]. Similar changes have
been observed in red blood cells from zinc-deficient rats
[9
]. MT protein concentrations in human leukocyte
populations are lower than those in red blood cells
[10
]; however, MT mRNA levels can be measured by
competitive reverse transcriptase (RT)-PCR [8
11
]. This
approach has allowed direct measurement of MT mRNA abundance in
purified monocytes (the type of leukocyte that has the highest MT
expression), as well as in peripheral blood mononuclear cells
(PBMCs) and in leukocytes on dried blood spots obtained from
zinc-supplemented subjects [11
]. MT mRNA levels are
quite sensitive to increases in zinc supplementation, suggesting that
leukocytes, particularly monocytes, are an attractive model in which to
examine zinc function. This interest is enhanced by observations that
zinc alters the susceptibility of cells to apoptosis
[12
], which may relate to a key function of this
micronutrient.
We have been using THP-1 cells, a human monocytic cell line, as a model for studying zinc metabolism and function in immune cells [13 ]. One goal of our experiments is to develop a method that allows the use of leukocytes for assessing dietary zinc status in populations. There is evidence to suggest that marginal zinc deficiency, which has no recognized laboratory method for quantitation, is more widespread than previously believed and produces morbidity worldwide [14 15 ]. As has been shown previously [8 11 ], induction of MT mRNA expression in monocytes is influenced by the zinc supply. Furthermore, recent evidence has shown that zinc transporter expression in rat intestine, liver, and kidney is also zinc dependent [16 ]. Comparable information on leukocyte zinc transporters has not been obtained. Consequently, a second goal of the current experiments with THP-1 cells is to examine the responsiveness of the zinc transporter ZIP2 to decreased zinc levels. ZIP2 is a member of the ZIP (ZRT1, IRT1-like) family of proteins. Data from transfection studies with human cells strongly suggest that ZIP2 is an importer and that it is zinc regulated [17 ].
The purposes of the present studies were (1) to examine in both THP-1 cells and human PBMCs the effects of intracellular zinc depletion induced by a zinc chelator on MT and ZIP2 expression, the extent of apoptosis as a function of zinc depletion, and the relationship of MT and ZIP2 expression to apoptosis and (2) to correlate intracellular zinc levels, using a new cell-permeating zinc probe, with the measurable changes in MT and ZIP2 levels and apoptosis.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
MT protein and mRNA
MT protein was measured by a sandwich ELISA using monoclonal
anti-human (h) MT and chicken egg yolk anti-hMT antibodies as described
previously [8
11
]. Total RNA was extracted from THP-1
cells and human PBMCs using TRIzol reagent (Life Technologies,
Rockville, MD) according to the manufacturer’s protocol. The level of
MT mRNA was determined by a competitive RT-PCR [8
11
].
Reverse transcription was performed, and specific PCR primers were used
to simultaneously amplify both the competitor cDNA (180 bp) and the
target MT cDNA (201-bp) template. The RT-PCR products were separated,
and the MT mRNA concentration was calculated as described previously
[11
].
Human ZIP2 mRNA
Quantitative real-time PCR (Q-PCR) was used to measure the level
of hZIP2 mRNA with a sequence detection system (5700; Applied
Biosystems, Foster City, CA). The following oligonucleotide primers
specific for hZIP2 (GenBank accession no. AF186081) and ß-actin
(accession no. X00351) were used: for hZIP2, GTTTGCCCTGTTGGCTCTCA
(sense) and ATCAATCTGGAACCATTTGAAGC (antisense); for ß-actin,
GACAGGATGCAGAAGGAGATCACT (sense) and GCTCAGGAGGAGCAATGATCTT
(antisense). These primers were designed using Primer Express software
(Applied Biosystems). Reverse transcription and PCRs were performed in
one tube with the following components: 0.25 µg of total RNA, 1x
SYBR Green PCR master mix, 0.25 U/µL of MultiScribe RT, 0.4 U/µL of
RNase inhibitor, and 300 nM forward and reverse primers in a 25-µL
reaction volume. These reagents were purchased from Applied Biosystems.
The following protocol was used for both ZIP2 and ß-actin mRNA:
reverse transcription at 48°C for 30 min; AmpliTaq Gold activation at
95°C for 10 min; and PCR amplification with 40 cycles of denaturation
at 95°C for 15 s and annealing/extension at 60°C for 1 min.
The fluorescence of the double-stranded products accumulated was
monitored in real time. To account for differences in reverse
transcription efficiency, variability in the initial
concentration in samples, and quality of the total RNA, the
relative ZIP2 mRNA levels were normalized to levels of ß-actin mRNA.
Dissociation curves for ZIP2 and ß-actin were checked to verify the
specificity of amplification, since both specific and nonspecific
products generate signal.
Flow-cytometric detection of Annexin V-fluorescein isothiocyanate
(FITC)- and propidium iodide-stained THP-1 cells
Annexin V-FITC and propidium iodide binding were measured with a
commercially available kit (PharMingen, San Diego, CA). THP-1 cells
were washed twice with cold PBS and then resuspended in binding buffer
[10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl2 (pH 7.4)] at a
concentration of 1 x 106 cells/mL. An aliquot (100
µL) was mixed with Annexin V-FITC and propidium iodide as directed by
the manufacturer. The solution was incubated for 15 min at room
temperature in the dark. After more binding buffer was added, the cells
were analyzed by flow cytometry within 1 h. The following controls
were used to set up compensation and quadrants for staining controls:
unstained cells, cells stained with Annexin V-FITC alone, cells stained
with propidium iodide alone, and cells stained with both indicators.
Flow-cytometric analysis of 3 x 104 labeled cells per
sample was performed using a Becton-Dickinson (Franklin Lakes,
NJ) FACScan instrument. Cell size and granularity were
assessed by measuring mean forward scattering and mean side scattering,
respectively. Early apoptotic cells were defined as Annexin V positive
and propidium iodide negative, whereas dead cells were propidium iodide
positive.
Fluorescence microscopy
THP-1 cells were incubated in medium containing zinc and/or TPEN
as described above. At various times, cells were collected and washed
rapidly in HEPES-buffered saline; 1 g/L of glucose at pH 7.4 with 10 mM
EDTA to remove extracellular nonspecifically (loosely) bound zinc. The
cells were then washed in the same buffer but without EDTA. The cells
were suspended in 5 µM Zinpyr-1 (kindly provided by Dr. Stephen J.
Lippard), a di-2-picolylamine/fluorescein-based cell-permeating
fluorescent probe (Kd=2.11 nM) specific for
Zn2+ [21
], and incubated at 37°C for 30
min. Then the cells were transferred to microscope slides, and a
coverslip was added. Digital images were obtained with a Zeiss Axiovert
S100 microscope equipped with a charge-coupled device camera.
Statistical analysis
Data were analyzed using Statistical Analysis System software
(Windows version 6.12; SAS Institute, Cary, NC). Treatment means were
compared using a least-squares means statement [22
].
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
40 µM zinc. At 80 µM zinc, MT
protein levels were highest (2.0 mg/g of cell protein). This amount of
MT represents approximately 2.1 µmol of zinc (141 µg)/g of cell
protein.
 View larger version (25K): [in a new window] |
Figure 1. Induction of MT expression in THP-1 cells in response to different zinc
concentrations (0–160 µM) in the medium. MT mRNA and MT protein were
measured by competitive RT-PCR and ELISA, respectively. Cells were
cultured for 18 h under these conditions. Values are means ±
SD; n = 5. Values are significantly
different from control cultures (no zinc added) at P <
0.05 (20 and 40 µM) or P < 0.01 (80 and 160 µM).
|
 View larger version (16K): [in a new window] |
Figure 2. Plasma zinc concentrations (A) and MT mRNA levels (B) of PBMCs derived
from human subjects as induced by oral zinc supplementation. A zinc
supplement of 15 mg/day was given for up to 10 days. PBMCs were
isolated from venous blood as described in Materials and Methods at
days 0, 4, and 10 of supplementation. Values are means ±
SD; n = 8. Asterisks indicate values
significantly different from those at day 0 (**, P<0.01).
|
 View larger version (25K): [in a new window] |
Figure 3. Influence of the intracellular zinc chelator TPEN and/or zinc on zinc
concentrations in THP-1 cells and PBMCs. Cells were cultured with
various concentrations of TPEN and/or zinc for 18 h. Zinc was
measured by atomic absorption. Values are means ± SD;
n = 5. Asterisks indicate values significantly
different from those for control cultures (no zinc added) at
P < 0.05 (*) or P < 0.01 (**).
|
 View larger version (19K): [in a new window] |
Figure 4. Influence of the intracellular zinc chelator TPEN and/or zinc on
induction of MT expression in THP-1 cells (A) or PBMCs (B). Cells were
cultured with various concentrations of TPEN and/or zinc for 18 h.
MT mRNA and MT protein were measured by competitive RT-PCR and ELISA,
respectively. Values are means ± SD;
n = 5. Asterisks indicate values significantly
different from those for control cultures (no zinc added) at
P < 0.05 (*) or P < 0.01 (**).
|
The observed reduction in MT mRNA levels resulting from intracellular zinc depletion for both THP-1 cells and PBMCs (Fig. 4A and 4B) answers one of our experimental questions. Specifically, levels of this mRNA can be reduced by zinc restriction, suggesting that studies to examine a comparable reduction due to dietary zinc depletion in human subjects are possible.
Chelation of intracellular zinc caused the death of THP-1 cells and PBMCs as measured by trypan blue exclusion analysis (Table 1 ). No significant increase in cell death was found when these cells were treated with 5 µM TPEN or 20 µM zinc overnight. However, when the cells were treated with 10 or 30 µM TPEN overnight, at least half of the cells died. These chelator concentrations reduced total cellular zinc concentrations to 15–25% of those in untreated cells (Fig. 3) . When an equimolar concentration of zinc was supplemented with TPEN, there was no increase in cell death in treated versus untreated THP-1 cells. Data from both cell types collectively describe an exponential function in which cellular zinc concentration in micrograms per gram of protein (y) is related to percent cell viability (x) as follows: y = 11e0.026x (r=0.90) (Fig. 5 ). This relationship suggests that monocytes can lose one-third of their zinc content and maintain a viability of >90%, but viability decreases markedly if zinc loss is more extensive. Furthermore, zinc depletion by TPEN decreased cell size and granularity as observed in scatter diagrams obtained by flow cytometry (data not shown).
|
View this table: [in a new window] |
Table 1. Cell Viability after Treatment with the Intracellular Zinc Chelator
TPEN and/or Zinc
|
 View larger version (17K): [in a new window] |
Figure 5. Relationship of cell viability to cellular zinc concentration. The plot
shows that the cellular zinc concentration (y) from Figure 3
is related to percent cell viability (x) from Table 1
as the
following exponential function: 11e0.026x.
|
 View larger version (73K): [in a new window] |
Figure 6. Influence of zinc depletion of THP-1 cells and PBMCs using the
intracellular zinc chelator TPEN on expression of the zinc transporter
ZIP2. Cells were cultured for 18 h with 5 or 10 µM TPEN as
described in the legends to Figures 3
and 4
. Total RNA was reverse
transcribed, and the cDNA amplified by Q-PCR was detected with SYBR
green fluorescence chemistry. (A) Representative amplification plots
using primers for ß-actin and hZIP2 in which the intensity of the
fluorescence product, RN, is plotted versus the PCR cycle number. Plots
labeled "control" and "TPEN" represent ZIP2 cDNA fluorescence.
(B) PCR values were normalized to those produced with primers for
ß-actin. Values are means ± SD; n =
5. Asterisks indicate values significantly different from those for
control cultures (no zinc added) at P < 0.05 (*) or
P < 0.01 (**).
|
Annexin V and propidium iodide staining were used to identify cells in early stages of apoptosis. For this series of experiments, TPEN was added for a period of 4 h rather than 18 h, as used in the experiments above, to preclude the marked cell death found with the longer treatment. Flow-cytometric data with Annexin V showed <2% apoptotic cells with culture medium alone (Fig. 7A ). Cells treated with either 5 or 20 µM zinc showed no difference in apoptosis from cells treated with culture medium alone. However, when cells were treated with 10 or 30 µM TPEN for 4 h, 9.2% or 37.0%, respectively, became apoptotic based on the display of phosphotidylserine on the exterior of the cell membrane, as shown by the increase in Annexin V fluorescence. The proportion of cells that were dead (propidium iodide positive) remained relatively constant (upper right quadrants of inserts, Fig. 7A 7B 7C 7D 7E ).
 View larger version (34K): [in a new window] |
Figure 7. Flow-cytometric analysis and sorting of THP-1 cells stained with
Annexin V and propidium iodide (PI) to assess the effect of the
intracellular zinc chelator TPEN on early apoptosis. Insets show PI
staining versus Annexin V staining. As shown in the panel A inset,
untreated cells were primarily Annexin V and PI negative, indicating
that they were viable and not undergoing apoptosis. Cells that are
Annexin V positive and PI negative, as shown in the panel D inset,
represent early apoptotic cells. The proportion of cells that were
already dead (Annexin V and PI positive) was relatively low but was not
influenced by either TPEN or zinc.
|
 View larger version (18K): [in a new window] |
Figure 8. Influence of zinc depletion of THP-1 cells by the intracellular zinc
chelator TPEN on expression of MT mRNA and zinc transporter ZIP2 mRNA.
Cells were cultured for 4 h with 5 or 10 µM TPEN as described in
the legends to Figures 3
and 4
. MT mRNA was measured as described in
the legend to Figure 4
. Zip2 mRNA was measured as described in the
legend to Figure 6
.
|
 View larger version (21K): [in a new window] |
Figure 9. Subcellular distribution of labile Zn in THP-1 cells with either no
treatment (A), 10 µM TPEN (B), or 20 µM Zn (C). THP-1 cells were
cultured with either TPEN or Zn for 4 h. Cells were washed first
with HEPES-buffered saline with EDTA and then with HEPES-buffered
saline without EDTA. Zinpyr-1 (5 µM) was added for 30 min to
visualize intracellular labile Zn.
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The response of monocyte MT mRNA levels to dietary zinc depletion has yet to be examined in human subjects. The results presented here, however, clearly demonstrate by multiple lines of evidence, using THP-1 cells as a model for circulating monocytes in human subjects, that cellular zinc deprivation by TPEN chelation evokes many responses, including a reduction in MT mRNA levels. These experiments suggest that dietary zinc deprivation will produce similar changes in MT mRNA levels and therefore the response might be of value for zinc status assessment of human population groups. Furthermore, the responsiveness of ZIP2 expression to zinc deprivation of monocytes and the tendency of these cells to enter the early stages of apoptosis in response to such deprivation suggest that these parameters might also serve as biological markers for human zinc deficiency. Currently there is no clearly defined biochemical indicator for zinc status assessment [14 23 ], yet marginal zinc deficiency continues to be found in many parts of the world [15 ].
We found that MT mRNA levels in THP-1 cells were negatively related to the concentration of TPEN in the medium and also to the concentration of zinc in the cells. Furthermore, depletion of intracellular zinc by TPEN caused MT protein levels in cells to decrease. The latter observation suggests that MT protein turnover is a likely result of zinc depletion. Others have shown that MT in monocytes and lymphocytes is induced by zinc in culture [24 25 26 ]. The present studies are the first to show concurrent decreases in both mRNA and MT protein levels. The regulation of MT transcription by zinc is mediated by metal-responsive elements located upstream of the MT gene. Therefore, the decrease in MT expression from TPEN treatment in this study could be caused by the removal of zinc by the chelator from the zinc-binding transcription factor MTF1 [5 27 ], leading to decreased DNA-binding activity and decreased MT gene transcription. Alternatively, increased apo-MT formation produced upon the removal of zinc by the chelator would lead to MT degradation [6 ].
TPEN has been used in cells in experiments prior to ours that focused on zinc depletion as an inducer of apoptosis [18 19 28 ]. In those reports, DNA fragmentation or caspase activity was used as the index of apoptosis. These events occur at later and earlier stages in the apoptotic cell death process, respectively. Nevertheless, those results demonstrate that zinc depletion increases apoptosis in a variety of cell types. Our experiments used FITC-conjugated Annexin V, a Ca2+-dependent phospholipid-binding protein, to detect phosphatidylserine translocation to the plasma membrane exterior [29 ]. This change in the membrane is a morphological feature of early apoptosis, occurring in a time frame just after increased caspase-3 activity and at an earlier stage than DNA fragmentation. Consequently, our experiments show that deprivation of intracellular zinc by TPEN produces changes in monocytes earlier than those reported for thymocytes and lymphocytes [30 31 ], where DNA fragmentation was used.
Some of the protective effects of zinc appear to involve inhibition of caspases, such as caspase-3 [30 31 ] or caspase-1 [32 ]. Reactive oxygen species are also known to induce apoptosis [33 34 ]. Thus, cellular redox status may influence apoptosis. Ratan et al. [35 ] found that shunting cysteine from protein synthesis to glutathione prevents oxidative-stress-induced apoptosis in embryonic cortical neurons. Since many reports have demonstrated that the addition of exogenous zinc prevents the induction of apoptosis by a variety of agents in several cell types [36 37 38 39 40 ], MT, for which zinc is a potent inducer, may be a factor that influences apoptosis.
The mechanism(s) by which zinc is transferred across the plasma membrane of a cell to intracellular ligands remains to be elucidated. Zinc transporters undoubtedly are involved in translocation of zinc. Recently, we found that the zinc transporters ZnT-1 and ZnT-2 were up-regulated by zinc supplementation [4 16 ]. Both ZnT-1 and ZnT-2 are believed to be zinc exporters [reviewed in ref. 4 ]. In contrast, Gaither and Eide [17 ] have shown, through transfection studies using K562 erythroleukemic cells, that ZIP2 is a zinc importer protein that might be localized to the plasma membrane. Our results here provide the first evidence that ZIP2 expression is up-regulated in response to zinc deprivation and reduction in the intracellular zinc pool. Furthermore, Gaither and Eide hypothesized that ZIP2 expression might exhibit limited tissue distribution [17 ], and at levels that cannot be detected by Northern blotting. However, based on our Q-PCR data for ZIP2 mRNA, we conclude that, compared to MT mRNA expression, ZIP2 expression is relatively high in THP-1 cells and isolated human PBMC, whereas it may be low in K562 cells.
In summary, we conclude that depletion of intracellular zinc from cultured THP-1 cells and PBMCs from human subjects decreases MT expression, induces apoptosis, and increases ZIP2 transporter expression. MT expression is the most sensitive parameter examined during zinc depletion and occurs prior to detectable apoptosis. Overall, the results suggest that mononuclear cells are sensitive to zinc depletion and use homeostatic mechanisms to maintain normal cellular integrity during such a severe stress.
Received March 13, 2001; revised April 30, 2001; accepted May 1, 2001.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
 |
|
 |
|
  Z. Zhou, J. Liu, Z. Song, C. J. McClain, and Y. J. Kang Zinc Supplementation Inhibits Hepatic Apoptosis in Mice Subjected to a Long-Term Ethanol Exposure Experimental Biology and Medicine, May 1, 2008; 233(5): 540 - 548. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Dainty, C. A. Kennedy, S. Watt, J. Bahler, and S. K. Whitehall Response of Schizosaccharomyces pombe to Zinc Deficiency Eukaryot. Cell, March 1, 2008; 7(3): 454 - 464. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Mao, B.-E. Kim, F. Wang, D. J. Eide, and M. J. Petris A Histidine-rich Cluster Mediates the Ubiquitination and Degradation of the Human Zinc Transporter, hZIP4, and Protects against Zinc Cytotoxicity J. Biol. Chem., March 9, 2007; 282(10): 6992 - 7000. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Kaler and R. Prasad Molecular cloning and functional characterization of novel zinc transporter rZip10 (Slc39a10) involved in zinc uptake across rat renal brush-border membrane Am J Physiol Renal Physiol, January 1, 2007; 292(1): F217 - F229. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. Fraker Roles for Cell Death in Zinc Deficiency J. Nutr., March 1, 2005; 135(3): 359 - 362. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Kindermann, F. Doring, M. Pfaffl, and H. Daniel Identification of Genes Responsive to Intracellular Zinc Depletion in the Human Colon Adenocarcinoma Cell Line HT-29 J. Nutr., January 1, 2004; 134(1): 57 - 62. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Dufner-Beattie, S. J. Langmade, F. Wang, D. Eide, and G. K. Andrews Structure, Function, and Regulation of a Subfamily of Mouse Zinc Transporter Genes J. Biol. Chem., December 12, 2003; 278(50): 50142 - 50150. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L Kelleher and B. Lonnerdal Zn Transporter Levels and Localization Change Throughout Lactation in Rat Mammary Gland and Are Regulated by Zn in Mammary Cells J. Nutr., November 1, 2003; 133(11): 3378 - 3385. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Cousins, R. K. Blanchard, M. P. Popp, L. Liu, J. Cao, J. B. Moore, and C. L. Green A global view of the selectivity of zinc deprivation and excess on genes expressed in human THP-1 mononuclear cells PNAS, June 10, 2003; 100(12): 6952 - 6957. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Cousins, R. K. Blanchard, J. B. Moore, L. Cui, C. L. Green, J. P. Liuzzi, J. Cao, and J. A. Bobo Regulation of Zinc Metabolism and Genomic Outcomes J. Nutr., May 1, 2003; 133(5): 1521S - 1526. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Finamore, M. Roselli, N. Merendino, F. Nobili, F. Vignolini, and E. Mengheri Zinc Deficiency Suppresses the Development of Oral Tolerance in Rats J. Nutr., January 1, 2003; 133(1): 191 - 198. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
