science pharmaceutical expo biotech jobs

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Friedland, J. S.
Right arrow Articles by Stylianou, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Friedland, J. S.
Right arrow Articles by Stylianou, E.
(Journal of Leukocyte Biology. 2001;70:447-454.)
© 2001 by Society for Leukocyte Biology

Regulation of interleukin-8 gene expression after phagocytosis of zymosan by human monocytic cells

Jon S. Friedland*, Despina Constantin{dagger}, Terry C. Shaw* and Eleni Stylianou{dagger}

* Department of Infectious Diseases, Imperial College of Science, Technology and Medicine (Hammersmith Campus), London, and
{dagger} School of Biomedical Sciences and Institute of Cell Signalling, University Hospital, Nottingham, United Kingdom

Correspondence: Dr. Eleni Stylianou, School of Biomedical Sciences, University Hospital, Nottingham, United Kingdom. E-mail: eleni.stylianou{at}nottingham.ac.uk


arrow
ABSTRACT
 
Monocyte phagocytosis of pathogens or inflammatory debris leads to chemokine secretion and heralds the influx of leukocytes to the site of injury. Persistent chemokine secretion can lead to tissue damage. However, the mechanisms by which phagocytosis regulates chemokine synthesis remain poorly understood. As a first step, we have studied regulation of interleukin (IL) 8 gene expression after interaction with zymosan or latex. IL-8 secretion was consistently one- or twofold higher after incubation with zymosan than with latex. Nuclear factor (NF) {kappa}B translocation to the nucleus was induced by zymosan but not latex, indicating that its translocation is dependent on the nature of the phagocytic stimulus. NF{kappa}B activation coincided with I{kappa}B{alpha} degradation but had no effect on processing of NF{kappa}B1/p105, the precursor of the NF{kappa}B protein p50. The NF{kappa}B inhibitor gliotoxin abrogated zymosan-induced IL-8 synthesis in peripheral blood monocytes, further demonstrating that the induction of IL-8 mRNA by zymosan is NF{kappa}B dependent. SB203580 inhibition of the p38 mitogen-activated protein kinase (MAPK) pathway significantly decreased zymosan-induced IL-8 mRNA accumulation. Inhibitors of protein kinases A and C or tyrosine kinases had no significant effect on zymosan-induced IL-8 synthesis. These data indicate that p38 MAPK and NF{kappa}B are critical in controlling zymosan-induced IL-8 secretion.

Key Words: chemokine synthesis • MAPK • tyrosine kinase • protein kinase • NF-{kappa}B activation


arrow
INTRODUCTION
 
The phagocytosis of pathogens and cellular debris is a critical function of monocytes and macrophages in host defense [1 ]. Zymosan is a carbohydrate-rich cell wall preparation, derived from the yeast Saccharomyces cerevisiae, which has been widely used as a phagocytic stimulus [2 , 3 ]. Zymosan can up-regulate leukotriene production by monocytes [4 ], lysosomal enzyme secretion [3 ], and release of proinflammatory cytokines [5 , 6 ]. In contrast, the phagocytosis of inert particles such as latex at best only weakly activates monocyte functions [7 , 8 ]. An important consequence of phagocytosis is the induction of chemokine synthesis, a pivotal event in further recruitment of cells to sites of infection and inflammation. Zymosan but not latex stimulates monocytic cells to secrete the chemokine interleukin (IL) 8 at concentrations of a similar order of magnitude similar to those achieved after lipopolysaccharide (LPS) stimulation [9 ].

IL-8, the first member of the C-X-C family of chemokines to be thoroughly characterized, is known to have a critical role in the recruitment of neutrophils and T lymphocytes to regions of tissue injury [10 ]. In addition, it has recently been demonstrated that IL-8 is involved in monocyte recruitment [11 ]. Phagocytosis of microbial pathogens is a potent stimulus of IL-8 secretion from monocytic cells [9 ] and neutrophils [12 ]. The 5'-flanking region of the IL-8 gene has been shown to contain a sequence spanning -133 bp -1 to that is sufficient for transcriptional regulation of the gene and that includes single nuclear factor {kappa}B (NF-{kappa}B) and activator protein-1 (AP-1) elements as well as two CCAAT-enhancer-binding-protein binding sites [14 , 15 ]. Regulation of IL-8 secretion is dependent on the activity of the NF-{kappa}B family of Rel-related transcription factors in many cell types [16 ], but the mechanisms regulating expression of the gene encoding this chemokine in monocytes are poorly understood.

NF-{kappa}B comprises specific heterodimeric complexes present in an inactive form in the cytoplasm of resting cells, where each is bound to one of the inhibitor I{kappa}B proteins. Stimulus-induced activation of the NF-{kappa}B-inducing kinase leads to phosphorylation of the I{kappa}B kinase complex [reviewed in reference 16] followed by ubiquitination and proteasome-mediated degradation of I{kappa}B, which frees NF-{kappa}B to translocate to the nucleus. There it interacts with its target motifs in the promoter regions of a large range of proinflammatory-protein genes, including those regulating secretion of chemokines such as IL-8 [16 , 17 ]. In addition, it has recently been demonstrated that there are other pathways of NF-{kappa}B activation. These pathways involve phosphorylation of the precursor protein p105 by Tpl2 kinase, which results in the release of p50 c-Rel or RelA proteins for translocation to the nucleus [18 ].

There are several signaling pathways that could potentially lead to NF-{kappa}B activation in monocytes phagocytosing zymosan. Zymosan triggers the association of tyrosine phosphoproteins and Lyn kinase with the cytoskeleton in human monocytes [3 ], and activation of tyrosine kinases has been implicated in secretion of 9E3, the chicken homologue of IL-8 [19 ]. In addition, activation of protein kinase (PK) C after phagocytosis of zymosan by monocytes has been shown to be important in the regulation of tumor necrosis factor (TNF) secretion [6 ].

The purpose of this study was to define the molecular events activated by yeast-derived zymosan that lead to IL-8 gene expression. Therefore, we investigated the involvement of NF-{kappa}B and specific upstream kinase pathways. We showed that interaction with zymosan, but not with inert latex, led to NF-{kappa}B-dependent IL-8 gene expression, indicating that such activation is dependent on the nature of the phagocytosis stimulus. Furthermore, gliotoxin, a specific NF-{kappa}B inhibitor, abrogated induction of IL-8 mRNA synthesis after incubation with zymosan. Zymosan-dependent activation of NF-{kappa}B occurs through the degradation of I{kappa}B{alpha} but does not involve the degradation of p105 and is not regulated by tyrosine kinases, PKC, or PKA. In contrast, the p38 mitogen-activated protein kinase signaling pathway is critical in regulating zymosan-stimulated IL-8 gene expression.


arrow
MATERIALS AND METHODS
 
THP-1 cells, a human monocytic, phagocytic cell line [20 ], were obtained from the European Collection of Animal Cell Cultures (Salisbury, United Kingdom). Buffy coat concentrates were obtained from the North London Blood Transfusion Service (Colindale, United Kingdom). RPMI 1640 was purchased from Gibco BRL, Paisley, Scotland. Endotoxin-free fetal calf serum (FCS) and zymosan were obtained from Sigma Chemical Co. (Poole, Dorset, United Kingdom). Pharmacia Biotech (St. Albans, United Kingdom) supplied the Ficoll-Paque. The kinase inhibitors genistein, erbstatin, KT5720, Calphostin C, SB 203580, and PD 98059 were purchased from Calbiochem (Beeston, Nottingham, UK). Gliotoxin and methyl gliotoxin were from Sigma Chemical Co. Santa Cruz Biotechnology Inc. (Santa Cruz,CA) supplied rabbit polyclonal antibodies to I{kappa}B{alpha}, I{kappa}Bß, and p105. [{gamma}-32P]ATP (6,000 Ci/mmol) was obtained from ICN Biomedicals Ltd. (Thame, U.K.), and T4 polynucleotide kinase was purchased from Stratagene (Cambridge, United Kingdom). Polytetrafluoroethylene-Teflon vials were acquired from Pierce & Warriner (Chester, U.K.). Hybond N+ membranes for Northern blotting were obtained from Amersham (Little Chalfont, U.K.). All other reagents were purchased from Sigma Chemical Co.

Cell culture, experimental protocols, and use of inhibitors
The human phagocytic, monocytic THP-1 cell line and primary monocytes were cultured in RPMI 1640 medium supplemented with 10% endotoxin-free FCS, 2 mM glutamine, and 100 µg/mL of ampicillin and kept at 37°C in a 5% CO2 atmosphere. Normal human monocytes were obtained by adhesion purification of peripheral blood mononuclear cells from blood buffy coat concentrates by density gradient centrifugation over Ficoll-Paque.

Immediately before experiments, 107 THP-1 cells were suspended in fresh medium at a density of 2 x 105 to 5 x 105/mL. To induce expression of the LPS receptor CD14, THP-1 cells were treated with vitamin D3 for 48 h prior to incubation [21 ]. Cells were incubated with either inert 3-µm-diameter latex beads (as a negative particulate control), yeast-derived zymosan (1 mg/mL; boiled and washed seven times prior to use), or LPS (1 µg/mL; as a positive control). In experiments using inhibitors (employed at concentrations relating to their 50% inhibitory concentrations), these substances were added to the cultures 30 min before the stimulus was applied. At specific time points, cells were centrifuged at 1,300 g and 4°C for 5 min, and the pellet was homogenized in 300 µL of RNA extraction buffer [4 M guanidine thiocyanate, 25 mM Tris (pH 7.0), 0.5% N-lauroylsarcosine, and 0.1 M 2-mercaptoethanol]. The homogenates were stored at -80°C for subsequent RNA extraction. In experiments to be analyzed by electrophoretic mobility shift assay (EMSA), nuclear extracts were isolated immediately. Experiments using peripheral-blood-derived monocytes (PBMs) were performed in either six-well plates or 90-mm-diameter tissue culture petri dishes. The possibility of endotoxin contamination was routinely excluded by the use of endotoxin-free FCS and endotoxin-free plastics and by subjecting experimental samples to the Limulus amoebocyte assay.

Preparation of cytosolic and nuclear extracts
Nuclear and cytosolic extracts were prepared by modifications of previously described procedures [22 ]. Protein concentration estimations were performed by a dye-binding assay [23 ]. Briefly, cells were washed in ice-cold phosphate-buffered saline and scraped, on ice, into a hypotonic buffer containing proteinase and phosphatase inhibitors [10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 50 µM dithiothreitol (DTT); 100 µM phenanthroline, 1 µg/mL of pepstatin, 100 µM E64, 100 µM DCI, 10 mM NaF, 100 µM Na3VO4, and 25 mM ß-glycerophosphate]. Cells were then lysed by incubation for 10 min on ice in 60–80 µL of hypotonic buffer containing 0.2% Nonidet P-40. Lysates were centrifuged at 10,000 g and 4°C for 10 min, and supernatants were discarded. Pelleted nuclei were resuspended in 60–80 µL of nuclear extract buffer [20 mM HEPES (pH 7.9), 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, and 100 µM DCI) and incubated at 4°C for 15 min. Lysed nuclei were vortexed and then centrifuged (10,000 g at 4°C) for 10 min, and supernatants were snap-frozen through storage at -80°C.

EMSAs
NF-{kappa}B binding activity was detected with synthetic oligonucleotide probes containing either the NF-{kappa}B site of the IL-8 promoter (GTGGAATTTCCT) [15 ] or a consensus mutant site (CTCACTTTCC) [22 ]. These probes were radiolabeled with [{gamma}-32P]ATP by using T4 polynucleotide kinase for 20 min at 37°C. DNA-binding assays were performed in a total volume of 20 µL containing the binding buffer [10 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 4% (v/v) glycerol, 5 mM DTT, 1 mg/mL of bovine serum albumin], the sample, 2 µL of 32P-labeled oligonucleotide, and 3 µg of poly(dI-dC), as described previously [22 ]. After being incubated for 15 min at room temperature, the samples were electrophoresed in a 5% native polyacrylamide gel with 0.25x Tris-borate-EDTA. For competition experiments, unlabeled oligonucleotides were incubated with extracts for 5 min prior to addition of the radiolabeled probe. After electrophoresis, the gels were dried and then autoradiographed.

RNA isolation and Northern blotting
RNA was extracted using modifications of previously described techniques [24 ]. In brief, RNA was extracted by a double phenol-chloroform (1:1)/chloroform-isoamyl alcohol (24:1) method and then precipitated overnight at -80°C in propan-2-ol. After centrifugation at 10,000 g for 1 h, the precipitated RNA was washed in 80% ethanol and resuspended in diethylpyrocarbonate-treated double-distilled water. RNA (15-µg aliquots) was electrophoresed in running buffer (which included ethidium bromide) on denaturing formaldehyde–1% agarose gels at 120 V. For Northern blot analyses, RNA samples were blotted by capillary action onto Hybond N+ membranes that were then fixed by ultraviolet cross-linking.

For probing, Northern blots were prehybridized with 6x standard saline citrate, 1x Denhardt’s solution, 0.5% sodium dodecyl sulfate, 0.05% sodium pyrophosphate, 50 µg/mL of polyadenylic acid, and 100 µg/mL of transfer RNA. These blots were then hybridized with [{gamma}-32P]-end-labeled oligonucleotide probes for IL-8 or ß-actin [25 ]. Blots were probed with ß-actin, and the 18S and 28S ribosomal RNA bands were assessed to verify uniform loading of RNA onto the gels. Autoradiography with intensifying screens was performed at -70°C for 24–48 h. Autoradiographs were scanned (Scanjet Iicx; Hewlett-Packard, Fort Collins, CO) into a Power Macintosh 6100/60 computer (Apple Inc., Santa Clara, CA) and were analyzed with Image 1.52 software (National Institutes of Health, Bethesda, MD). Blots were stripped by heating them for 1 h at 65°C in a solution consisting of 5 mM Tris-HCl (pH 8.0), 2 mM disodium EDTA, and 0.1x Denhardt’s solution.

Reverse transcriptase-PCR and dot blot hybridization
Total RNA was extracted from human PBMs (5 x 106 cells/mL per well of a six-well plate) by using an RNeasy Mini Kit (Qiagen, Crawley, United Kingdom). One microgram of total RNA was reverse transcribed into cDNA by using oligo(dT) in 5x first-strand buffer (Gibco BRL) supplemented with 5 mM each deoxyribonucleoside triphosphate, 0.1 mM DTT. and 200 U/µL of Superscript reagent (Gibco BRL). cDNA was amplified with the following IL-8 primers: ATGACTTCCAAGCTGGCCGTGGCT (sense) and TCTCAGCCCTCTTCAAAAACTTCTC (antisense) [26 ]. Each primer (0.1 nmol), together with the cDNA, was incubated in 10xx PCR buffer supplemented with 1.5 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, and 1 U of Taq DNA polymerase. Samples were denatured at 95°C for 1.5 min, and annealing was performed at 60°C (for IL-8) or at 55°C [for glyceraldehyde 3-phosphate dehydrogenase (GAPDH)] for 1.5 min. Extension reactions were performed at 72°C for 1.5 min (30 cycles for IL-8 and 28 cycles for GAPDH). PCR samples were then electrophoresed on 2% agarose gels in the buffer containing ethidium bromide. For dot blot hybridization, the PCR products were spotted on Hybond N+ membranes and hybridized with an IL-8–specific, 32P-labeled probe (GAGAGTGGACCACACTGCGCCAAC). Membranes were washed in 2x SSPE [1x SSPE is 0.18 M NaCl, 10 mM NaH2PO4, and 1 mM EDTA (pH 7.7)] and then in 5x SSPE, each containing 0.1% sodium dodecyl sulfate, and then autoradiographed. The intensities of radioactive spots obtained with the IL-8 probe relative to those obtained with the GAPDH probe were quantified on a phosphorimager (FLA-2000; Fujifilm).

Quantification of IL-8 protein secretion
IL-8 concentrations in THP-1 or human peripheral blood cell culture supernatants were measured by a specific enzyme-linked immunosorbent assay, using matched-pair antibodies and recombinant standards from R*D Systems Europe Ltd. (Oxon, United Kingdom). The lower limit of sensitivity of the assays was 15 pg/mL.

Statistical analysis
The data presented are the means ± SE of values from at least three independent experiments. Statistical comparisons between multiple groups were performed by analysis of variance, and a P value of <0.05 was considered statistically significant.


arrow
RESULTS
 
Comparison of IL-8 gene expression and secretion in human monocytes and THP-1 cells
We examined the ability of human PBMs to secrete IL-8 after incubation with zymosan and confirmed that THP-1 cells (which have been established as a good model for the study of monocyte function [27 28 29 ]) are useful for the study of phagocytosis-induced IL-8 secretion. Incubation with zymosan resulted in levels of IL-8 secretion that were maintained >24 h and were of similar a magnitude in both THP-1 cells and PBMs (Fig. 1 a and b). Approximately 70% of the cells phagocytosed particulate stimuli, with >90% of the phagocytosis being complete within 30 min (data not shown). Phagocytosis of zymosan stimulated an early and sustained IL-8 mRNA accumulation in primary human monocytes (Fig. 1c) . Peak IL-8 mRNA accumulation occurred at between 2 and 6 h after zymosan stimulation and was maintained up to 24 h. These results, which were confirmed by Northern blot analysis (data not shown), are consistent with the pattern of IL-8 mRNA accumulation in THP-1 cells after interaction with zymosan, which we reported previously [9 ]. In contrast, latex was a minimal stimulus of PBM IL-8 secretion, which was detectable only at 24 h and was 2 log orders of magnitude lower than that after incubation with zymosan. After incubation of THP-1 cells with latex beads, IL-8 was detected in supernatants at concentrations similar to those found in unstimulated cells incubated in medium alone, which were ~1 log order of magnitude lower than those induced by zymosan.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. Time course of IL-8 mRNA and protein synthesis after incubation of human monocytic cells with zymosan or latex. PBMs (A) or THP-1 cells (B) were incubated with yeast-derived zymosan (1 mg/mL) or inert 3-µm-diameter latex beads. Supernatants were harvested at the times shown, and concentrations of secreted IL-8 protein were measured by specific ELISA. (C) IL-8 mRNA accumulation in unstimulated PBMs (open bars) and after incubation of PBMs with zymosan (1 mg/mL; closed bars) was quantified by dot blot hybridization at the times shown. The intensity of radioactivity detected by the IL-8 probe relative to that of a GAPDH probe was determined by phosphorimager analysis. Results shown are means ± SE of values from three separate experiments, and differences in mRNA levels were subjected to analysis of variance (*, P<0.05).

Activation of NF-{kappa}B by phagocytosis stimuli
To determine whether differential activation of NF-{kappa}B by distinct stimuli of phagocytosis may, in part, explain the differences in IL-8 secretion in response to zymosan and to latex, nuclear protein extracts were prepared from THP-1 cells, and EMSAs were performed with an oligonucleotide containing the NF-{kappa}B site in the human IL-8 gene promoter [15 ] (Fig. 2 a). Zymosan induced NF-{kappa}B binding, which was detectable at 1 h, peaked at 2 h, and persisted up to 24 h. Latex did not activate NF-{kappa}B. The time course of induction paralleled the accumulation of IL-8 mRNA after stimulation by zymosan in human monocytes (Fig. 1c) . Incubation of nuclear extracts with a mutant probe indicated that zymosan induced specific NF-{kappa}B binding activity (Fig. 2a and 2b) . The mutant probe detected one nonspecific complex and a constitutive complex. To further confirm the specificity of NF-{kappa}B complexes, we demonstrated a lack of binding to the mutated {kappa}B probe after stimulation by zymosan and determined that excess unlabeled wild-type probe but not excess mutant probe blocked binding of the labeled IL-8 NF-{kappa}B-specific oligonucleotide (Fig. 2b) . The number of NF-{kappa}B-specific complexes (Fig. 2a and 2b) detected after incubation with zymosan was dependent on the clone of THP-1 cells under investigation.



View larger version (86K):
[in this window]
[in a new window]
 
Figure 2. Activation of NF-{kappa}B by zymosan but not latex. (A) NF-{kappa}B binding to the IL-8 promoter after incubation of THP-1 cells with zymosan or latex. 32P-labeled oligonucleotides containing the IL-8 NF-{kappa}B binding site were added to nuclear extracts from cells that were cultured in control medium alone (lanes C) or that had been incubated with either 1 mg/mL of zymosan (lanes Z) or 3-µ-diameter latex beads (lanes L). The lane labeled "mut" contained a nuclear extract from zymosan-stimulated (1 mg/mL, 2 h) cells incubated with a mutated NF-{kappa}B probe. Arrows indicate inducible NF-{kappa}B complexes. Nonspecific binding (NS) detected in the presence of excess unlabeled oligonucleotide and constitutive NF-{kappa}B nuclear binding activity (Constit) are also shown. (B) EMSAs of nuclear extracts from zymosan-stimulated THP-1 cells after addition of oligonucleotides containing either intact (lanes 1 and 2) or mutant (lanes 3–5) IL-8 NF-{kappa}B sites at 0.5, 2, or 4 h. Extracts harvested at 2 h were also incubated with a 50-fold excess of unlabeled, intact NF-{kappa}B probe (lane 6) or with excess mutant probe (lane 7). Inducible NF-{kappa}B binding is indicated by the arrow. All results shown are representative of three independent experiments.

Zymosan induced I{kappa}B{alpha} degradation but had no effect on processing of p105
Previous studies suggested that there are at least two mechanisms by which NF-{kappa}B is activated: via phosphorylation and removal of I{kappa}B [16 ] or through degradation of p105 to release p50 [18 ]. To investigate whether interaction with zymosan activated either or both of these mechanisms, THP-1 cells were incubated with either zymosan or LPS, a well-established NF-{kappa}B activator [30 , 31 ], and cytosolic extracts were analyzed by Western blotting. I{kappa}B{alpha} degradation (but not that of I{kappa}Bß, which was probed for at the same time) in response to zymosan as well as to the LPS-positive control was detectable at 1 h (Fig. 3 a). This preceded the peak NF-{kappa}B activity induced by zymosan, which occurred at 2 h. In contrast, no effect on p105 degradation was observed after incubation with zymosan (Fig. 3b) . In addition, no change in the level of p50 was observed in cytosolic extracts (Fig. 3b) or total-cell lysates (data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 3. Western blot analysis of I{kappa}B{alpha} and p105 degradation in human THP-1 cells after incubation with zymosan. Cytosolic extracts from THP-1 cells incubated with zymosan (1 mg/mL) or LPS (10 ng/mL; positive control) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, electrotransferred to membranes, and incubated with antibodies to I{kappa}B{alpha} or I{kappa}Bß (not detected) (a) or to p105/p50 (b). Lanes C0–C3, cells incubated with medium alone (negative control).

The NF-{kappa}B inhibitor gliotoxin abrogated zymosan-induced IL-8 mRNA synthesis in human PBMs
To further investigate the role of NF-{kappa}B, the specific inhibitor gliotoxin and the structurally related but functionally inactive control compound methyl gliotoxin were used [32 ]. A low concentration of gliotoxin was chosen so that NF-{kappa}B activity was blocked but the toxic and nonspecific effects of this fungal metabolite which occur at high concentrations were avoided [32 and references therein]. Gliotoxin, methyl gliotoxin (each at 0.1 µg/mL), or dimethyl sulfoxide (as a vehicle control) was added to human PBMs (5 x106 cells/mL). Cells were then incubated with either zymosan (1 mg/mL) or LPS (1 µg/mL) for 2 h, after which IL-8 mRNA was detected following reverse transcriptase PCR and dot blot hybridization (Fig. 4 ). Methyl gliotoxin had some nonspecific effects on LPS-stimulated cells; however, gliotoxin significantly inhibited IL-8 mRNA accumulation in response to zymosan stimulation for 2 h, but methyl gliotoxin did not (n=3; P<0.05).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. Effect of inhibition of NF-{kappa}B by gliotoxin on zymosan-induced IL-8 gene expression in human PBMs. Total RNA was extracted from cells pretreated for 30 min with gliotoxin, methyl gliotoxin (each at 100 ng/mL), or dimethyl sulfoxide (as a vehicle control) as shown and then incubated for 2 h with medium alone (open bars), 1 mg/mL of zymosan (closed bars), or 10 ng/mL of LPS (hatched bars). Oligo(dT)-purified RNA was probed with a 32P-labeled IL-8-specific probe and quantified by dot blot hybridization and phosphorimager analysis. The intensity of radioactivity detected by the IL-8 probe relative to that detected with a GAPDH probe is shown. Results are means ± SE of values from three independent experiments. Comparisons between stimulated cells pretreated with methyl gliotoxin or with gliotoxin are shown (*, P<0.05).

Effect of inhibition of PKA, PKC, and tyrosine kinases on zymosan-induced NF-{kappa}B binding activity
We next investigated specific upstream kinases, of potential importance in the regulation of IL-8 expression, after incubation with zymosan. Tyrosine kinases have been implicated as regulators of IL-8 secretion and as mediators of the effects of zymosan [2 , 3 ]. PKC and PKA have also been reported to control IL-8 synthesis [2 , 33 ]. We therefore pretreated cultures with various doses of genistein and erbstatin (broad-spectrum inhibitors of tyrosine kinases), the PKA inhibitor KT5720 [34 ], or the PKC inhibitor Calphostin C [35 ] and examined their effects on zymosan induction of NF-{kappa}B (Fig. 5 ). Pretreatment of cultures with 1–100 µM genistein, 0.05–1 µM Calphostin C, or 0.1––1 µM KT5720 did not affect NF-{kappa}B binding. In addition, none of these inhibitors affected IL-8 mRNA or protein secretion (data not shown).



View larger version (68K):
[in this window]
[in a new window]
 
Figure 5. The effect of kinase inhibitors on zymosan-stimulated NF-{kappa}B binding activity in nuclear extracts of THP-1 cells. Cells were incubated with 1 mg/mL of zymosan for 2 h (lanes 1–9) after pretreatment with vehicle alone (lane 1), genistein (lanes 2–4), Calphostin C (lanes 5–7), or KT5720 (lanes 8 and 9). Unstimulated cells in medium alone are shown in lane 10. Nuclear extracts were prepared, and EMSAs were performed as described in Materials and Methods. Data are representative of three separate experiments.

Role of MAPKs in zymosan-induced IL-8 mRNA accumulation
Recent studies of LPS- and Mycoplasma fermentans-stimulated THP-1 cells suggested that both the extracellular regulated kinase (Erk) 1/2 and the p38 mitogen-activated protein kinase (MAPK) pathways are involved in IL-8 synthesis [36 ], but to our knowledge no previous study has addressed the involvement of these enzymes in zymosan-inducted IL-8 gene expression. Therefore, cells were pretreated with the specific p38 MAPK inhibitor SB 203580 (5 µM) [37 ] or the Erk1/2 inhibitor PD 98059 (10 µM) [38 ] and then stimulated with zymosan or LPS for 18 h (Fig. 6 ). LPS-induced IL-8 gene expression was significantly inhibited by PD 98059, a result consistent with data obtained previously [36 ]. In contrast, zymosan-induced IL-8 mRNA accumulation was significantly reduced after inhibition of the p38 MAPK pathway by SB 203580 (n=4; P=0.05 relative to vehicle control). Although inhibiting the Erk1/2 MAPK pathway had a tendency to decrease zymosan-induced IL-8 mRNA accumulation, these changes were not significant.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 6. Effect of PD 98059 and SB 203580 on IL-8 mRNA accumulation in monocytic cells incubated with zymosan or LPS. THP-1 cells were pretreated for 30 min with either dimethyl sulfoxide (as a vehicle control), the Erk1/2 inhibitor PD 98059 (PD; 10 µM), or the p38 MAPK inhibitor SB 203580 (SB; 5 µM) and then incubated with either control medium (open bars), 1 mg/mL of zymosan (closed bars), or 10 ng/mL of LPS (hatched bars) for 18 h. Oligo(dT)-purified RNA was probed with a 32P-labeled IL-8-specific probe and quantified by dot blot hybridization and phosphorimager analysis. The intensity of radioactivity detected by IL-8 probe relative to that detected with a GAPDH probe is shown. Results are means ± SE of values from four separate experiments. Comparisons between stimulated cells pretreated with vehicle controls and those pretreated with MAPK inhibitors are shown (*, P<0.05).


arrow
DISCUSSION
 
It is crucial to define the mechanisms by which phagocytosis stimuli regulate IL-8 expression in order to understand how monocytes are activated to increase the recruitment of neutrophils and T cells to sites of infection and inflammation. The mechanisms regulating IL-8 synthesis have repeatedly been shown to be stimulus and cell type specific [14 , 39 , 40 ], and the regulatory pathways activated in monocytes by stimuli of phagocytosis have not been defined. In the present study, we showed that the mechanism regulating IL-8 secretion is dependent on the nature of the phagocytosis stimulus, although it may not be the actual process of phagocytosis but rather specific interactions of particulate stimuli with cell surface receptors that are critical. In these studies we have not distinguished between the binding of zymosan to its cell surface receptors and the process of phagocytosis, although we have verified that over the time course of the experiments the cells can phagocytose zymosan efficiently. Interaction with zymosan caused significantly higher levels of IL-8 secretion and mRNA accumulation than did stimulation with latex. Zymosan-induced IL-8 gene expression was NF-{kappa}B dependent; however, neither tyrosine kinases nor protein kinase C or A was involved in the regulation of this gene, although these kinases may be activated by zymosan [2 , 3 ]. None of these kinase inhibitors affected nuclear binding of NF-{kappa}B to the IL-8 promoter. In contrast, our data show that MAPK pathways are critical; there was a significant inhibition of zymosan-induced IL-8 mRNA accumulation after inhibition of p38 MAPK and a nonsignificant reduction after inhibition of Erk1/2 in monocytes.

The activation of NF-{kappa}B preceding IL-8 secretion induced by zymosan-stimulated monocytes correlates with data demonstrating that this family of transcription factors is crucial to LPS-induced, monocyte-derived IL-8 secretion [30 ]. The inability of phagocytosis of latex to activate NF-{kappa}B binding showed that the response was specific, being dependent on the nature of the particulate stimulus phagocytosed. The induction of NF-{kappa}B after interaction with zymosan occurred within 1 h, peaked at 2 h, and persisted up to 24 h, similar to the prolonged activation of NF-{kappa}B that we have observed in respiratory syncytial virus-infected human bronchial epithelial cells [17 ]. The different number of NF-{kappa}B-specific complexes detected after incubation with zymosan was a feature associated with the use of different clones of THP-1 cells. Although the explanation for these differences is unknown, the clones behaved in a similar manner in all the studies we describe. The NF-{kappa}B complexes that bind to the IL-8 promoter have previously been shown to comprise the p50 and p65 NF-{kappa}B proteins [14 ], a finding which we have confirmed (data not shown). Incubation of zymosan was associated with degradation of I{kappa}B{alpha} but not with the induction of proteasome-mediated degradation of p105, a response that has been described for TNF [18 ]. It is possible that p50 is processed from p105 constitutively, because neither stimulus had any effect on processing of the p50 precursor (Fig. 3b) .

Inhibition of NF-{kappa}B by gliotoxin abrogated zymosan-induced IL-8 secretion, demonstrating that binding of this transcription factor is functionally important, which is consistent with previous data obtained in studies of a variety of cell types [13 , 14 ]. However, there is one report, by Bondeson and colleagues, suggesting that zymosan-induced IL-8 synthesis in monocytes is NF-{kappa}B independent [41 ]. The reason for this apparent divergent finding may be that we observed delayed NF-{kappa}B activity that peaked at 2 h and Bondeson et al. studied nuclear translocation of NF-{kappa}B within 60 min of incubation with zymosan.

Signal transduction pathways leading to IL-8 gene expression, particularly those activated after phagocytosis, are poorly characterized. Although tyrosine phosphoproteins are involved in cytoskeletal changes that occur after interaction with zymosan [3 ], we found that these very early effects on the cytoskeleton do not influence the later onset of NF-{kappa}B binding (Fig. 5) or IL-8 mRNA accumulation (data not shown). This contrasts with the reported involvement of protein tyrosine kinases in IL-8 secretion after LPS stimulation of activated alveolar macrophages [31 ], further indicating the cell- and stimulus-specific nature of IL-8 secretion. However, the data on LPS regulation of IL-8 secretion are conflicting; LPS-dependent NF-{kappa}B activation was blocked by genistein and other tyrosine kinase inhibitors in a cell-free system [30 ], whereas NF-{kappa}B activation by LPS in Chinese hamster ovary cells transfected with human CD14 was reported to be independent of tyrosine kinase activity [42 ]. The data from this study also indicate that neither PKA nor PKC is involved in the regulation of zymosan-stimulated NF-{kappa}B activation.

The inhibition of IL-8 mRNA by SB 203580 indicates that p38 MAPK is important in the regulation of induction of gene expression after incubation with zymosan. An analogous critical role for this kinase has been demonstrated in LPS-induced cytokine expression in monocytes/macrophages [36 , 43 ] and IL-1- or TNF-induced IL-8 secretion [44 ]. The p38 MAPK pathway is not thought to exert its effect via direct inhibition of NF-{kappa}B binding. In LPS-stimulated THP-1 cells, SB 203580 decreased gene transcription through reduced binding of the TATA binding protein to the TATA box and through inhibition of the interaction of the TATA binding protein with the p65 subunit of NF-{kappa}B [43 ]. Our data also suggest that the Erk1/2 pathway might be involved in control of zymosan-induced IL-8 secretion, but because observed changes were not significant, this remains to be confirmed. In summary, the data demonstrate a central role for NF-{kappa}B activation, by a p105-independent mechanism, in driving IL-8 secretion in response to stimulation by zymosan but not by latex, indicating that the pathways that are activated after uptake of different stimuli of phagocytosis are distinct. Of the kinase-dependent mechanisms investigated, only inhibition of p38 MAPK significantly down-regulated IL-8 gene transcription after interaction with zymosan.


arrow
ACKNOWLEDGEMENTS
 
J. S. F. and T. C. S. were supported by The British Lung Foundation and The Welton Foundation. D. C. was supported by awards from the National Kidney Research Fund and Trent Health Authority. We thank Lei Zhao for technical assistance, Dr. Lorna Magowan for isolation of human monocytes from peripheral blood, and Anne Kane (Histopathology, Queens Medical Centre, Nottingham, United Kingdom) for photographic services.

Received January 13, 2001; revised April 16, 2001; accepted April 17, 2001.


arrow
REFERENCES
 
    1
  1. van Furth, R. (1998) Mononuclear phagocyte system Delves, P. J. Roitts, I. M. eds. Encyclopedia of Immunology ,1755-1758 Academic Press London.
  2. 2
  3. Sanguedolce, M. V., Capo, C., Bouhamadan, M., Bongrand, P., Huang, C. K., Mege, J. L. (1993) Zymosan-induced tyrosine phosphorylations in human monocytes Role of protein kinase C. J. Immunol 151,405-414
  4. 3
  5. Zaffran, Y., Escallier, J. C., Ruta, S., Capo, C., Mege, J. L. (1995) Zymosan-triggered association of tyrosine phosphoproteins and Lyn kinase with cytoskeleton in human monocytes J. Immunol 154,3488-3497[Abstract]
  6. 4
  7. Czop, J. K., Austen, K. F. (1985) Generation of leukotrienes by human monocytes upon stimulation of their beta-glucan receptor during phagocytosis Proc. Natl. Acad. Sci. USA 82,2751-2754[Abstract/Free Full Text]
  8. 5
  9. Poutsiaka, D. D., Mengozzi, M., Vannier, E., Sinha, B., Dinarello, C. A. (1993) Cross-linking of the ß-glucan receptor on human monocytes results in interleukin-1 receptor antagonist but not interleukin-1 production Blood 82,3695-3700[Abstract/Free Full Text]
  10. 6
  11. Sanguedolce, M. V., Capo, C., Bongrand, P., Mege, J. L. (1992) Zymosan-stimulated tumor necrosis factor-{alpha} production by human monocytes: down-modulation by phorbol ester J. Immunol 148,2229-2236[Abstract]
  12. 7
  13. Green, S. J., Crawford, R. M., Hockmeyer, J. T., Meltzer, M. S., Nacy, C. A. (1990) Leishmania major amastigotes initiate the L-arginine-dependent killing mechanism in IFN-{gamma}-stimulated macrophages by induction of tumor necrosis factor-{alpha} J. Immunol 145,4290-4297[Abstract]
  14. 8
  15. Ladel, C. H., Szalay, G., Reidel, D., Kaufmann, S. H. E. (1997) Interleukin-12 secretion by Mycobacterium tuberculosis-infected macrophages Infect. Immun 65,1936-1938[Abstract]
  16. 9
  17. Friedland, J. S., Remick, D. G., Shattock, R., Griffin, G. E. (1992) Secretion of interleukin-8 following phagocytosis of Mycobacterium tuberculosis by human monocyte cell lines Eur. J. Immunol 22,1373-1378[Medline]
  18. 10
  19. Baggiolini, M., Dewald, B., Moser, B. (1997) Human chemokines: an update Annu. Rev. Immunol 15,675-705[Medline]
  20. 11
  21. Gerszten, R. E., Garcia-Zepeda, E. A., Lim, Y.-C., Yoshida, M., Ding, H. A., Gimbrone, M. A., Jr, Luster, A. D., Luscinskas, F. W., Rosenzweig, A. (1999) MCP-1 and IL-8 trigger firm adhesion of monocytes to vascular endothelium under flow conditions Nature (London) 398,718-723[Medline]
  22. 12
  23. Hachicha, M., Rathanaswami, P., Naccache, H., McColl, S. R. (1998) Regulation of chemokine gene expression in human peripheral blood neutrophils phagocytosing microbial pathogens J. Immunol 160,449-454[Abstract/Free Full Text]
  24. 13
  25. Kunsch, C., Rosen, C. A. (1993) NF-{kappa}B subunit-specific regulation of the interleukin-8 promoter Mol. Cell. Biol 13,6137-6146[Abstract/Free Full Text]
  26. 14
  27. Mukaida, N., Okamoto, S.-i., Ishikawa, Y., Matsushima, K. (1994) Molecular mechanism of interleukin-8 gene expression J. Leukoc. Biol 56,554-558[Abstract]
  28. 15
  29. Mukaida, N., Shiroo, M., Matsushima, K. (1989) Genomic structure of the human monocyte-derived neutrophil chemotactic factor IL-8 J. Immunol 143,1366-1371[Abstract]
  30. 16
  31. Karin, M., Ben-Neriah, Y. (2000) Phosphorylation meets ubiquitination: the control of NF-kappa-B activity Annu. Rev. Immunol 18,621-663[Medline]
  32. 17
  33. Thomas, L. H., Friedland, J. S., Sharland, M., Becker, S. (1998) Respiratory syncytial virus-induced RANTES production from human bronchial epithelial cells is dependent on NF-{kappa}B nuclear binding and inhibited by adenovirus-mediated expression of I{kappa}B{alpha} J. Immunol 161,1007-1016[Abstract/Free Full Text]
  34. 18
  35. Belich, M. P., Salmeron, A., Johnston, L. H., Ley, S. C. (1999) TPL-2 kinase regulates the proteolysis of the NF-{kappa}B inhibitory protein NF-{kappa}B1 p105 Nature (London) 397,363-368[Medline]
  36. 19
  37. Vaingankar, S. M., Martins-Green, M. (1998) Thrombin activation of the 9E3/CEF4 chemokine involves tyrosine kinases including c-src and the epidermal growth factor receptor J. Biol. Chem 273,5226-5234[Abstract/Free Full Text]
  38. 20
  39. Tsuchiya, S., Yamahi, M., Yamaguchi, Y., Kobayashi, Y., Konno, T., Tada, K. (1980) Establishment and characterisation of a human acute monocytic leukemia cell line (THP-1) Int. J. Cancer 26,171-176[Medline]
  40. 21
  41. Hmama, Z., Nandan, D., Sly, L., Knutson, K. L., Herrera-Velit, P., Reiner, N. E. (1999) 1{alpha},25-Dihydroxyvitamin D3-induced myeloid cell differentiation is regulated by a vitamin D receptor-phosphatidylinositol 3-kinase signalling complex J. Exp. Med 190,1583-1594[Abstract/Free Full Text]
  42. 22
  43. Stylianou, E., O’Neill, L. A. J., Rawlinson, L., Edbrooke, M., Woo, P., Saklatvala, J. (1992) Interleukin 1 induces NF-kappa B through its type I but not its type II receptor in lymphocytes J. Biol. Chem 267,15836-15841[Abstract/Free Full Text]
  44. 23
  45. Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding Anal. Biochem 72,248-254[Medline]
  46. 24
  47. Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Anal. Biochem 162,156-159[Medline]
  48. 25
  49. Strieter, R. M., Kunkel, S. L., Showell, H. J., Remick, D. G., Phan, S. H., Ward, P. A., Marks, R. M. (1989) Endothelial cell gene expression of a neutrophil chemotactic factor by TNF-{alpha}, LPS and IL-1ß Science 243,1467-1469[Abstract/Free Full Text]
  50. 26
  51. Pertosa, G., Grandaliano, G., Gesualdo, L., Ranieri, E., Monno, R., Schena, F. P. (1998) Interleukin-6, interleukin-8 and monocyte chemotactic peptide-1 gene expression and protein synthesis are independently modulated by hemodialysis membranes Kidney Int 54,570-579[Medline]
  52. 27
  53. Kubin, M., Chow, J. M., Trinchieri, G. (1994) Differential regulation of interleukin-12 (IL-12), tumor necrosis factor alpha, and IL-1 beta production in human myeloid leukemia cell lines and peripheral blood mononuclear cells Blood 83,1847-1855[Abstract/Free Full Text]
  54. 28
  55. Lacraz, S., Isler, P., Vey, E., Welgus, H. G., Dayer, J.-M. (1994) Direct contact between T lymphocytes and monocytes is a major pathway for induction of metalloproteinase expression J. Biol. Chem 269,22027-22033[Abstract/Free Full Text]
  56. 29
  57. Stokes, R. W., Doxsee, D. (1999) The receptor-mediated uptake, survival, replication, and drug sensitivity of Mycobacterium tuberculosis within the macrophage-like cell line THP-1: a comparison with human monocyte-derived macrophages Cell. Immunol 197,1-9[Medline]
  58. 30
  59. Ishikawa, Y., Mukaida, N., Kuno, K., Rice, N., Okamoto, S., Matsushima, K. (1995) Establishment of lipopolysaccharide-dependent nuclear factor {kappa}B activation in a cell-free system J. Biol. Chem 270,4158-4164[Abstract/Free Full Text]
  60. 31
  61. Carter, A. B., Monick, M. M., Hunninghake, G. W. (1998) Lipopolysaccharide-induced NF-kappa B activation and cytokine release in human alveolar macrophages is PKC-independent and TK- and PC-PLC-dependent Am. J. Respir .Cell. Mol. Biol 18,384-391[Abstract/Free Full Text]
  62. 32
  63. Pahl, H. L., Kraub, B., Schulze-Osthoff, K., Decker, T., Traenckner, E. B.-M., Vogt, M., Myers, C., Parks, T., Warring, P., Muhlbacher, A., Czernilofsky, A.-P., Baeuerle, P. A. (1996) The immunosuppressive fungal metabolite gliotoxin specifically inhibits transcription factor NF{kappa}B J. Exp. Med 183,1829-1840[Abstract/Free Full Text]
  64. 33
  65. Ollivier, V., Parry, G. C. N., Cobb, R. R., de Prost, D., Mackman, N. (1996) Elevated cyclic AMP inhibits NF-{kappa}B-mediated transcription in human monocytic cells and endothelial cells J. Biol. Chem 271,20828-20835[Abstract/Free Full Text]
  66. 34
  67. Kase, H., Iwahashi, K., Nakanshi, S., Matsuda, Y., Yamada, K., Takahashi, M., Murakata, C., Sato, A., Kaneko, M. (1987) K-252 compounds, novel and potent inhibitors of protein kinase C and cyclic nucleotide-dependent protein kinases Biochem. Biophys. Res. Commun 142,436-440[Medline]
  68. 35
  69. Kobayashi, E., Nakano, H., Morimoto, M., Tamaoki, T. (1989) Calphostin C (UNC-1028C), a novel microbial compound, is a highly potent and specific inhibitor of protein kinase C Biochem. Biophys. Res. Commun 159,548-553[Medline]
  70. 36
  71. Marie, C., Roman-Roman, S., Rawadi, G. (1999) Involvement of mitogen-activated protein kinase pathways in interleukin-8 production by human monocytes and polymorphonuclear cells stimulated with lipopolysaccharide or Mycoplasma fermentans membrane lipoproteins Infect. Immun 67,688-693[Abstract/Free Full Text]
  72. 37
  73. Cuenda, A., Rouse, J., Doza, Y. N., Meier, R., Cohen, P., Gallagher, T. F., Young, P. R., Lee, J. C. (1995) SB 203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1 FEBS Lett 364,229-233[Medline]
  74. 38
  75. Alessi, D. R., Cuenda, A., Cohen, P., Dudley, D. T., Saltiel, A. R. (1995) PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo J. Biol. Chem 270,27489-27494[Abstract/Free Full Text]
  76. 39
  77. Chaudhary, L. R., Avioli, L.V. (1996) Regulation of interleukin-8 gene expression by interleukin-1ß, osteotropic hormones, and protein kinase inhibitors in normal human bone marrow stromal cells J. Biol. Chem 271,16591-16596[Abstract/Free Full Text]
  78. 40
  79. Gross, V., Andus, T., Daig, R., Aschenbrenner, E., Scholmerich, J., Falk, W. (1995) Regulation of interleukin-8 production in a human colon epithelial cell line (HT-29) Gastroenterology 108,653-661[Medline]
  80. 41
  81. Bondeson, J., Browne, K. A., Brennan, F. M., Foxwell, B. M., Feldmann, M. (1999) Selective regulation of cytokine induction by adenoviral gene transfer of I{kappa}B{alpha} into human macrophages: lipopolysaccharide-induced, but not zymosan-induced, proinflammatory cytokines are inhibited, but IL-10 is nuclear factor-{kappa}B independent J. Immunol 162,2939-2945[Abstract/Free Full Text]
  82. 42
  83. Delude, R. L., Fenton, M. J., Savedra, R., Perera, P. Y., Vogel, S. N., Thieringer, R., Golenbock, D. T. (1994) CD14-mediated translocation of nuclear factor-{kappa}B induced by lipopolysaccharide does not require tyrosine kinase activity J. Biol. Chem 269,22253-22260[Abstract/Free Full Text]
  84. 43
  85. Carter, A. B., Knudston, K. L., Monick, M. M., Hunninghake, G. W. (1999) The p38 mitogen activated protein kinase is required for NF{kappa}B dependent gene expression—the role of TATA binding protein (TBP) J. Biol. Chem 274,30858-30863[Abstract/Free Full Text]
  86. 44
  87. Holtmann, H., Winzen, R., Holland, P., Eickenmeier, S., Hoffmann, E., Wallach, D., Malinin, N. L., Cooper, J. A., Resch, K., Kracht, M. (1999) Induction of interleukin-8 synthesis integrates effects on transcription and mRNA degradation from at least three different cytokine- or stress-activated signal transduction pathways Mol. Cell. Biol 19,6742-6753[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
K. A. Gauss, L. K. Nelson-Overton, D. W. Siemsen, Y. Gao, F. R. DeLeo, and M. T. Quinn
Role of NF-{kappa}B in transcriptional regulation of the phagocyte NADPH oxidase by tumor necrosis factor-{alpha}
J. Leukoc. Biol., September 1, 2007; 82(3): 729 - 741.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. Legrand-Poels, G. Kustermans, F. Bex, E. Kremmer, T. A. Kufer, and J. Piette
Modulation of Nod2-dependent NF-{kappa}B signaling by the actin cytoskeleton
J. Cell Sci., April 1, 2007; 120(7): 1299 - 1310.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. M. Wright and J. S. Friedland
Regulation of monocyte chemokine and MMP-9 secretion by proinflammatory cytokines in tuberculous osteomyelitis
J. Leukoc. Biol., June 1, 2004; 75(6): 1086 - 1092.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
N. Osakabe, A. Yasuda, M. Natsume, and T. Yoshikawa
Rosmarinic acid inhibits epidermal inflammatory responses: anticarcinogenic effect of Perilla frutescens extract in the murine two-stage skin model
Carcinogenesis, April 1, 2004; 25(4): 549 - 557.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
S. Brickson, L. L. Ji, K. Schell, R. Olabisi, B. St. Pierre Schneider, and T. M. Best
M1/70 attenuates blood-borne neutrophil oxidants, activation, and myofiber damage following stretch injury
J Appl Physiol, September 1, 2003; 95(3): 969 - 976.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. V. Culpitt, D. F. Rogers, P. Shah, C. De Matos, R. E. K. Russell, L. E. Donnelly, and P. J. Barnes
Impaired Inhibition by Dexamethasone of Cytokine Release by Alveolar Macrophages from Patients with Chronic Obstructive Pulmonary Disease
Am. J. Respir. Crit. Care Med., January 1, 2003; 167(1): 24 - 31.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
E. Hoffmann, O. Dittrich-Breiholz, H. Holtmann, and M. Kracht
Multiple control of interleukin-8 gene expression
J. Leukoc. Biol., November 1, 2002; 72(5): 847 - 855.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
O. Lopez-Franco, Y. Suzuki, G. Sanjuan, J. Blanco, P. Hernandez-Vargas, Y. Yo, J. Kopp, J. Egido, and C. Gomez-Guerrero
Nuclear Factor-{kappa}B Inhibitors as Potential Novel Anti-Inflammatory Agents for the Treatment of Immune Glomerulonephritis
Am. J. Pathol., October 1, 2002; 161(4): 1497 - 1505.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Q. Xiao, K. Malcolm, G. S. Worthen, S. Gardai, W. P. Schiemann, V. A. Fadok, D. L. Bratton, and P. M. Henson
Cross-talk between ERK and p38 MAPK Mediates Selective Suppression of Pro-inflammatory Cytokines by Transforming Growth Factor-beta
J. Biol. Chem., April 19, 2002; 277(17): 14884 - 14893.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Friedland, J. S.
Right arrow Articles by Stylianou, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Friedland, J. S.
Right arrow Articles by Stylianou, E.