| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Infectious Diseases, Imperial College of Science, Technology and Medicine (Hammersmith Campus), London, and
School of Biomedical Sciences and Institute of Cell Signalling, University Hospital, Nottingham, United Kingdom
Correspondence: Dr. Eleni Stylianou, School of Biomedical Sciences, University Hospital, Nottingham, United Kingdom. E-mail: eleni.stylianou{at}nottingham.ac.uk
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B translocation to the nucleus was induced by zymosan but not
latex, indicating that its translocation is dependent on the nature of
the phagocytic stimulus. NFB activation coincided with IB
degradation but had no effect on processing of NFB1/p105, the
precursor of the NFB protein p50. The NFB inhibitor gliotoxin
abrogated zymosan-induced IL-8 synthesis in peripheral blood monocytes,
further demonstrating that the induction of IL-8 mRNA by zymosan is
NFB dependent. SB203580 inhibition of the p38 mitogen-activated
protein kinase (MAPK) pathway significantly decreased zymosan-induced
IL-8 mRNA accumulation. Inhibitors of protein kinases A and C or
tyrosine kinases had no significant effect on zymosan-induced IL-8
synthesis. These data indicate that p38 MAPK and NFB are critical in
controlling zymosan-induced IL-8 secretion.
Key Words: chemokine synthesis • MAPK • tyrosine kinase • protein kinase • NF-B activation
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
IL-8, the first member of the C-X-C family of chemokines to be
thoroughly characterized, is known to have a critical role in the
recruitment of neutrophils and T lymphocytes to regions of tissue
injury [10
]. In addition, it has recently been
demonstrated that IL-8 is involved in monocyte recruitment
[11
]. Phagocytosis of microbial pathogens is a potent
stimulus of IL-8 secretion from monocytic cells [9
] and
neutrophils [12
]. The 5'-flanking region of the IL-8
gene has been shown to contain a sequence spanning -133 bp -1 to
that is sufficient for transcriptional regulation of the gene
and that includes single nuclear factor B (NF-B) and activator
protein-1 (AP-1) elements as well as two
CCAAT-enhancer-binding-protein binding sites [14
,
15
]. Regulation of IL-8 secretion is dependent on the
activity of the NF-B family of Rel-related transcription factors in
many cell types [16
], but the mechanisms regulating
expression of the gene encoding this chemokine in monocytes are poorly
understood.
NF-B comprises specific heterodimeric complexes present in an
inactive form in the cytoplasm of resting cells, where each is bound to
one of the inhibitor IB proteins. Stimulus-induced activation of the
NF-B-inducing kinase leads to phosphorylation of the IB kinase
complex [reviewed in reference 16] followed by ubiquitination and
proteasome-mediated degradation of IB, which frees NF-B to
translocate to the nucleus. There it interacts with its target motifs
in the promoter regions of a large range of proinflammatory-protein
genes, including those regulating secretion of chemokines such as IL-8
[16
, 17
]. In addition, it has recently been
demonstrated that there are other pathways of NF-B activation. These
pathways involve phosphorylation of the precursor protein p105 by
Tpl2 kinase, which results in the release of p50 c-Rel or
RelA proteins for translocation to the nucleus [18
].
There are several signaling pathways that could potentially lead to
NF-B activation in monocytes phagocytosing zymosan. Zymosan triggers
the association of tyrosine phosphoproteins and Lyn kinase with the
cytoskeleton in human monocytes [3
], and activation of
tyrosine kinases has been implicated in secretion of 9E3, the chicken
homologue of IL-8 [19
]. In addition, activation of
protein kinase (PK) C after phagocytosis of zymosan by monocytes has
been shown to be important in the regulation of tumor necrosis factor
(TNF) secretion [6
].
The purpose of this study was to define the molecular events activated
by yeast-derived zymosan that lead to IL-8 gene expression. Therefore,
we investigated the involvement of NF-B and specific upstream kinase
pathways. We showed that interaction with zymosan, but not with inert
latex, led to NF-B-dependent IL-8 gene expression, indicating that
such activation is dependent on the nature of the phagocytosis
stimulus. Furthermore, gliotoxin, a specific NF-B inhibitor,
abrogated induction of IL-8 mRNA synthesis after incubation with
zymosan. Zymosan-dependent activation of NF-B occurs through the
degradation of IB but does not involve the degradation of p105
and is not regulated by tyrosine kinases, PKC, or PKA. In contrast, the
p38 mitogen-activated protein kinase signaling pathway is critical in
regulating zymosan-stimulated IL-8 gene expression.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B, IBß, and p105.
[
-32P]ATP (6,000 Ci/mmol) was obtained
from ICN Biomedicals Ltd. (Thame, U.K.), and T4 polynucleotide
kinase was purchased from Stratagene (Cambridge, United Kingdom).
Polytetrafluoroethylene-Teflon vials were acquired from Pierce &
Warriner (Chester, U.K.). Hybond N+ membranes for Northern
blotting were obtained from Amersham (Little Chalfont, U.K.). All other
reagents were purchased from Sigma Chemical Co.
Cell culture, experimental protocols, and use of inhibitors
The human phagocytic, monocytic THP-1 cell line and primary
monocytes were cultured in RPMI 1640 medium supplemented with 10%
endotoxin-free FCS, 2 mM glutamine, and 100 µg/mL of ampicillin and
kept at 37°C in a 5% CO2 atmosphere. Normal human
monocytes were obtained by adhesion purification of peripheral blood
mononuclear cells from blood buffy coat concentrates by density
gradient centrifugation over Ficoll-Paque.
Immediately before experiments, 107 THP-1 cells were suspended in fresh medium at a density of 2 x 105 to 5 x 105/mL. To induce expression of the LPS receptor CD14, THP-1 cells were treated with vitamin D3 for 48 h prior to incubation [21 ]. Cells were incubated with either inert 3-µm-diameter latex beads (as a negative particulate control), yeast-derived zymosan (1 mg/mL; boiled and washed seven times prior to use), or LPS (1 µg/mL; as a positive control). In experiments using inhibitors (employed at concentrations relating to their 50% inhibitory concentrations), these substances were added to the cultures 30 min before the stimulus was applied. At specific time points, cells were centrifuged at 1,300 g and 4°C for 5 min, and the pellet was homogenized in 300 µL of RNA extraction buffer [4 M guanidine thiocyanate, 25 mM Tris (pH 7.0), 0.5% N-lauroylsarcosine, and 0.1 M 2-mercaptoethanol]. The homogenates were stored at -80°C for subsequent RNA extraction. In experiments to be analyzed by electrophoretic mobility shift assay (EMSA), nuclear extracts were isolated immediately. Experiments using peripheral-blood-derived monocytes (PBMs) were performed in either six-well plates or 90-mm-diameter tissue culture petri dishes. The possibility of endotoxin contamination was routinely excluded by the use of endotoxin-free FCS and endotoxin-free plastics and by subjecting experimental samples to the Limulus amoebocyte assay.
Preparation of cytosolic and nuclear extracts
Nuclear and cytosolic extracts were prepared by modifications of
previously described procedures [22
]. Protein
concentration estimations were performed by a dye-binding assay
[23
]. Briefly, cells were washed in ice-cold
phosphate-buffered saline and scraped, on ice, into a hypotonic buffer
containing proteinase and phosphatase inhibitors [10 mM HEPES (pH
7.9), 1.5 mM MgCl2, 10 mM KCl, 50 µM dithiothreitol
(DTT); 100 µM phenanthroline, 1 µg/mL of pepstatin, 100 µM E64,
100 µM DCI, 10 mM NaF, 100 µM Na3VO4, and
25 mM ß-glycerophosphate]. Cells were then lysed by incubation for
10 min on ice in 60–80 µL of hypotonic buffer containing 0.2%
Nonidet P-40. Lysates were centrifuged at 10,000 g and 4°C
for 10 min, and supernatants were discarded. Pelleted nuclei were
resuspended in 60–80 µL of nuclear extract buffer [20 mM HEPES (pH
7.9), 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 25%
glycerol, and 100 µM DCI) and incubated at 4°C for 15 min. Lysed
nuclei were vortexed and then centrifuged (10,000 g at
4°C) for 10 min, and supernatants were snap-frozen through storage at
-80°C.
EMSAs
NF-B binding activity was detected with synthetic
oligonucleotide probes containing either the NF-B site of the IL-8
promoter (GTGGAATTTCCT) [15
] or a consensus mutant site
(CTCACTTTCC) [22
]. These probes were radiolabeled with
[-32P]ATP by using T4 polynucleotide
kinase for 20 min at 37°C. DNA-binding assays were performed in a
total volume of 20 µL containing the binding buffer [10 mM Tris-HCl
(pH 7.5), 100 mM NaCl, 1 mM EDTA, 4% (v/v) glycerol, 5 mM DTT, 1 mg/mL
of bovine serum albumin], the sample, 2 µL of
32P-labeled oligonucleotide, and 3 µg of poly(dI-dC), as
described previously [22
]. After being incubated for 15
min at room temperature, the samples were electrophoresed in a 5%
native polyacrylamide gel with 0.25x Tris-borate-EDTA. For competition
experiments, unlabeled oligonucleotides were incubated with extracts
for 5 min prior to addition of the radiolabeled probe. After
electrophoresis, the gels were dried and then autoradiographed.
RNA isolation and Northern blotting
RNA was extracted using modifications of previously described
techniques [24
]. In brief, RNA was extracted by a double
phenol-chloroform (1:1)/chloroform-isoamyl alcohol (24:1) method and
then precipitated overnight at -80°C in propan-2-ol. After
centrifugation at 10,000 g for 1 h, the precipitated
RNA was washed in 80% ethanol and resuspended in
diethylpyrocarbonate-treated double-distilled water. RNA (15-µg
aliquots) was electrophoresed in running buffer (which included
ethidium bromide) on denaturing formaldehyde–1% agarose gels at 120
V. For Northern blot analyses, RNA samples were blotted by capillary
action onto Hybond N+ membranes that were then fixed by
ultraviolet cross-linking.
For probing, Northern blots were prehybridized with 6x standard saline
citrate, 1x Denhardt’s solution, 0.5% sodium dodecyl sulfate, 0.05%
sodium pyrophosphate, 50 µg/mL of polyadenylic acid, and 100 µg/mL
of transfer RNA. These blots were then hybridized with
[-32P]-end-labeled oligonucleotide probes
for IL-8 or ß-actin [25
]. Blots were probed with
ß-actin, and the 18S and 28S ribosomal RNA bands were assessed to
verify uniform loading of RNA onto the gels. Autoradiography with
intensifying screens was performed at -70°C for 24–48 h.
Autoradiographs were scanned (Scanjet Iicx; Hewlett-Packard, Fort
Collins, CO) into a Power Macintosh 6100/60 computer (Apple Inc., Santa
Clara, CA) and were analyzed with Image 1.52 software (National
Institutes of Health, Bethesda, MD). Blots were stripped by heating
them for 1 h at 65°C in a solution consisting of 5 mM Tris-HCl
(pH 8.0), 2 mM disodium EDTA, and 0.1x Denhardt’s solution.
Reverse transcriptase-PCR and dot blot hybridization
Total RNA was extracted from human PBMs (5 x
106 cells/mL per well of a six-well plate) by using an
RNeasy Mini Kit (Qiagen, Crawley, United Kingdom). One microgram of
total RNA was reverse transcribed into cDNA by using oligo(dT) in 5x
first-strand buffer (Gibco BRL) supplemented with 5 mM each
deoxyribonucleoside triphosphate, 0.1 mM DTT. and 200 U/µL of
Superscript reagent (Gibco BRL). cDNA was amplified with the following
IL-8 primers: ATGACTTCCAAGCTGGCCGTGGCT (sense) and
TCTCAGCCCTCTTCAAAAACTTCTC (antisense) [26
]. Each primer
(0.1 nmol), together with the cDNA, was incubated in 10xx PCR buffer
supplemented with 1.5 mM MgCl2, 0.2 mM each deoxynucleoside
triphosphate, and 1 U of Taq DNA polymerase. Samples were
denatured at 95°C for 1.5 min, and annealing was performed at 60°C
(for IL-8) or at 55°C [for glyceraldehyde 3-phosphate dehydrogenase
(GAPDH)] for 1.5 min. Extension reactions were performed at 72°C for
1.5 min (30 cycles for IL-8 and 28 cycles for GAPDH). PCR samples were
then electrophoresed on 2% agarose gels in the buffer containing
ethidium bromide. For dot blot hybridization, the PCR products were
spotted on Hybond N+ membranes and hybridized with an
IL-8–specific, 32P-labeled probe
(GAGAGTGGACCACACTGCGCCAAC). Membranes were washed in 2x SSPE [1x
SSPE is 0.18 M NaCl, 10 mM NaH2PO4, and 1 mM
EDTA (pH 7.7)] and then in 5x SSPE, each containing 0.1% sodium
dodecyl sulfate, and then autoradiographed. The intensities of
radioactive spots obtained with the IL-8 probe relative to those
obtained with the GAPDH probe were quantified on a phosphorimager
(FLA-2000; Fujifilm).
Quantification of IL-8 protein secretion
IL-8 concentrations in THP-1 or human peripheral blood cell
culture supernatants were measured by a specific enzyme-linked
immunosorbent assay, using matched-pair antibodies and recombinant
standards from R*D Systems Europe Ltd. (Oxon, United Kingdom). The
lower limit of sensitivity of the assays was 15 pg/mL.
Statistical analysis
The data presented are the means ± SE of
values from at least three independent experiments. Statistical
comparisons between multiple groups were performed by analysis of
variance, and a P value of <0.05 was considered
statistically significant.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
1 log order
of magnitude lower than those induced by zymosan.
|
B by phagocytosis stimuliB by
distinct stimuli of phagocytosis may, in part, explain the differences
in IL-8 secretion in response to zymosan and to latex, nuclear protein
extracts were prepared from THP-1 cells, and EMSAs were performed with
an oligonucleotide containing the NF-B site in the human IL-8 gene
promoter [15
] (Fig. 2
a). Zymosan induced NF-B binding, which was detectable at 1 h, peaked at 2 h, and persisted up to 24 h. Latex did not activate
NF-B. The time course of induction paralleled the accumulation of
IL-8 mRNA after stimulation by zymosan in human monocytes (Fig. 1c)
.
Incubation of nuclear extracts with a mutant probe indicated that
zymosan induced specific NF-B binding activity (Fig. 2a
and 2b)
. The
mutant probe detected one nonspecific complex and a constitutive
complex. To further confirm the specificity of NF-B complexes, we
demonstrated a lack of binding to the mutated B probe after
stimulation by zymosan and determined that excess unlabeled wild-type
probe but not excess mutant probe blocked binding of the labeled IL-8
NF-B-specific oligonucleotide (Fig. 2b)
. The number of
NF-B-specific complexes (Fig. 2a
and 2b)
detected after incubation
with zymosan was dependent on the clone of THP-1 cells under
investigation.
|
B degradation but had no effect on
processing of p105B is activated: via phosphorylation and removal of IB
[16
] or through degradation of p105 to release p50
[18
]. To investigate whether interaction with zymosan
activated either or both of these mechanisms, THP-1 cells were
incubated with either zymosan or LPS, a well-established NF-B
activator [30
, 31
], and cytosolic extracts
were analyzed by Western blotting. IB degradation (but not that
of IBß, which was probed for at the same time) in response to
zymosan as well as to the LPS-positive control was detectable at 1 h (Fig. 3
a). This preceded the peak NF-B activity induced by zymosan,
which occurred at 2 h. In contrast, no effect on p105 degradation
was observed after incubation with zymosan (Fig. 3b)
. In addition, no
change in the level of p50 was observed in cytosolic extracts
(Fig. 3b) or total-cell lysates (data not shown).
|
B inhibitor gliotoxin abrogated zymosan-induced IL-8 mRNA
synthesis in human PBMsB, the specific inhibitor
gliotoxin and the structurally related but functionally inactive
control compound methyl gliotoxin were used [32
]. A low
concentration of gliotoxin was chosen so that NF-B activity was
blocked but the toxic and nonspecific effects of this fungal metabolite
which occur at high concentrations were avoided [32 and references
therein]. Gliotoxin, methyl gliotoxin (each at 0.1 µg/mL), or
dimethyl sulfoxide (as a vehicle control) was added to human PBMs
(5 x106 cells/mL). Cells were then incubated with
either zymosan (1 mg/mL) or LPS (1 µg/mL) for 2 h, after which
IL-8 mRNA was detected following reverse transcriptase PCR and dot blot
hybridization (Fig. 4
). Methyl gliotoxin had some nonspecific effects on LPS-stimulated
cells; however, gliotoxin significantly inhibited IL-8 mRNA
accumulation in response to zymosan stimulation for 2 h, but
methyl gliotoxin did not (n=3; P<0.05).
|
B binding activityB (Fig. 5
). Pretreatment of cultures with 1–100 µM genistein, 0.05–1
µM Calphostin C, or 0.1––1 µM KT5720 did not affect NF-B
binding. In addition, none of these inhibitors affected IL-8 mRNA or
protein secretion (data not shown).
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B dependent; however, neither tyrosine kinases nor protein kinase
C or A was involved in the regulation of this gene, although these
kinases may be activated by zymosan [2
, 3
].
None of these kinase inhibitors affected nuclear binding of NF-B to
the IL-8 promoter. In contrast, our data show that MAPK pathways are
critical; there was a significant inhibition of zymosan-induced IL-8
mRNA accumulation after inhibition of p38 MAPK and a nonsignificant
reduction after inhibition of Erk1/2 in monocytes.
The activation of NF-B preceding IL-8 secretion induced by
zymosan-stimulated monocytes correlates with data demonstrating that
this family of transcription factors is crucial to LPS-induced,
monocyte-derived IL-8 secretion [30
]. The inability of
phagocytosis of latex to activate NF-B binding showed that the
response was specific, being dependent on the nature of the particulate
stimulus phagocytosed. The induction of NF-B after interaction with
zymosan occurred within 1 h, peaked at 2 h, and persisted up
to 24 h, similar to the prolonged activation of NF-B that we have
observed in respiratory syncytial virus-infected human bronchial
epithelial cells [17
]. The different number of
NF-B-specific complexes detected after incubation with zymosan was a
feature associated with the use of different clones of THP-1 cells.
Although the explanation for these differences is unknown, the clones
behaved in a similar manner in all the studies we describe. The NF-B
complexes that bind to the IL-8 promoter have previously been shown to
comprise the p50 and p65 NF-B proteins [14
], a
finding which we have confirmed (data not shown). Incubation of zymosan
was associated with degradation of IB but not with the induction
of proteasome-mediated degradation of p105, a response that has been
described for TNF [18
]. It is possible that p50 is
processed from p105 constitutively, because neither stimulus had any
effect on processing of the p50 precursor (Fig. 3b)
.
Inhibition of NF-B by gliotoxin abrogated zymosan-induced IL-8
secretion, demonstrating that binding of this transcription factor is
functionally important, which is consistent with previous data obtained
in studies of a variety of cell types [13
,
14
]. However, there is one report, by Bondeson and
colleagues, suggesting that zymosan-induced IL-8 synthesis in monocytes
is NF-B independent [41
]. The reason for this
apparent divergent finding may be that we observed delayed NF-B
activity that peaked at 2 h and Bondeson et al. studied nuclear
translocation of NF-B within 60 min of incubation with zymosan.
Signal transduction pathways leading to IL-8 gene expression,
particularly those activated after phagocytosis, are poorly
characterized. Although tyrosine phosphoproteins are involved in
cytoskeletal changes that occur after interaction with zymosan
[3
], we found that these very early effects on the
cytoskeleton do not influence the later onset of NF-B binding (Fig. 5)
or IL-8 mRNA accumulation (data not shown). This contrasts with the
reported involvement of protein tyrosine kinases in IL-8 secretion
after LPS stimulation of activated alveolar macrophages
[31
], further indicating the cell- and stimulus-specific
nature of IL-8 secretion. However, the data on LPS regulation of IL-8
secretion are conflicting; LPS-dependent NF-B activation was blocked
by genistein and other tyrosine kinase inhibitors in a cell-free system
[30
], whereas NF-B activation by LPS in Chinese
hamster ovary cells transfected with human CD14 was reported to be
independent of tyrosine kinase activity [42
]. The data
from this study also indicate that neither PKA nor PKC is involved in
the regulation of zymosan-stimulated NF-B activation.
The inhibition of IL-8 mRNA by SB 203580 indicates that p38 MAPK is
important in the regulation of induction of gene expression after
incubation with zymosan. An analogous critical role for this kinase has
been demonstrated in LPS-induced cytokine expression in
monocytes/macrophages [36
, 43
] and IL-1- or
TNF-induced IL-8 secretion [44
]. The p38 MAPK pathway is
not thought to exert its effect via direct inhibition of NF-B
binding. In LPS-stimulated THP-1 cells, SB 203580 decreased gene
transcription through reduced binding of the TATA binding protein to
the TATA box and through inhibition of the interaction of the TATA
binding protein with the p65 subunit of NF-B [43
].
Our data also suggest that the Erk1/2 pathway might be involved in
control of zymosan-induced IL-8 secretion, but because observed changes
were not significant, this remains to be confirmed. In summary, the
data demonstrate a central role for NF-B activation, by a
p105-independent mechanism, in driving IL-8 secretion in response to
stimulation by zymosan but not by latex, indicating that the pathways
that are activated after uptake of different stimuli of phagocytosis
are distinct. Of the kinase-dependent mechanisms investigated, only
inhibition of p38 MAPK significantly down-regulated IL-8 gene
transcription after interaction with zymosan.
|
ACKNOWLEDGEMENTS |
|---|
Received January 13, 2001; revised April 16, 2001; accepted April 17, 2001.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
production by human monocytes: down-modulation by phorbol ester J. Immunol 148,2229-2236[Abstract]
-stimulated macrophages by induction of tumor necrosis factor- J. Immunol 145,4290-4297[Abstract]
B subunit-specific regulation of the interleukin-8 promoter Mol. Cell. Biol 13,6137-6146B nuclear binding and inhibited by adenovirus-mediated expression of IB J. Immunol 161,1007-1016B inhibitory protein NF-B1 p105 Nature (London) 397,363-368[Medline]
,25-Dihydroxyvitamin D3-induced myeloid cell differentiation is regulated by a vitamin D receptor-phosphatidylinositol 3-kinase signalling complex J. Exp. Med 190,1583-1594, LPS and IL-1ß Science 243,1467-1469B activation in a cell-free system J. Biol. Chem 270,4158-4164B J. Exp. Med 183,1829-1840B-mediated transcription in human monocytic cells and endothelial cells J. Biol. Chem 271,20828-20835B into human macrophages: lipopolysaccharide-induced, but not zymosan-induced, proinflammatory cytokines are inhibited, but IL-10 is nuclear factor-B independent J. Immunol 162,2939-2945B induced by lipopolysaccharide does not require tyrosine kinase activity J. Biol. Chem 269,22253-22260B dependent gene expression—the role of TATA binding protein (TBP) J. Biol. Chem 274,30858-30863This article has been cited by other articles:
|
|
 |
|
  K. A. Gauss, L. K. Nelson-Overton, D. W. Siemsen, Y. Gao, F. R. DeLeo, and M. T. Quinn Role of NF-{kappa}B in transcriptional regulation of the phagocyte NADPH oxidase by tumor necrosis factor-{alpha} J. Leukoc. Biol., September 1, 2007; 82(3): 729 - 741. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Legrand-Poels, G. Kustermans, F. Bex, E. Kremmer, T. A. Kufer, and J. Piette Modulation of Nod2-dependent NF-{kappa}B signaling by the actin cytoskeleton J. Cell Sci., April 1, 2007; 120(7): 1299 - 1310. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. M. Wright and J. S. Friedland Regulation of monocyte chemokine and MMP-9 secretion by proinflammatory cytokines in tuberculous osteomyelitis J. Leukoc. Biol., June 1, 2004; 75(6): 1086 - 1092. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Osakabe, A. Yasuda, M. Natsume, and T. Yoshikawa Rosmarinic acid inhibits epidermal inflammatory responses: anticarcinogenic effect of Perilla frutescens extract in the murine two-stage skin model Carcinogenesis, April 1, 2004; 25(4): 549 - 557. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Brickson, L. L. Ji, K. Schell, R. Olabisi, B. St. Pierre Schneider, and T. M. Best M1/70 attenuates blood-borne neutrophil oxidants, activation, and myofiber damage following stretch injury J Appl Physiol, September 1, 2003; 95(3): 969 - 976. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. V. Culpitt, D. F. Rogers, P. Shah, C. De Matos, R. E. K. Russell, L. E. Donnelly, and P. J. Barnes Impaired Inhibition by Dexamethasone of Cytokine Release by Alveolar Macrophages from Patients with Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., January 1, 2003; 167(1): 24 - 31. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Hoffmann, O. Dittrich-Breiholz, H. Holtmann, and M. Kracht Multiple control of interleukin-8 gene expression J. Leukoc. Biol., November 1, 2002; 72(5): 847 - 855. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Lopez-Franco, Y. Suzuki, G. Sanjuan, J. Blanco, P. Hernandez-Vargas, Y. Yo, J. Kopp, J. Egido, and C. Gomez-Guerrero Nuclear Factor-{kappa}B Inhibitors as Potential Novel Anti-Inflammatory Agents for the Treatment of Immune Glomerulonephritis Am. J. Pathol., October 1, 2002; 161(4): 1497 - 1505. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Q. Xiao, K. Malcolm, G. S. Worthen, S. Gardai, W. P. Schiemann, V. A. Fadok, D. L. Bratton, and P. M. Henson Cross-talk between ERK and p38 MAPK Mediates Selective Suppression of Pro-inflammatory Cytokines by Transforming Growth Factor-beta J. Biol. Chem., April 19, 2002; 277(17): 14884 - 14893. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
