science pharmaceutical expo biotech jobs

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mukai, T.
Right arrow Articles by Hamaoka, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mukai, T.
Right arrow Articles by Hamaoka, T.
(Journal of Leukocyte Biology. 2001;70:422-430.)
© 2001 by Society for Leukocyte Biology

IL-12 plays a pivotal role in LFA-1-mediated T cell adhesiveness by up-regulation of CCR5 expression

Takao Mukai*, Masayuki Iwasaki*, Ping Gao*, Michio Tomura*, Yumi Yashiro-Ohtani*, Shiro Ono*, Masako Murai{dagger}, Kouji Matsushima{dagger}, Masashi Kurimoto{ddagger}, Mikihiko Kogo§, Tokuzo Matsuya§, Hiromi Fujiwara* and Toshiyuki Hamaoka*

* Department of Oncology, Biomedical Research Center, Osaka University Graduate School of Medicine, 2-2 Yamada-oka, and
§ Division of Pathogenesis and Control of Oral Diseases, Graduate School of Dentistry, Osaka University, Suita, Osaka;
{dagger} Department of Molecular Preventive Medicine, The University of Tokyo, Faculty of Medicine; and
{ddagger} Fujisaki Institute, Hayashibara Biochemical Laboratories, Okayama, Japan

Correspondence: Dr. Hiromi Fujiwara, Department of Oncology, Biomedical Research Center, Osaka University Graduate School of Medicine, 2-2 Yamada-oka, Suita, Osaka 565-0871, Japan. E-mail: hf{at}ongene.med.osaka-u.ac.jp


arrow
ABSTRACT
 
The chemokine receptor CCR5 has been implicated in the recruitment of T cells to inflammatory sites. However, the regulation of CCR5 induction on T cells and its contribution to T cell adhesiveness are poorly understood. Using a Th1 clone, 2D6, that can be maintained with interleukin (IL)-12 or IL-2 alone (designated 2D6IL-12 or 2D6IL-2, respectively), we investigated how CCR5 is induced on T cells and whether CCR5 is responsible for up-regulating the function of adhesion molecules. 2D6IL-12 grew, forming cell aggregates, in culture containing IL-12. This was due to lymphocyte function-associated antigen (LFA)-1–intercellular adhesion molecule (ICAM)-1 interaction, because 2D6IL-12 expressed both LFA-1 and ICAM-1 and cell aggregation was inhibited by anti-ICAM-1 monoclonal antibody. Despite comparable levels of LFA-1 and ICAM-1 expression, 2D6IL-2 cells did not aggregate in culture with IL-2. It is important that there was a critical difference in CCR5 expression between 2D6IL-12 and 2D6IL-2; the former expressed high levels of CCR5, and the latter expressed only marginal levels. Both types of cells expressed detectable albeit low levels of RANTES (regulated on activation, normal T expressed and secreted) mRNA. Unlike IL-12 or IL-2, IL-18 induced high levels of RANTES mRNA expression without modulating CCR5 expression. Therefore, combined stimulation with IL-12 and IL-18 strikingly up-regulated 2D6 cell aggregation. Notably, LFA-1-mediated aggregation of 2D6IL-12 cells was suppressed by anti-CCR5 antibody. These results indicate that IL-12 plays a critical role in CCR5 expression on Th1 cells and consequently contributes to CCR5-mediated activation of LFA-1 molecules.

Key Words: chemokine • chemokine receptor • adhesion molecule


arrow
INTRODUCTION
 
Chemokines and chemokine receptors are involved in the regulation of lymphocyte recruitment to inflammatory/infectious sites in many pathological situations [1 2 3 ]. This regulation rests on the ability of chemokines to induce affinity modulation of integrin adhesion molecules expressed on lymphocytes [4 , 5 ]. Chemokine receptor expression on a given population of lymphocytes and stimulation with the relevant chemokine(s) lead to up-regulation of the adhesive capacity in these cells [4 5 6 7 8 ].

Within the T cell lineage, the expression of several chemokine receptors appears to be restricted to activated and memory (CD45RO+) types of cells [9 , 10 ]. Among these, CCR5 has been regarded as characteristic of CD4+ Th1 lymphocytes [11 12 13 ] and implicated in the recruitment of Th1 cells to inflammatory sites [9 , 10 ]. Regarding CCR5 expression on T cells, there are only a few studies on human T cells [14 , 15 ]. CCR5 expression was shown to be up-regulated on CD45RO+ human memory T cells after treatment with recombinant interleukin (rIL)-2. However, these studies revealed that memory T cells express CCR5 only after long-term (>8-day) exposure to IL-2 [14 , 15 ]. Therefore, it is unclear whether IL-2 can provide memory T cells with a signal capable of directly inducing CCR5. It also remains to be determined which signals can induce CCR5 on T cells in the activated state, such as Th1 clones and T cells recently triggered by T-cell receptor, and whether CCR5 induced by such signals functions to activate adhesion molecules expressed on these T cells.

Previously, we established an IL-12-responsive T cell clone, 2D6 [16 ], by maintaining an alloreactive Th1 clone in culture containing rIL-12 alone instead of allogeneic antigen-presenting cells (APCs). Our previous study [16 ] showed that the 2D6 clone expresses both lymphocyte function-associated antigen (LFA)-1 and intercellular adhesion molecule (ICAM)-1 and exhibits cell-to-cell adhesion via these adhesion molecules. Using this clone, we investigated whether 2D6 cells maintained with IL-12 (2D6IL-12 cells) express CCR5 and, if so, whether CCR5 functions to activate LFA-1 on 2D6 cells and induce cell-to-cell adhesion. 2D6 cells could also be maintained with IL-2 (2D6IL-2). The standard 2D6IL-12 cells and the 2D6IL-2 cells expressed comparable levels of LFA-1 and ICAM-1; however, 2D6IL-2 cells did not aggregate. 2D6IL-12 and 2D6IL-2 expressed high and only marginal levels of CCR5, respectively, although there was no substantial difference in the expression of CCR5-reactive chemokines between these two cell types. The adhesiveness of 2D6IL-12 cells was also found to be suppressed in the presence of anti-CCR5 antibody (Ab). These results indicate that IL-12 plays a critical role in inducing the expression of CCR5 on Th1 cells and, through such a role, contributes to up-regulation of LFA-1-mediated cellular adhesiveness.


arrow
MATERIALS AND METHODS
 
Cell line
The IL-12-responsive T cell clone 2D6 [16 ] was established by maintaining alloreactive 4-86 Th cells [17 ] in the presence of rIL-12 alone without stimulation with allogeneic APCs. 2D6 exhibited high levels of proliferation in response to as little as 1 pg/mL of rIL-12 [16 ]. 2D6 cells maintained with rIL-12 (250 pg/mL) were used after intensive washing as the standard IL-12-dependent 2D6. 2D6 cells maintained with rIL-2 (50 U/mL) instead of rIL-12 for 1–20 passages were used as an IL-2-supported subline. This subline was designated 2D6IL-2, and the standard line was designated 2D6IL-12 for distinction.

Reagents
Mouse rIL-12 and rIL-18 were provided by Genetics Institute, Inc., Cambridge, MA, and Hayashibara Biochemical Laboratories, Okayama, Japan, respectively. Mouse rIL-2 was kindly provided by Shionogi Co. Ltd. (Osaka, Japan). Anti-LFA-1 (M17/5.2) [18 ] and anti-ICAM-1 (UN1/1.7.4) [19 ] hybridomas were purchased from the American Type Culture Collection, Manassas, VA, and each monoclonal Ab (mAb) was purified from the respective ascitic fluids. Rabbit anti-mouse CCR5 Ab was prepared as previously described [20 ]. Briefly, rabbits were immunized with glutathione S-transferase protein conjugated to the NH2 terminus of CCR5, and sera were fractionated to obtain the immunoglobulin (Ig) G fraction using a protein A-agarose column. Phycoerythrin (PE)-conjugated anti-mouse CCR5 mAb was obtained from PharMingen (San Diego, CA). Biotinylated mouse anti-rat IgG and biotinylated goat anti-rabbit IgG were purchased from Jackson ImmunoResearch, (West Grove, PA). Control rat IgG and rabbit IgG were obtained from Biomeda (Foster City, CA) and Jackson ImmunoResearch, respectively. PE-conjugated streptavidin was from Becton Dickinson (Mountain View, CA). The following recombinant chemokine preparations and anti-chemokine Abs were purchased: mouse macrophage-inflammatory protein (MIP)-1{alpha}, RANTES (regulated on activation, normal T expressed and secreted), and MIP-1ß (R & D Systems, Minneapolis, MN); goat anti-mouse MIP-1{alpha}, anti-mouse RANTES, and anti-mouse MIP-1ß Abs (R & D Systems); fluorescein isothiocyanate (FITC)-conjugated donkey anti-goat Ig (Chemicon Inc., Temecula, CA); and normal goat Ig (R & D Systems).

Immunofluorescence and flow cytometry
Cell surface CCR5 was detected by three methods. The first involved application of the flow-cytometric-assay protocol used to identify cells expressing cytokine receptors such as interferon-{gamma} receptor (IFN-{gamma}R) [21 ] and IL-12R [16 ] to the detection of CCR5 as the binding receptor of MIP-1{alpha} or RANTES. Briefly, 106 2D6 cells were incubated with 100 nM rMIP-1{alpha} or rRANTES in 10 µL of phosphate-buffered saline (PBS) for 60 min at 4°C. After washing, cells were allowed to react with 1 µg of goat anti-MIP-1{alpha} or RANTES Ig followed by incubation with FITC-conjugated donkey anti-goat Ig. The second method was incubation of 2D6 cells with rabbit anti-mouse CCR5 polyclonal Ab followed by biotinylated goat anti-rabbit Ig and PE-conjugated streptavidin. The third method was direct staining of 2D6 cells with PE-conjugated anti-mouse CCR5 mAb. LFA-1 and ICAM-1 were stained by incubating cells with the first Ab (specific mAb) for 20 min and then with biotinylated mouse anti-rat IgG for an additional 20 min, followed by incubation with PE-conjugated streptavidin. Stained cells were analyzed with a FACSCalibur (Becton Dickinson).

Reverse transcription-PCR (RT-PCR)
Total RNA was prepared from cytokine-stimulated T cells by the acid guanidium thiocyanate-phenol-chloroform method. Total RNA (1 µg) was reverse transcribed into cDNA in a total volume of 20 µL using random primers and SUPERSCRIPTTM RNase H- reverse transcriptase (Life Technologies, Rockville, MD). PCR amplification was carried out in a total volume of 50 µL of PCR buffer (x1) (TaKaRa, Otsu, Japan) containing 1.0 µL of the first-strand cDNA, 0.25 mM each deoxynucleotide triphosphate, 2 µM each primer, and 2.5 U of Taq DNA polymerase (TaKaRa). The following oligonucleotides were used: mouse CCR5 sense primer, 5'-GGATTTTCAAGGGTCAGTTC-3'; CCR5 antisense primer, 5'-AACCTTCTTTCTGAGATCTGG-3'; mouse ß-actin sense primer, 5'-GTGGGCCGCTCTAGGCACCAA-3'; and ß-actin antisense primer, 5'-CTCTTTGATGTCACGCACGATTTC-3'. Cycle parameters were as follows: annealing for 1 min at 60°C (CCR5) or 55°C (ß-actin), elongation for 2 min at 72°C, and denaturation for 1 min at 94°C. The resulting PCR products were separated in a 1% agarose gel and visualized by ethidium bromide staining. Sequences of CCR5 and ß-actin (for standardization) were amplified out of each cDNA batch with 25 and 23 amplification cycles, respectively.

cDNA probes
CCR5, CXCR3, and RANTES cDNAs were cloned from purified mouse lymph node cells that were activated for 48 h with immobilized anti-CD3 (5 µg/mL) and soluble anti-CD28 (2 µg/mL) in the presence of 250 pg/mL of mouse rIL-12. CCR1 cDNA was cloned from unfractionated spleen cells that were treated for 48 h with 5 µg/mL of concanavalin A, harvested, and then restimulated for 48 h with 100 U/mL of mouse rIL-2. MIP-1{alpha} and MIP-1ß cDNAs were cloned from cells of the mouse macrophage cell line RAW 264 that had been treated for 12 h with 100 pg/mL of lipopolysaccharide (Escherichia coli O127:B8; Difco Laboratories, Detroit, MI). RNAs isolated from the above cells were used as templates for first-strand cDNA synthesis. The mouse CCR5, CCR1, CXCR3, MIP-1{alpha}, MIP-1ß, and RANTES coding sequences were cloned from these cDNAs by use of Taq DNA polymerase, standard PCR conditions, and the following primers: for CCR5, a 5' sense oligonucleotide GGATTTTCAAGGGTCAGTTC and a 3' antisense oligonucleotide AACCTTCTTTCTGAGATCTGG based on sequences 77–96 and 580–600, respectively, from the sequence of CCR5 [22 ]; for CCR1, a 5' sense oligonucleotide ATGGAGATTTCAGATTTCACAG and a 3' antisense oligonucleotide TCAGAAGCCAGCAGAGAG based on sequences 1–22 and 1051–1068, respectively, from the sequence of CCR1 [23 ]; for CXCR3, a 5' sense oligonucleotide GCTAGATGCCTCGGACTTTG and a 3' antisense oligonucleotide GCTGATCGTAGTTGGCTGATA based on sequences 30–49 and 566–589, respectively, from the sequence of CXCR3 [24 ]; for MIP-1{alpha}, a 5' sense oligonucleotide TGACACTCTGCAACCAAGTC and a 3' antisense oligonucleotide GAACGTGTCCTGAAGTCTTTC based on sequences 114–133 and 589–609, respectively, from the sequence of MIP-1{alpha} [25 ]; for MIP-1ß, a 5' sense oligonucleotide TGGATTACTATGAGACCAGCA and a 3' antisense oligonucleotide CAGTCATATCCACAATAGCAGA based on sequences 208–228 and 574–595, respectively, from the sequence of MIP-1ß [26 ]; and for RANTES, a 5' sense oligonucleotide AGCTGCCCTCACCATCATC and a 3' antisense oligonucleotide GTATTCTTGAACCCACTTCTTC based on sequences 54–72 and 270–291, respectively, from the sequence of RANTES [27 ]. The PCR products were purified by agarose gel electrophoresis and ligated to the T vector as described [28 ]. Briefly, the Bluescript (Stratagene, La Jolla, CA) plasmid was digested with EcoRV and incubated with Taq polymerase under standard buffer conditions in the presence of 2 mM deoxyribosylthymine triphosphate for 2 h at 70°C. After phenol extraction and precipitation, the T vector was ready for cloning. PCR products were then ligated to the vector. cDNA for ß2 microglobulin was kindly provided by Dr. Takeshi Tokuhisa (Chiba University Medical School, Japan).

Measurement of mRNA expression by RNase protection assay
Total cellular RNA was isolated by the acid guanidium thiocyanate-phenol-chloroform method, and mRNA levels were determined using the RNase protection assay according to the procedure previously described [29 ]. Briefly, 10 µg of total cellular RNA was hybridized in solution to a 32P-labeled antisense riboprobe overnight at 50°C in 80% formamide. The plasmid was linearized with HinfI (CCR5), Hinc II (CCR1), HpaI (CXCR3), AvaII (MIP-1{alpha}), BglII (MIP-1ß), and FokI (RANTES), and in vitro transcription was performed in the presence of [{alpha}-32P]uridine triphosphate. The protected fragment (172 bp for CCR5, 179 bp for CCR1, 279 bp for CXCR3, 216 bp for MIP-1{alpha}, 313 bp for MIP-1ß, and 232 bp for RANTES) was separated on a denaturing sequencing gel. As an internal control for the amount of RNA loaded onto the gel, RNA was simultaneously hybridized to an antisense 32P-labeled probe for the ß2 microglobulin gene (127 bp).

Calcium mobilization assay
T cells were suspended at 107/mL in 2% fetal bovine serum/PBS containing 3 µM Fura-2 acetoxymethyl ester (DOJINDO, Kumamoto, Japan) and incubated at 37°C for 30 min. Fura-2-loaded cells were pelleted and washed twice and then resuspended at 5 x 106/mL in PBS containing 0.5 mM CaCl2. The calcium response was initiated by the addition of 1 nM MIP-1{alpha}, 10 nM MIP-1ß, or 10 nM RANTES. Cells were analyzed for free calcium ion by measurement of Fura-2 fluorescence emission on a HITACHI F-3000 fluorescence photometer (Hitachi, Tokyo, Japan).

Stimulation of purified T cells with anti-CD3 plus anti-CD28 mAb and subsequent exposure to IL-12
Lymph node cells from (C57BL/6xC3H/He)F1 mice were depleted of B cells and Ia+ APCs by immunomagnetic negative selection as follows. Cells were allowed to react with anti-I-Ad/b mAb and then incubated with magnetic particles bound to goat anti-mouse Ig (Advanced Magnetics, Cambridge, MA). A T cell population depleted of anti-I-Ad/b-labeled and surface Ig+ cells was obtained by removing cell-bound magnetic particles with a rare-earth magnet (Advanced Magnetics). T cell cultures were carried out as follows. Anti-CD3 (5 µg/mL) and anti-CD28 (2 µg/mL) mAbs were coimmobilized to individual wells of 24-well culture plates (Corning 25860; Corning Glass Works, Corning, NY) in a volume of 0.5 mL in PBS. After 3 h, solutions were discarded and plates were washed with PBS twice. Purified T cells were cultured in 2 mL of RPMI 1640 medium supplemented with 10% fetal bovine serum and 2-mercaptoethanol at 1.5 x 106 cells/well in a humidified atmosphere (5% CO2) at 37°C. Cells were harvested 48 h later and after washing were recultured in the presence of 250 pg/mL of rIL-12 or 100 U/mL of rIL-2 for an additional 48 h.


arrow
RESULTS
 
2D6IL-12 cells form large cell aggregates
We observed that when 2D6 cells were maintained in the presence of IL-12, they adhered to each other and formed large aggregates (Fig. 1 A). Our previous study [16 ] showed that 2D6IL-12 cells express both LFA-1 and ICAM-1 and that cell-to-cell adhesion in 2D6 is due to the interaction between these two types of adhesion molecules. This was confirmed by the observation that addition of anti-ICAM-1 mAb to the 2D6IL-12 culture prevented the aggregation (Fig. 1B) .



View larger version (100K):
[in this window]
[in a new window]
 
Figure 1. Cell-to-cell aggregation of 2D6IL-12 during culture with IL-12 is dependent on LFA-1–ICAM-1 interaction. 2D6 cells were cultured at a cell density of 105/well in 48-well culture plates for 48 (A) or 24 (B) h. (A) Pictures of cell aggregates were taken at low (left) or high (right) magnification. (B) Anti-ICAM-1 mAb (10 µg/mL) or control rat IgG was included.

Failure of 2D6IL-2 cells to form aggregates despite expressing LFA-1 and ICAM-1
We found that 2D6IL-2 cells did not adhere to each other but grew as a single-cell suspension (Fig. 2 ). We next compared the levels of LFA-1 and ICAM-1 expression between 2D6IL-12 and 2D6IL-2. Surprisingly, the two types of 2D6 cells expressed comparable levels of LFA-1 and ICAM-1 (Fig. 3 ). These results indicate that the expression of adhesion molecules does not necessarily lead to the implementation of their function and suggest that LFA-1 on 2D6IL-2 cells is not in an activated form and fails to mediate adhesion to ICAM-1.



View larger version (97K):
[in this window]
[in a new window]
 
Figure 2. The differential capacity of 2D6IL-12 and 2D6IL-2 cells to induce cell-to-cell aggregation. 2D6IL-12 and 2D6IL-2 cells were cultured with IL-12 and IL-2, respectively, for 48 h.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Comparable levels of LFA-1 and ICAM-1 expression on 2D6IL-12 and 2D6IL-2 cells. 2D6IL-12 and 2D6IL-2 cells (106/group) were stained with anti-LFA-1 (0.1 µg) and anti-ICAM-1 mAb (0.1 µg), followed by incubation with biotinylated anti-rat IgG (0.1 µg) plus PE-streptavidin (0.1 µg). Control (dotted line) represents staining without specific mAbs. Data are representative of three similar experiments.

A substantial difference in the expression of CCR5 between 2D6IL-12 and 2D6IL-2 cells
Considering the role of the chemokine system in the activation of adhesion molecules [4 , 5 ], we examined the expression of chemokine receptors, particularly that of CCR5, which has been implicated in the up-regulation of T cell adhesiveness and migratory capacity [6 7 8 9 10 11 12 13 ]. As shown in Figure 4 , high levels of CCR5 mRNA were detected in 2D6IL-12 cells by RT-PCR as well as by RNase protection assays, whereas 2D6IL-2 cells expressed only marginal levels of CCR5 mRNA even in the RT-PCR assay.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 4. High and only marginal levels of CCR5 expression in 2D6IL-12 and 2D6IL-2 cells, respectively. Total RNA was isolated from 2D6IL-12 and 2D6IL-2 cells, subjected to RT-PCR (A) and RNase protection assay (B), and examined for CCR5 mRNA expression. Data are representative of two (A) and three (B) similar experiments.

CXCR3 is expressed on Th1 CD4+ T cells along with CCR5 [12 , 13 ]. We determined whether CXCR3 is also expressed selectively by 2D6IL-12 cells. This was examined in comparison with CCR5 (positive control) and another chemokine receptor, CCR1, that exhibits ligand specificity similar to that of CCR5 (Fig. 5 A). In contrast to CCR5 expression, 2D6IL-12 cells expressed neither CXCR3 nor CCR1. 2D6IL-2 cells also failed to express mRNAs for CXCR3 and CCR1. As positive controls for CXCR3 and CCR1, we observed that high levels of CXCR3 and CCR1 mRNAs are expressed in T cells stimulated with anti-CD3 mAb plus anti-CD28 mAb and in unfractionated spleen cells containing macrophages, respectively (data not shown). Together, these results show that continuous exposure of 2D6 cells to IL-12 is associated with selective expression of CCR5 and that there exists a substantial difference in the level of CCR5 expression between 2D6IL-12 and 2D6IL-2 cells.



View larger version (66K):
[in this window]
[in a new window]
 
Figure 5. mRNA expression of various chemokine receptors and chemokines by 2D6IL-12 and 2D6IL-2 cells. Total RNA from 2D6IL-12 and 2D6IL-2 cells was examined for mRNA expression of the indicated chemokine receptors (A) and their ligands (B). Data are representative of three similar experiments.

CCR5 expression on the surfaces of 2D6IL-12 cells but not of 2D6IL-2 cells
We examined whether CCR5, a common receptor for MIP-1{alpha}, MIP-1ß, and RANTES [9 ], is expressed on the surfaces of 2D6IL-12 cells, and, if so, whether it functions as a receptor for stimulation with these chemokines. The procedure used for the detection of cytokine receptors such as IFN-{gamma}R [21 ] and IL-12R [16 ] was applied to the detection of surface CCR5 expression. Namely, 2D6IL-12 cells were incubated with either MIP-1{alpha}, MIP-1ß, or RANTES and then stained with antibody against the corresponding chemokine. Figure 6 shows that the binding of anti-MIP-1{alpha} or anti-RANTES Ab was detected by preincubation with the corresponding chemokine but not with an alternative chemokine. These results show that the binding sites for MIP-1{alpha} and RANTES were detected on the surfaces of 2D6IL-12 cells. Such a binding site was not detected on 2D6IL-2 cells (data not shown). MIP-1{alpha} and RANTES also reacted with CCR1. Because 2D6IL-12 cells failed to express CCR1, the MIP-1{alpha}/RANTES-binding site could represent CCR5. To directly demonstrate the expression of CCR5 on 2D6IL-12 but not on 2D6IL-2 cells, CCR5 was stained using anti-CCR5 polyclonal (Fig. 7 A) and monoclonal (Fig. 7B) Abs. The results show that CCR5 was detected only on 2D6IL-12 cells.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 6. Detection of MIP-1{alpha}/RANTES-binding sites (CCR5) on 2D6IL-12 cells. 2D6IL-12 cells (106) were incubated with 100 nM rMIP-1{alpha} or rRANTES and after washing, stained with 1 µg of goat anti-MIP-1{alpha} or anti-RANTES Ab followed by incubation with 0.4 µg of FITC-conjugated donkey anti-goat Ig. Cells in a control group were not treated with any reagent. Data are representative of four similar experiments.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 7. Staining of CCR5 with anti-CCR5 Ab. 2D6 cells (106) were incubated with 1 µg of rabbit anti-CCR5 polyclonal Ab or control rabbit IgG followed by 0.1 µg of biotinylated goat anti-rabbit Ig and 0.1 µg of PE-conjugated streptavidin (A). 2D6 cells were stained directly with 0.25 µg of PE-conjugated anti-mouse CCR5 mAb (B). Data are representative of two (A) and three (B) similar experiments.

Further, we investigated whether CCR5 expression is induced selectively by IL-12 on freshly prepared T cells instead of the 2D6 Th1 clone. Resting T cells express neither IL-2R nor IL-12R, and both cytokine receptors are induced after stimulation with anti-CD3 plus anti-CD28 mAbs [30 ]. These T-cell receptor-triggered T cells were then exposed to IL-2 or IL-12 for 48 h. Figure 8 shows that stimulation with IL-12 but not with IL-2 resulted in CCR5 expression, which supports the IL-12-selective CCR5 expression observed in the 2D6 cell system.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 8. Induction of CCR5 expression on T-cell-receptor-triggered lymph node T cells with IL-12 but not with IL-2. Purified lymph node T cells (1.5x106/well) were stimulated with immobilized anti-CD3 (5 µg/mL) and soluble anti-CD28 (2 µg/mL) for 48 h in 24-well culture plates. T-cell-receptor-triggered T cells were cultured in the presence of rIL-2 (100 U/mL) or rIL-12 (250 pg/mL) for 48 h. These cytokine-treated and untreated control cells were stained doubly with 1 µg of PE-conjugated anti-CCR5 mAb and a mixture of allophycocyanin-conjugated anti-CD4 (10 ng) plus anti-CD8 (40 ng) mAbs. Data are representative of five similar experiments.

IL-12-induced CCR5 is functional
To determine whether CCR5 expressed on the surface of 2D6IL-12 cells is a functional receptor, we examined whether CCR5-reactive chemokines induce Ca2+ mobilization as a result of surface CCR5 stimulation. Figure 9 A shows that stimulation with MIP-1{alpha}, MIP-1ß, or RANTES resulted in high (MIP-1{alpha} and MIP-1ß) or moderate (RANTES) levels of Ca2+ influx in 2D6IL-12 cells. Thus, CCR5 expressed on 2D6IL-12 cells was functional. In contrast, 2D6IL-2 cells showed only marginal levels of Ca2+ influx after MIP-1{alpha} stimulation (Fig. 9B) . Together, these results show that 2D6IL-12 cells expressed CCR5 on their surfaces and that the expressed CCR5 reacted with the relevant chemokines and worked as a functional receptor.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 9. Ca2+ influx in 2D6IL-12 cells after stimulation with CCR5-reactive chemokines. 2D6IL-12 cells (5x106) were stimulated with MIP-1{alpha} (1 nM), MIP-1ß (10 nM), or RANTES (10 nM) (A). 2D6IL-12 and 2D6IL-2 cells were stimulated with 1 nM MIP-1{alpha} (B). Data are representative of three (A) and two (B) similar experiments.

mRNA expression for CCR5-reactive chemokines in 2D6IL-12 and 2D6IL-2 cells
We examined whether CCR5-reactive chemokines (MIP-1{alpha}, MIP-1ß, and RANTES) are expressed by 2D6IL-12 and 2D6IL-2 cells (Fig. 5B) . Detectable albeit low levels of RANTES mRNA expression were seen in both types of 2D6 cells, but MIP-1{alpha} and MIP-1ß mRNAs were not detectable in either cell type. Thus, in contrast to the clear-cut difference in the expression of CCR5, there was no substantial difference in the mRNA expression of CCR5-reactive chemokines between 2D6IL-12 and 2D6IL-2. Our previous study [31 ] showed that 2D6IL-12 expresses IL-18R. We also examined the effect of IL-18 on the expression of CCR5 and CCR5-reactive chemokines by 2D6IL-12. As shown in Figure 10 , IL-18 did not induce CCR5 expression, but unlike IL-12 and IL-2, this cytokine stimulated strikingly high levels of RANTES mRNA expression.



View larger version (82K):
[in this window]
[in a new window]
 
Figure 10. IL-18 induces mRNA expression of RANTES but not that of CCR5 in 2D6IL-12 cells. 2D6IL-12 cells were starved of IL-12 for 12 h. After washing, cells were stimulated with IL-12 (250 pg/mL), IL-2 (100 U/mL), or IL-18 (100 ng/mL) for 12 h. Cells were harvested and subjected to the RNase protection assay to determine CCR5 and RANTES mRNA expression. Data are representative of two similar experiments.

Down-regulatory effect of IL-2 on IL-12-mediated CCR5 expression
The differential expression of CCR5 on 2D6IL-12 and 2D6IL-2 might suggest that there exist cytokine-mediated regulatory mechanisms of CCR5 expression. 2D6IL-12 and 2D6IL-2 cells were previously shown to express comparable levels of IL-2R and IL-12R [31 ]. In contrast, IL-18R was expressed selectively on 2D6IL-12 cells [31 ]. Thus, 2D6IL-12 cells respond to either IL-12, IL-2, or IL-18. 2D6IL-12 cells were stimulated with IL-12, IL-2, or IL-18 alone or with combinations of these cytokines. Figure 11 shows that IL-2 inhibited IL-12-induced CCR5 up-regulation. Like IL-2, IL-18 failed to induce CCR5 expression, but unlike IL-2, IL-18 did not down-regulate CCR5 expression induced by IL-12. Thus, IL-2 negatively regulates CCR5 expression in 2D6 cells.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 11. Down-regulatory effect of IL-2 on IL-12-induced CCR5 expression. 2D6IL-12 cells were starved of IL-12 for 12 h. After washing, cells were stimulated with IL-12 (250 pg/mL), IL-2 (100 U/mL) or IL-18 (100 ng/mL) alone or in combinations of these two cytokines for 12 h. Data are representative of three similar experiments.

Aggregation of 2D6 cells is accelerated or inhibited in the presence of IL-12 plus IL-18 Abs or anti-CCR5 Ab, respectively
The fact that 2D6IL-12 cells simultaneously express CCR5 and RANTES suggests that CCR5 on 2D6IL-12 cells is continuously stimulated with RANTES. This also implies that stimulation of CCR5 may function to convert LFA-1 from an inactive to an active form. This possibility was examined by observing whether LFA-1-dependent 2D6 aggregation is accelerated when RANTES expression is enhanced by IL-18 costimulation and whether the aggregation is inhibited when CCR5 stimulation is blocked. First, 2D6IL-12 cells were cultured with IL-12, IL-18, or a combination of the two. As shown in Figure 12 A, 2D6 aggregation induced by IL-12 was accelerated by the presence of IL-18, probably because of its capacity to stimulate RANTES expression. Second, 2D6IL-12 cells were stimulated with IL-12 in the presence of an anti-CCR5 polyclonal Ab that can block CCR5 function [20 ]. Figure 12B shows that addition of anti-CCR5 Ab resulted in a striking inhibition of LFA-1-mediated 2D6 aggregation. These observations indicated that stimulation of CCR5 is responsible for inducing LFA-1-mediated 2D6 cell aggregation.



View larger version (158K):
[in this window]
[in a new window]
 
Figure 12. 2D6 aggregation in culture with IL-12 is accelerated by IL-18 and inhibited by anti-CCR5 Ab. (A) 2D6IL-12 cells were cultured at a relatively low cell density (2.5x104 cells/dish) in 10-cm dishes in the presence of IL-12 (250 pg/mL), IL-18 (100 ng/mL) or a combination of these for 72 h. (B) 2D6IL-12 cells were stimulated with IL-12 at a relatively high cell density (5x104 cells/well) in 48-well culture plates in the presence of anti-CCR5 polyclonal Ab (25 µg/mL) or control rabbit IgG for 24 h. Original magnifications are shown. Pictures are representative of those taken in four (A) and three (B) similar experiments.


arrow
DISCUSSION
 
Using a previously established IL-12-responsive T cell clone, 2D6, the present study showed the following. 2D6IL-12 cells exhibited the property of aggregation via the interaction between LFA-1 and ICAM-1, which they simultaneously expressed. Although 2D6IL-2 cells expressed comparable levels of LFA-1 and ICAM-1, they failed to show LFA-1/ICAM-1-mediated aggregation. There was a substantial difference in the expression of CCR5 but not of CCR5-reactive chemokines between 2D6IL-12 and 2D6IL-2. Addition of anti-CCR5 Ab to a 2D6IL-12 cell culture resulted in inhibition of the LFA-1-mediated aggregation of these cells. These results demonstrated a role for IL-12 in the induction of CCR5 on T cells as well as for IL-12-induced CCR5 in the up-regulation of LFA-1-mediated T cell adhesiveness.

Our previous study [16 ] describing the establishment of an IL-12-responsive T cell clone (2D6) showed that 2D6 cells express both LFA-1 and ICAM-1 and adhere to each other via interaction between LFA-1 and ICAM-1, resulting in large cell aggregates. Because 2D6 cells also respond to IL-2 [16 ], 2D6 cells can be maintained with IL-2 instead of IL-12. In the course of these experiments, we found that 2D6IL-2 cells did not form cell aggregates. Initially, we thought that the expression of either LFA-1 or ICAM-1 was reduced in 2D6IL-2 cells. Contrary to expectations, the present study showed that 2D6IL-2 cells expressed levels of LFA-1 and ICAM-1 comparable with those observed for 2D6IL-12 cells. This is compatible with the notion that the expression of adhesion molecules does not necessarily imply that they exert their adhesive capacity.

A considerable body of evidence highlights the role of chemokines and chemokine receptors in the regulation of leukocyte migration from the vascular compartment to inflammatory sites [1 2 3 ]. It is becoming increasingly evident that chemokines promote the conversion from a weakly adherent (integrin-independent) phenotype to a firmly adherent (integrin-dependent) phenotype during lymphocyte extravasation, suggesting that chemokines are capable of up-regulating integrin function by an "inside-out" activation mechanism [8 , 32 33 34 35 ]. This view is supported by in vivo findings showing that mice lacking particular chemokine receptors display impaired leukocyte transmigration into sites of inflammation [36 37 38 39 ]. Such knowledge led us to examine whether 2D6IL-12 and 2D6IL-2 cells both express the chemokine receptors that have been reported to be expressed on Th1 cells. The chemokine receptors CCR5 and CXCR3 have been regarded as characteristic of CD4+ Th1 lymphocytes [11 12 13 ] and implicated in the recruitment of Th1 cells to inflammatory sites such as the synovial lesion in rheumatoid arthritis [12 , 13 ], indicating their importance in T cell-mediated inflammatory responses. Our results showed that 2D6IL-12 and 2D6IL-2 cells expressed high and only marginal levels of CCR5, respectively.

In contrast to the clear-cut difference in CCR5 expression, the expression of CCR5-reactive chemokines (MIP-1{alpha}, MIP-1ß, and RANTES) did not differ greatly between these two types of 2D6 cells. Only RANTES mRNA was expressed by 2D6IL-12 and 2D6IL-2 at comparable levels. Thus, it is assumed that in 2D6IL-12 cells, CCR5 is continuously stimulated with RANTES and LFA-1 is activated as a result of CCR5 stimulation. This possibility was supported by two lines of observation. First, LFA-1-mediated 2D6 cell aggregation was accelerated by signals that enhance RANTES expression. 2D6 cells were previously found to express IL-18R and to respond to IL-18 [31 ]. This study showed that IL-18 stimulation of 2D6 cells selectively up-regulated RANTES but not CCR5 mRNA expression. Thus, accelerated aggregation induced in 2D6IL-12 cells costimulated with IL-18 could result from the exposure of CCR5 to a large amount of RANTES induced by IL-18. Second, LFA-1-mediated 2D6 cell aggregation is strongly inhibited by adding an anti-CCR5 Ab capable of blocking CCR5 function [20 ]. These observations support the notion that stimulation of CCR5 leads to up-regulation of an LFA-1-mediated adhesive capacity in T cells.

An important aspect of the present study is that the chemokine receptor CCR5 is induced by stimulation with IL-12 but not with IL-2. CCR5 expression on human T cells, particularly CD45RO+ (memory) T cells, is selectively induced by exposing these cells to IL-2 [14 , 15 ]. IL-12 has been shown to induce only low levels of CCR5 expression [14 ] or rather to inhibit IL-2-mediated up-regulation of CCR5 expression [15 ]. In the 2D6 CD4+ Th1 cell system, IL-2 failed to up-regulate CCR5 expression, and the expression of this chemokine receptor was selectively inducible by IL-12. Thus, the observations made in the present model are quite discordant with the results obtained for human memory T cells. However, the previous studies [14 , 15 ] did not examine whether memory (CD45RO+) T cells express sufficient levels of IL-12R for responding to IL-12 stimulation. Therefore, the failure of IL-12 to induce CCR5 expression in human T cells may not necessarily be due to an inability of this cytokine to induce expression. Further studies are required to reconcile the seemingly discordant results observed in the two systems by preparing a human T cell population expressing optimal levels of IL-12R and examining the capacity of IL-12 to induce CCR5 expression in such a T cell population.

It should also be noted that 2D6IL-12 cells express high levels of CCR5 but fail to express CXCR3. The expression of CCR5 and CXCR3 has thus far been observed in parallel on Th1 cells. Whereas naive (cord blood) human T cells express neither CCR5 nor CXCR3, Th1-polarized cells express moderate levels of CCR5 and high levels of CXCR3 [12 ]. The expression of these receptors has also been studied in T cells from rheumatoid joints which acquire a Th1 phenotype in vivo, and these T cells express high levels of CCR5 and CXCR3 [12 , 13 ]. In this study, only marginal levels of CXCR3 were detected on 2D6IL-12 cells expressing CCR5, indicating that IL-12 failed to up-regulate CXCR3 expression on 2D6 cells. While CXCR3 was expressed on Th1 cells infiltrating the inflammatory site, it appears that the expression of this chemokine receptor was regulated differently from that of CCR5, and IL-12 induced selective expression of CCR5.

Our present results show that CCR5 expression was selectively induced on 2D6 mouse CD4+ Th1 cells exposed to IL-12. LFA-1 expressed on 2D6 cells was activated to exhibit a firmly adherent function depending on CCR5-derived signals. Thus, this study demonstrated a critical role for IL-12 in the induction of CCR5 on T cells as well as a role for IL-12-induced CCR5 in up-regulating integrin function via an "inside-out" activation mechanism. Moreover, these results are compatible with the notion that CCR5+ T cells are stimulated with the relevant chemokines expressed at inflammatory sites to induce tight interaction with endothelial ICAM-1 through CCR5-mediated LFA-1 activation [1 2 3 4 5 6 7 8 ]. The 2D6 cell system could also provide an intriguing model for investigating not only the molecular mechanisms by which IL-12 signals induce CCR5 expression but also those mechanisms by which CCR5 signals elicit the functional activation of LFA-1.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by Special Project Research—Cancer Bioscience from the Ministry of Education, Science, and Culture of Japan. The authors are grateful to Mark J. Micallef for critical review of this manuscript and to Mrs. Mami Yasuda and Miss Mari Yoneyama for secretarial assistance.

Received February 26, 2001; revised April 23, 2001; accepted April 24, 2001.


arrow
REFERENCES
 
    1
  1. Baggiolini, M., Dewald, B., Moser, B. (1997) Human chemokines: an update Annu. Rev. Immunol 15,675-705[Medline]
  2. 2
  3. Rollins, B. J. (1997) Chemokines Blood 90,909-928[Free Full Text]
  4. 3
  5. Murphy, P. M. (1994) The molecular biology of leukocyte chemoattractant receptors Annu. Rev. Immunol 12,593-633[Medline]
  6. 4
  7. Springer, T. A. (1995) Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration Annu. Rev. Physiol 57,827-872[Medline]
  8. 5
  9. Adams, D. H., Lloyd, A. R. (1997) Chemokines: leucocyte recruitment and activation cytokines Lancet 349,490-495[Medline]
  10. 6
  11. Tanaka, Y., Adams, D. H., Hubscher, S., Hirano, H., Siebenlist, U., Shaw, S. (1993) T-cell adhesion induced by proteoglycan-immobilized cytokine MIP-1ß Nature 361,79-82[Medline]
  12. 7
  13. Taub, D. D., Conlon, K., Lloyd, A. R., Oppenheim, J. J., Kelvin, D. J. (1993) Preferential migration of activated CD4+ and CD8+ T cells in response to MIP-1{alpha} and MIP-1ß Science 260,355-358[Abstract/Free Full Text]
  14. 8
  15. Carr, M. W., Alon, R., Springer, T. A. (1996) The C-C chemokine MCP-1 differentially modulates the avidity of ß1 and ß2 integrins on T lymphocytes Immunity 4,179-187[Medline]
  16. 9
  17. Ward, S. G., Bacon, K., Westwick, J. (1998) Chemokines and T lymphocytes: more than an attraction Immunity 9,1-11[Medline]
  18. 10
  19. Mackay, C. R. (1996) Chemokine receptors and T cell chemotaxis J. Exp. Med 184,799-802[Free Full Text]
  20. 11
  21. Bonecchi, R., Bianchi, G., Bordignon, P. P., D’Ambrosio, D., Lang, R., Borsatti, A., Sozzani, S., Allavena, P., Gray, P. A., Mantovani, A., Sinigaglia, F. (1998) Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s J. Exp. Med 187,129-134[Abstract/Free Full Text]
  22. 12
  23. Loetscher, P., Uguccioni, M., Bordoli, L., Baggiolini, M., Moser, B., Chizzolini, C., Dayer, J. M. (1998) CCR5 is characteristic of Th1 lymphocytes Nature 391,344-345[Medline]
  24. 13
  25. Qin, S., Rottman, J. B., Myers, P., Kassam, N., Weinblatt, M., Loetscher, M., Koch, A. E., Moser, B., Mackay, C. R. (1998) The chemokine receptors CXCR3 and CCR5 mark subsets of T cells associated with certain inflammatory reactions J. Clin. Invest 101,746-754[Medline]
  26. 14
  27. Loetscher, P., Seitz, M., Baggiolini, M., Moser, B. (1996) Interleukin-2 regulates CC chemokine receptor expression and chemotactic responsiveness in T lymphocytes J. Exp. Med 184,569-577[Abstract/Free Full Text]
  28. 15
  29. Wang, J., Guan, E., Roderiquez, G., Norcross, M. A. (1999) Inhibition of CCR5 expression by IL-12 through induction of ß-chemokines in human T lymphocytes J. Immunol 163,5763-5769[Abstract/Free Full Text]
  30. 16
  31. Maruo, S., Ahn, H. J., Yu, W. G., Tomura, M., Wysocka, M., Yamamoto, N., Kobayashi, M., Hamaoka, T., Trinchieri, G., Fuijiwara, H. (1997) Establishment of an IL-12-responsive T cell clone: its characterization and utilization in the quantitation of IL-12 activity J. Leukoc. Biol 61,346-352[Abstract]
  32. 17
  33. Maruo, S., Toyo-oka, K., Oh-hora, M., Tai, X. G., Iwata, H., Takenaka, H., Yamada, S., Ono, S., Hamaoka, T., Kobayashi, M., Wysocka, M., Trinchieri, G., Fujiwara, H. (1996) IL-12 produced by antigen-presenting cells induces IL-2-independent proliferation of T helper cell clones J. Immunol 156,1748-1755[Abstract]
  34. 18
  35. Sanchez-Madrid, F., Davignon, D., Martz, E., Springer, T. A. (1982) Antigens involved in mouse cytolytic T-lymphocyte (CTL)-mediated killing: functional screening and topographic relationship Cell. Immunol 73,1-11[Medline]
  36. 19
  37. Takei, F. (1985) Inhibition of mixed lymphocyte response by a rat monoclonal antibody to a novel murine lymphocyte activation antigen (MALA-2) J. Immunol 134,1403-1407[Abstract]
  38. 20
  39. Murai, M., Yoneyama, H., Harada, A., Yi, Z., Vestergaard, C., Guo, B., Suzuki, K., Asakura, H., Matsushima, K. (1999) Active participation of CCR5+ CD8+ T lymphocytes in the pathogenesis of liver injury in graft-versus-host disease J. Clin. Invest 104,49-57[Medline]
  40. 21
  41. Gray, P. W., Leong, S., Fennie, E. H., Farrar, M. A., Pingel, J. T., Fernandez-Luna, J., Schreiber, R. D. (1989) Cloning and expression of the cDNA for the murine interferon {gamma} receptor Proc. Natl. Acad. Sci. USA 86,8497-8501[Abstract/Free Full Text]
  42. 22
  43. Boring, L., Gosling, J., Monteclaro, F. S., Lusis, A. J., Tsou, C. L., Charo, I. F. (1996) Molecular cloning and functional expression of murine JE (monocyte chemoattractant protein 1) and murine macrophage inflammatory protein 1{alpha} receptors: evidence for two closely linked C-C chemokine receptors on chromosome 9 J. Biol. Chem 271,7551-7558[Abstract/Free Full Text]
  44. 23
  45. Post, T. W., Bozic, C. R., Rothenberg, M. E., Luster, A. D., Gerard, N., Gerard, C. (1995) Molecular characterization of two murine eosinophil ß chemokine receptors J. Immunol 155,5299-5305[Abstract]
  46. 24
  47. Soto, H., Wang, W., Strieter, R. M., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Hedrick, J., Zlotnik, A. (1998) The CC chemokine 6Ckine binds the CXC chemokine receptor CXCR3 Proc. Natl. Acad. Sci. USA 95,8205-8210[Abstract/Free Full Text]
  48. 25
  49. Davatelis, G., Tekamp-Olson, P., Wolpe, S. D., Hermsen, K., Luedke, C., Gallegos, C., Coit, D., Merryweather, J., Cerami, A. (1988) Cloning and characterization of a cDNA for murine macrophage inflammatory protein (MIP), a novel monokine with inflammatory and chemokinetic properties J. Exp. Med 167,1939-1944[Abstract/Free Full Text]
  50. 26
  51. Sherry, B., Tekamp-Olson, P., Gallegos, C., Bauer, D., Davatelis, G., Wolpe, S. D., Masiarz, F., Coit, D., Cerami, A. (1988) Resolution of the two components of macrophage inflammatory protein 1, and cloning and characterization of one of those components, macrophage inflammatory protein 1ß J. Exp. Med 168,2251-2259[Abstract/Free Full Text]
  52. 27
  53. Heeger, P., Wolf, G., Meyers, C., Sun, M. J., O’Farrell, S. C., Krensky, A. M., Neilson, E. G. (1992) Isolation and characterization of cDNA from renal tubular epithelium encoding murine Rantes Kidney Int 41,220-225[Medline]
  54. 28
  55. Marchuk, D., Drumm, M., Saulino, A., Collins, F. S. (1991) Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products Nucleic Acids Res 19,1154[Free Full Text]
  56. 29
  57. Wilson, K. C., Finbloom, D. S. (1992) Interferon gamma rapidly induces in human monocytes a DNA-binding factor that recognizes the ß response region within the promoter of the gene for the high-affinity Fc {gamma} receptor Proc. Natl. Acad. Sci. USA 89,11964-11968[Abstract/Free Full Text]
  58. 30
  59. Tomura, M., Maruo, S., Mu, J., Zhou, X. Y., Ahn, H. J., Hamaoka, T., Okamura, H., Nakanishi, K., Clark, S., Kurimoto, M., Fujiwara, H. (1998) Differential capacities of CD4+, CD8+, and CD4- CD8- T cell subsets to express IL-18 receptor and produce IFN-{gamma} in response to IL-18 J. Immunol 160,3759-3765[Abstract/Free Full Text]
  60. 31
  61. Ahn, H. J., Maruo, S., Tomura, M., Mu, J., Hamaoka, T., Nakanishi, K., Clark, S., Kurimoto, M., Okamura, H., Fujiwara, H. (1997) A mechanism underlying synergy between IL-12 and IFN-{gamma}-inducing factor in enhanced production of IFN-{gamma} J. Immunol 159,2125-2131[Abstract/Free Full Text]
  62. 32
  63. Weber, C., Alon, R., Moser, B., Springer, T. A. (1996) Sequential regulation of {alpha}4ß1 and {alpha}5ß1 integrin avidity by CC chemokines in monocytes: implications for transendothelial chemotaxis J. Cell Biol 134,1063-1073[Abstract/Free Full Text]
  64. 33
  65. Laudanna, C., Campbell, J. J., Butcher, E. C. (1996) Role of Rho in chemoattractant-activated leukocyte adhesion through integrins Science 271,981-983[Abstract]
  66. 34
  67. Campbell, J. J., Hedrick, J., Zlotnik, A., Siani, M. A., Thompson, D. A., Butcher, E. C. (1998) Chemokines and the arrest of lymphocytes rolling under flow conditions Science 279,381-384[Abstract/Free Full Text]
  68. 35
  69. Sadhu, C., Masinovsky, B., Staunton, D. E. (1998) Differential regulation of chemoattractant-stimulated ß2, ß3, and ß7 integrin activity J. Immunol 160,5622-5628[Abstract/Free Full Text]
  70. 36
  71. Ben-Baruch, A., Michiel, D. F., Oppenheim, J. J. (1995) Signals and receptors involved in recruitment of inflammatory cells J. Biol. Chem 270,11703-11706[Free Full Text]
  72. 37
  73. Boring, L., Gosling, J., Chensue, S. W., Kunkel, S. L., Farese, R., Jr, Broxmeyer, H. E., Charo, I. F. (1997) Impaired monocyte migration and reduced type 1 (Th1) cytokine responses in C-C chemokine receptor 2 knockout mice J. Clin. Invest 100,2552-2561[Medline]
  74. 38
  75. Kurihara, T., Warr, G., Loy, J., Bravo, R. (1997) Defects in macrophage recruitment and host defense in mice lacking the CCR2 chemokine receptor J. Exp. Med 186,1757-1762[Abstract/Free Full Text]
  76. 39
  77. Gao, J. L., Wynn, T. A., Chang, Y., Lee, E. J., Broxmeyer, H. E., Cooper, S., Tiffany, H. L., Westphal, H., Kwon-Chung, J., Murphy, P. M. (1997) Impaired host defense, hematopoiesis, granulomatous inflammation and type 1–type 2 cytokine balance in mice lacking CC chemokine receptor 1 J. Exp. Med 185,1959-1968[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
BloodHome page
P. Gao, R. L. Wange, N. Zhang, J. J. Oppenheim, and O. M. Z. Howard
Negative regulation of CXCR4-mediated chemotaxis by the lipid phosphatase activity of tumor suppressor PTEN
Blood, October 15, 2005; 106(8): 2619 - 2626.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Gough, M. Crittenden, U. Thanarajasingam, L. Sanchez-Perez, J. Thompson, D. Jevremovic, and R. Vile
Gene Therapy to Manipulate Effector T Cell Trafficking to Tumors for Immunotherapy
J. Immunol., May 1, 2005; 174(9): 5766 - 5773.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
O. D. Perez, D. Mitchell, G. C. Jager, and G. P. Nolan
LFA-1 signaling through p44/42 is coupled to perforin degranulation in CD56+CD8+ natural killer cells
Blood, August 15, 2004; 104(4): 1083 - 1093.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Ito, A. Matejuk, C. Hopke, H. Drought, J. Dwyer, A. Zamora, S. Subramanian, A. A. Vandenbark, and H. Offner
Transfer of Severe Experimental Autoimmune Encephalomyelitis by IL-12- and IL-18-Potentiated T Cells Is Estrogen Sensitive
J. Immunol., May 1, 2003; 170(9): 4802 - 4809.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
P. Gao, X.-Y. Zhou, Y. Yashiro-Ohtani, Y.-F. Yang, N. Sugimoto, S. Ono, T. Nakanishi, S. Obika, T. Imanishi, T. Egawa, et al.
The unique target specificity of a nonpeptide chemokine receptor antagonist: selective blockade of two Th1 chemokine receptors CCR5 and CXCR3
J. Leukoc. Biol., February 1, 2003; 73(2): 273 - 280.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. Losana, C. Bovolenta, L. Rigamonti, I. Borghi, F. Altare, E. Jouanguy, G. Forni, J.-L. Casanova, B. Sherry, M. Mengozzi, et al.
IFN-{gamma} and IL-12 differentially regulate CC-chemokine secretion and CCR5 expression in human T lymphocytes
J. Leukoc. Biol., October 1, 2002; 72(4): 735 - 742.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Rodriguez-Sosa, A. R. Satoskar, R. Calderon, L. Gomez-Garcia, R. Saavedra, R. Bojalil, and L. I. Terrazas
Chronic Helminth Infection Induces Alternatively Activated Macrophages Expressing High Levels of CCR5 with Low Interleukin-12 Production and Th2-Biasing Ability
Infect. Immun., July 1, 2002; 70(7): 3656 - 3664.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Ariel, D. Novick, M. Rubinstein, C. A. Dinarello, O. Lider, and R. Hershkoviz
IL-12 and IL-18 induce MAP kinase-dependent adhesion of T cells to extracellular matrix components
J. Leukoc. Biol., July 1, 2002; 72(1): 192 - 198.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Tang, T. P. Cheng, D. Agnello, C.-Y. Wu, B. D. Hissong, W. T. Watford, H.-J. Ahn, J. Galon, J. Moss, M. Vaughan, et al.
Cybr, a cytokine-inducible protein that binds cytohesin-1 and regulates its activity
PNAS, February 20, 2002; (2002) 52712999.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Tang, T. P. Cheng, D. Agnello, C.-Y. Wu, B. D. Hissong, W. T. Watford, H.-J. Ahn, J. Galon, J. Moss, M. Vaughan, et al.
Cybr, a cytokine-inducible protein that binds cytohesin-1 and regulates its activity
PNAS, March 5, 2002; 99(5): 2625 - 2629.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mukai, T.
Right arrow Articles by Hamaoka, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mukai, T.
Right arrow Articles by Hamaoka, T.