| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Oncology, Biomedical Research Center, Osaka University Graduate School of Medicine, 2-2 Yamada-oka, and
Division of Pathogenesis and Control of Oral Diseases, Graduate School of Dentistry, Osaka University, Suita, Osaka;
Department of Molecular Preventive Medicine, The University of Tokyo, Faculty of Medicine; and
Fujisaki Institute, Hayashibara Biochemical Laboratories, Okayama, Japan
Correspondence: Dr. Hiromi Fujiwara, Department of Oncology, Biomedical Research Center, Osaka University Graduate School of Medicine, 2-2 Yamada-oka, Suita, Osaka 565-0871, Japan. E-mail: hf{at}ongene.med.osaka-u.ac.jp
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: chemokine • chemokine receptor • adhesion molecule
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Within the T cell lineage, the expression of several chemokine receptors appears to be restricted to activated and memory (CD45RO+) types of cells [9 , 10 ]. Among these, CCR5 has been regarded as characteristic of CD4+ Th1 lymphocytes [11 12 13 ] and implicated in the recruitment of Th1 cells to inflammatory sites [9 , 10 ]. Regarding CCR5 expression on T cells, there are only a few studies on human T cells [14 , 15 ]. CCR5 expression was shown to be up-regulated on CD45RO+ human memory T cells after treatment with recombinant interleukin (rIL)-2. However, these studies revealed that memory T cells express CCR5 only after long-term (>8-day) exposure to IL-2 [14 , 15 ]. Therefore, it is unclear whether IL-2 can provide memory T cells with a signal capable of directly inducing CCR5. It also remains to be determined which signals can induce CCR5 on T cells in the activated state, such as Th1 clones and T cells recently triggered by T-cell receptor, and whether CCR5 induced by such signals functions to activate adhesion molecules expressed on these T cells.
Previously, we established an IL-12-responsive T cell clone, 2D6 [16 ], by maintaining an alloreactive Th1 clone in culture containing rIL-12 alone instead of allogeneic antigen-presenting cells (APCs). Our previous study [16 ] showed that the 2D6 clone expresses both lymphocyte function-associated antigen (LFA)-1 and intercellular adhesion molecule (ICAM)-1 and exhibits cell-to-cell adhesion via these adhesion molecules. Using this clone, we investigated whether 2D6 cells maintained with IL-12 (2D6IL-12 cells) express CCR5 and, if so, whether CCR5 functions to activate LFA-1 on 2D6 cells and induce cell-to-cell adhesion. 2D6 cells could also be maintained with IL-2 (2D6IL-2). The standard 2D6IL-12 cells and the 2D6IL-2 cells expressed comparable levels of LFA-1 and ICAM-1; however, 2D6IL-2 cells did not aggregate. 2D6IL-12 and 2D6IL-2 expressed high and only marginal levels of CCR5, respectively, although there was no substantial difference in the expression of CCR5-reactive chemokines between these two cell types. The adhesiveness of 2D6IL-12 cells was also found to be suppressed in the presence of anti-CCR5 antibody (Ab). These results indicate that IL-12 plays a critical role in inducing the expression of CCR5 on Th1 cells and, through such a role, contributes to up-regulation of LFA-1-mediated cellular adhesiveness.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Reagents
Mouse rIL-12 and rIL-18 were provided by Genetics Institute,
Inc., Cambridge, MA, and Hayashibara Biochemical Laboratories, Okayama,
Japan, respectively. Mouse rIL-2 was kindly provided by Shionogi Co.
Ltd. (Osaka, Japan). Anti-LFA-1 (M17/5.2) [18
] and
anti-ICAM-1 (UN1/1.7.4) [19
] hybridomas were
purchased from the American Type Culture Collection, Manassas, VA, and
each monoclonal Ab (mAb) was purified from the respective ascitic
fluids. Rabbit anti-mouse CCR5 Ab was prepared as previously described
[20
]. Briefly, rabbits were immunized with glutathione
S-transferase protein conjugated to the NH2
terminus of CCR5, and sera were fractionated to obtain the
immunoglobulin (Ig) G fraction using a protein A-agarose column.
Phycoerythrin (PE)-conjugated anti-mouse CCR5 mAb was obtained from
PharMingen (San Diego, CA). Biotinylated mouse anti-rat IgG and
biotinylated goat anti-rabbit IgG were purchased from Jackson
ImmunoResearch, (West Grove, PA). Control rat IgG and rabbit IgG were
obtained from Biomeda (Foster City, CA) and Jackson ImmunoResearch,
respectively. PE-conjugated streptavidin was from Becton Dickinson
(Mountain View, CA). The following recombinant chemokine preparations
and anti-chemokine Abs were purchased: mouse macrophage-inflammatory
protein (MIP)-1
, RANTES (regulated on activation, normal T expressed
and secreted), and MIP-1ß (R & D Systems, Minneapolis, MN); goat
anti-mouse MIP-1, anti-mouse RANTES, and anti-mouse MIP-1ß Abs (R
& D Systems); fluorescein isothiocyanate (FITC)-conjugated donkey
anti-goat Ig (Chemicon Inc., Temecula, CA); and normal goat Ig (R & D
Systems).
Immunofluorescence and flow cytometry
Cell surface CCR5 was detected by three methods. The first
involved application of the flow-cytometric-assay protocol used to
identify cells expressing cytokine receptors such as interferon-
receptor (IFN-R) [21
] and IL-12R [16
]
to the detection of CCR5 as the binding receptor of MIP-1 or RANTES.
Briefly, 106 2D6 cells were incubated with 100 nM rMIP-1
or rRANTES in 10 µL of phosphate-buffered saline (PBS) for 60 min at
4°C. After washing, cells were allowed to react with 1 µg of goat
anti-MIP-1 or RANTES Ig followed by incubation with FITC-conjugated
donkey anti-goat Ig. The second method was incubation of 2D6 cells with
rabbit anti-mouse CCR5 polyclonal Ab followed by biotinylated goat
anti-rabbit Ig and PE-conjugated streptavidin. The third method was
direct staining of 2D6 cells with PE-conjugated anti-mouse CCR5 mAb.
LFA-1 and ICAM-1 were stained by incubating cells with the first Ab
(specific mAb) for 20 min and then with biotinylated mouse anti-rat IgG
for an additional 20 min, followed by incubation with PE-conjugated
streptavidin. Stained cells were analyzed with a FACSCalibur (Becton
Dickinson).
Reverse transcription-PCR (RT-PCR)
Total RNA was prepared from cytokine-stimulated T cells by the
acid guanidium thiocyanate-phenol-chloroform method. Total RNA (1 µg)
was reverse transcribed into cDNA in a total volume of 20 µL using
random primers and SUPERSCRIPTTM RNase
H- reverse transcriptase (Life Technologies, Rockville,
MD). PCR amplification was carried out in a total volume of 50 µL of
PCR buffer (x1) (TaKaRa, Otsu, Japan) containing 1.0 µL of the
first-strand cDNA, 0.25 mM each deoxynucleotide triphosphate, 2 µM
each primer, and 2.5 U of Taq DNA polymerase (TaKaRa). The
following oligonucleotides were used: mouse CCR5 sense primer,
5'-GGATTTTCAAGGGTCAGTTC-3'; CCR5 antisense primer,
5'-AACCTTCTTTCTGAGATCTGG-3'; mouse ß-actin sense primer,
5'-GTGGGCCGCTCTAGGCACCAA-3'; and ß-actin antisense primer,
5'-CTCTTTGATGTCACGCACGATTTC-3'. Cycle parameters were as follows:
annealing for 1 min at 60°C (CCR5) or 55°C (ß-actin), elongation
for 2 min at 72°C, and denaturation for 1 min at 94°C. The
resulting PCR products were separated in a 1% agarose gel and
visualized by ethidium bromide staining. Sequences of CCR5 and
ß-actin (for standardization) were amplified out of each cDNA batch
with 25 and 23 amplification cycles, respectively.
cDNA probes
CCR5, CXCR3, and RANTES cDNAs were cloned from purified mouse
lymph node cells that were activated for 48 h with immobilized
anti-CD3 (5 µg/mL) and soluble anti-CD28 (2 µg/mL) in the presence
of 250 pg/mL of mouse rIL-12. CCR1 cDNA was cloned from unfractionated
spleen cells that were treated for 48 h with 5 µg/mL of
concanavalin A, harvested, and then restimulated for 48 h with 100
U/mL of mouse rIL-2. MIP-1 and MIP-1ß cDNAs were cloned from cells
of the mouse macrophage cell line RAW 264 that had been treated for
12 h with 100 pg/mL of lipopolysaccharide (Escherichia
coli O127:B8; Difco Laboratories, Detroit, MI). RNAs
isolated from the above cells were used as templates for first-strand
cDNA synthesis. The mouse CCR5, CCR1, CXCR3, MIP-1, MIP-1ß, and
RANTES coding sequences were cloned from these cDNAs by use of
Taq DNA polymerase, standard PCR conditions, and the
following primers: for CCR5, a 5' sense oligonucleotide
GGATTTTCAAGGGTCAGTTC and a 3' antisense oligonucleotide
AACCTTCTTTCTGAGATCTGG based on sequences 77–96 and 580–600,
respectively, from the sequence of CCR5 [22
]; for CCR1,
a 5' sense oligonucleotide ATGGAGATTTCAGATTTCACAG and a 3' antisense
oligonucleotide TCAGAAGCCAGCAGAGAG based on sequences 1–22 and
1051–1068, respectively, from the sequence of CCR1
[23
]; for CXCR3, a 5' sense oligonucleotide
GCTAGATGCCTCGGACTTTG and a 3' antisense oligonucleotide
GCTGATCGTAGTTGGCTGATA based on sequences 30–49 and 566–589,
respectively, from the sequence of CXCR3 [24
]; for
MIP-1, a 5' sense oligonucleotide TGACACTCTGCAACCAAGTC and a 3'
antisense oligonucleotide GAACGTGTCCTGAAGTCTTTC based on sequences
114–133 and 589–609, respectively, from the sequence of MIP-1
[25
]; for MIP-1ß, a 5' sense oligonucleotide
TGGATTACTATGAGACCAGCA and a 3' antisense oligonucleotide
CAGTCATATCCACAATAGCAGA based on sequences 208–228 and 574–595,
respectively, from the sequence of MIP-1ß [26
]; and
for RANTES, a 5' sense oligonucleotide AGCTGCCCTCACCATCATC and a 3'
antisense oligonucleotide GTATTCTTGAACCCACTTCTTC based on sequences
54–72 and 270–291, respectively, from the sequence of RANTES
[27
]. The PCR products were purified by agarose gel
electrophoresis and ligated to the T vector as described
[28
]. Briefly, the Bluescript (Stratagene, La Jolla, CA)
plasmid was digested with EcoRV and incubated with
Taq polymerase under standard buffer conditions in the
presence of 2 mM deoxyribosylthymine triphosphate for 2 h at
70°C. After phenol extraction and precipitation, the T vector was
ready for cloning. PCR products were then ligated to the vector. cDNA
for ß2 microglobulin was kindly provided by Dr. Takeshi Tokuhisa
(Chiba University Medical School, Japan).
Measurement of mRNA expression by RNase protection assay
Total cellular RNA was isolated by the acid guanidium
thiocyanate-phenol-chloroform method, and mRNA levels were determined
using the RNase protection assay according to the procedure previously
described [29
]. Briefly, 10 µg of total cellular RNA
was hybridized in solution to a 32P-labeled antisense
riboprobe overnight at 50°C in 80% formamide. The plasmid was
linearized with HinfI (CCR5), Hinc II (CCR1),
HpaI (CXCR3), AvaII (MIP-1), BglII
(MIP-1ß), and FokI (RANTES), and in vitro transcription
was performed in the presence of [-32P]uridine
triphosphate. The protected fragment (172 bp for CCR5, 179 bp for CCR1,
279 bp for CXCR3, 216 bp for MIP-1, 313 bp for MIP-1ß, and 232 bp
for RANTES) was separated on a denaturing sequencing gel. As an
internal control for the amount of RNA loaded onto the gel, RNA was
simultaneously hybridized to an antisense 32P-labeled probe
for the ß2 microglobulin gene (127 bp).
Calcium mobilization assay
T cells were suspended at 107/mL in 2% fetal bovine
serum/PBS containing 3 µM Fura-2 acetoxymethyl ester (DOJINDO,
Kumamoto, Japan) and incubated at 37°C for 30 min. Fura-2-loaded
cells were pelleted and washed twice and then resuspended at 5 x
106/mL in PBS containing 0.5 mM CaCl2. The
calcium response was initiated by the addition of 1 nM MIP-1, 10 nM
MIP-1ß, or 10 nM RANTES. Cells were analyzed for free calcium ion by
measurement of Fura-2 fluorescence emission on a HITACHI F-3000
fluorescence photometer (Hitachi, Tokyo, Japan).
Stimulation of purified T cells with anti-CD3 plus anti-CD28 mAb
and subsequent exposure to IL-12
Lymph node cells from (C57BL/6xC3H/He)F1 mice were
depleted of B cells and Ia+ APCs by immunomagnetic negative
selection as follows. Cells were allowed to react with
anti-I-Ad/b mAb and then incubated with magnetic
particles bound to goat anti-mouse Ig (Advanced Magnetics, Cambridge,
MA). A T cell population depleted of
anti-I-Ad/b-labeled and surface Ig+ cells was
obtained by removing cell-bound magnetic particles with a rare-earth
magnet (Advanced Magnetics). T cell cultures were carried out as
follows. Anti-CD3 (5 µg/mL) and anti-CD28 (2 µg/mL) mAbs were
coimmobilized to individual wells of 24-well culture plates (Corning
25860; Corning Glass Works, Corning, NY) in a volume of 0.5 mL in PBS.
After 3 h, solutions were discarded and plates were washed with
PBS twice. Purified T cells were cultured in 2 mL of RPMI 1640 medium
supplemented with 10% fetal bovine serum and 2-mercaptoethanol at
1.5 x 106 cells/well in a humidified atmosphere (5%
CO2) at 37°C. Cells were harvested 48 h later and
after washing were recultured in the presence of 250 pg/mL of rIL-12 or
100 U/mL of rIL-2 for an additional 48 h.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
|
|
|
|
,
MIP-1ß, and RANTES [9
], is expressed on the surfaces
of 2D6IL-12 cells, and, if so, whether it functions as a
receptor for stimulation with these chemokines. The procedure used for
the detection of cytokine receptors such as IFN-R
[21
] and IL-12R [16
] was applied to the
detection of surface CCR5 expression. Namely, 2D6IL-12
cells were incubated with either MIP-1, MIP-1ß, or RANTES and then
stained with antibody against the corresponding chemokine. Figure 6
shows that the binding of anti-MIP-1 or anti-RANTES Ab was
detected by preincubation with the corresponding chemokine but not with
an alternative chemokine. These results show that the binding sites for
MIP-1 and RANTES were detected on the surfaces of
2D6IL-12 cells. Such a binding site was not detected on
2D6IL-2 cells (data not shown). MIP-1 and RANTES also
reacted with CCR1. Because 2D6IL-12 cells failed to express
CCR1, the MIP-1/RANTES-binding site could represent CCR5. To
directly demonstrate the expression of CCR5 on 2D6IL-12 but
not on 2D6IL-2 cells, CCR5 was stained using anti-CCR5
polyclonal (Fig. 7
A) and monoclonal (Fig. 7B)
Abs. The results show that CCR5 was
detected only on 2D6IL-12 cells.
|
|
|
, MIP-1ß, or RANTES
resulted in high (MIP-1 and MIP-1ß) or moderate (RANTES) levels of
Ca2+ influx in 2D6IL-12 cells. Thus, CCR5
expressed on 2D6IL-12 cells was functional. In contrast,
2D6IL-2 cells showed only marginal levels of
Ca2+ influx after MIP-1 stimulation (Fig. 9B)
. Together,
these results show that 2D6IL-12 cells expressed CCR5 on
their surfaces and that the expressed CCR5 reacted with the relevant
chemokines and worked as a functional receptor.
|
, MIP-1ß,
and RANTES) are expressed by 2D6IL-12 and
2D6IL-2 cells (Fig. 5B)
. Detectable albeit low levels of
RANTES mRNA expression were seen in both types of 2D6 cells, but
MIP-1 and MIP-1ß mRNAs were not detectable in either cell type.
Thus, in contrast to the clear-cut difference in the expression of
CCR5, there was no substantial difference in the mRNA expression of
CCR5-reactive chemokines between 2D6IL-12 and
2D6IL-2. Our previous study [31
] showed that
2D6IL-12 expresses IL-18R. We also examined the effect of
IL-18 on the expression of CCR5 and CCR5-reactive chemokines by
2D6IL-12. As shown in Figure 10
, IL-18 did not induce CCR5 expression, but unlike IL-12 and IL-2,
this cytokine stimulated strikingly high levels of RANTES mRNA
expression.
|
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Our previous study [16 ] describing the establishment of an IL-12-responsive T cell clone (2D6) showed that 2D6 cells express both LFA-1 and ICAM-1 and adhere to each other via interaction between LFA-1 and ICAM-1, resulting in large cell aggregates. Because 2D6 cells also respond to IL-2 [16 ], 2D6 cells can be maintained with IL-2 instead of IL-12. In the course of these experiments, we found that 2D6IL-2 cells did not form cell aggregates. Initially, we thought that the expression of either LFA-1 or ICAM-1 was reduced in 2D6IL-2 cells. Contrary to expectations, the present study showed that 2D6IL-2 cells expressed levels of LFA-1 and ICAM-1 comparable with those observed for 2D6IL-12 cells. This is compatible with the notion that the expression of adhesion molecules does not necessarily imply that they exert their adhesive capacity.
A considerable body of evidence highlights the role of chemokines and chemokine receptors in the regulation of leukocyte migration from the vascular compartment to inflammatory sites [1 2 3 ]. It is becoming increasingly evident that chemokines promote the conversion from a weakly adherent (integrin-independent) phenotype to a firmly adherent (integrin-dependent) phenotype during lymphocyte extravasation, suggesting that chemokines are capable of up-regulating integrin function by an "inside-out" activation mechanism [8 , 32 33 34 35 ]. This view is supported by in vivo findings showing that mice lacking particular chemokine receptors display impaired leukocyte transmigration into sites of inflammation [36 37 38 39 ]. Such knowledge led us to examine whether 2D6IL-12 and 2D6IL-2 cells both express the chemokine receptors that have been reported to be expressed on Th1 cells. The chemokine receptors CCR5 and CXCR3 have been regarded as characteristic of CD4+ Th1 lymphocytes [11 12 13 ] and implicated in the recruitment of Th1 cells to inflammatory sites such as the synovial lesion in rheumatoid arthritis [12 , 13 ], indicating their importance in T cell-mediated inflammatory responses. Our results showed that 2D6IL-12 and 2D6IL-2 cells expressed high and only marginal levels of CCR5, respectively.
In contrast to the clear-cut difference in CCR5 expression, the
expression of CCR5-reactive chemokines (MIP-1, MIP-1ß, and RANTES)
did not differ greatly between these two types of 2D6 cells. Only
RANTES mRNA was expressed by 2D6IL-12 and
2D6IL-2 at comparable levels. Thus, it is assumed that in
2D6IL-12 cells, CCR5 is continuously stimulated with RANTES
and LFA-1 is activated as a result of CCR5 stimulation. This
possibility was supported by two lines of observation. First,
LFA-1-mediated 2D6 cell aggregation was accelerated by signals that
enhance RANTES expression. 2D6 cells were previously found to express
IL-18R and to respond to IL-18 [31
]. This study showed
that IL-18 stimulation of 2D6 cells selectively up-regulated RANTES but
not CCR5 mRNA expression. Thus, accelerated aggregation induced in
2D6IL-12 cells costimulated with IL-18 could result from
the exposure of CCR5 to a large amount of RANTES induced by IL-18.
Second, LFA-1-mediated 2D6 cell aggregation is strongly inhibited by
adding an anti-CCR5 Ab capable of blocking CCR5 function
[20
]. These observations support the notion that
stimulation of CCR5 leads to up-regulation of an LFA-1-mediated
adhesive capacity in T cells.
An important aspect of the present study is that the chemokine receptor CCR5 is induced by stimulation with IL-12 but not with IL-2. CCR5 expression on human T cells, particularly CD45RO+ (memory) T cells, is selectively induced by exposing these cells to IL-2 [14 , 15 ]. IL-12 has been shown to induce only low levels of CCR5 expression [14 ] or rather to inhibit IL-2-mediated up-regulation of CCR5 expression [15 ]. In the 2D6 CD4+ Th1 cell system, IL-2 failed to up-regulate CCR5 expression, and the expression of this chemokine receptor was selectively inducible by IL-12. Thus, the observations made in the present model are quite discordant with the results obtained for human memory T cells. However, the previous studies [14 , 15 ] did not examine whether memory (CD45RO+) T cells express sufficient levels of IL-12R for responding to IL-12 stimulation. Therefore, the failure of IL-12 to induce CCR5 expression in human T cells may not necessarily be due to an inability of this cytokine to induce expression. Further studies are required to reconcile the seemingly discordant results observed in the two systems by preparing a human T cell population expressing optimal levels of IL-12R and examining the capacity of IL-12 to induce CCR5 expression in such a T cell population.
It should also be noted that 2D6IL-12 cells express high levels of CCR5 but fail to express CXCR3. The expression of CCR5 and CXCR3 has thus far been observed in parallel on Th1 cells. Whereas naive (cord blood) human T cells express neither CCR5 nor CXCR3, Th1-polarized cells express moderate levels of CCR5 and high levels of CXCR3 [12 ]. The expression of these receptors has also been studied in T cells from rheumatoid joints which acquire a Th1 phenotype in vivo, and these T cells express high levels of CCR5 and CXCR3 [12 , 13 ]. In this study, only marginal levels of CXCR3 were detected on 2D6IL-12 cells expressing CCR5, indicating that IL-12 failed to up-regulate CXCR3 expression on 2D6 cells. While CXCR3 was expressed on Th1 cells infiltrating the inflammatory site, it appears that the expression of this chemokine receptor was regulated differently from that of CCR5, and IL-12 induced selective expression of CCR5.
Our present results show that CCR5 expression was selectively induced on 2D6 mouse CD4+ Th1 cells exposed to IL-12. LFA-1 expressed on 2D6 cells was activated to exhibit a firmly adherent function depending on CCR5-derived signals. Thus, this study demonstrated a critical role for IL-12 in the induction of CCR5 on T cells as well as a role for IL-12-induced CCR5 in up-regulating integrin function via an "inside-out" activation mechanism. Moreover, these results are compatible with the notion that CCR5+ T cells are stimulated with the relevant chemokines expressed at inflammatory sites to induce tight interaction with endothelial ICAM-1 through CCR5-mediated LFA-1 activation [1 2 3 4 5 6 7 8 ]. The 2D6 cell system could also provide an intriguing model for investigating not only the molecular mechanisms by which IL-12 signals induce CCR5 expression but also those mechanisms by which CCR5 signals elicit the functional activation of LFA-1.
|
ACKNOWLEDGEMENTS |
|---|
Received February 26, 2001; revised April 23, 2001; accepted April 24, 2001.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and MIP-1ß Science 260,355-358 receptor Proc. Natl. Acad. Sci. USA 86,8497-8501 receptors: evidence for two closely linked C-C chemokine receptors on chromosome 9 J. Biol. Chem 271,7551-7558 receptor Proc. Natl. Acad. Sci. USA 89,11964-11968 in response to IL-18 J. Immunol 160,3759-3765-inducing factor in enhanced production of IFN- J. Immunol 159,2125-21314ß1 and 5ß1 integrin avidity by CC chemokines in monocytes: implications for transendothelial chemotaxis J. Cell Biol 134,1063-1073This article has been cited by other articles:
|
|
 |
|
  P. Gao, R. L. Wange, N. Zhang, J. J. Oppenheim, and O. M. Z. Howard Negative regulation of CXCR4-mediated chemotaxis by the lipid phosphatase activity of tumor suppressor PTEN Blood, October 15, 2005; 106(8): 2619 - 2626. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Gough, M. Crittenden, U. Thanarajasingam, L. Sanchez-Perez, J. Thompson, D. Jevremovic, and R. Vile Gene Therapy to Manipulate Effector T Cell Trafficking to Tumors for Immunotherapy J. Immunol., May 1, 2005; 174(9): 5766 - 5773. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. D. Perez, D. Mitchell, G. C. Jager, and G. P. Nolan LFA-1 signaling through p44/42 is coupled to perforin degranulation in CD56+CD8+ natural killer cells Blood, August 15, 2004; 104(4): 1083 - 1093. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ito, A. Matejuk, C. Hopke, H. Drought, J. Dwyer, A. Zamora, S. Subramanian, A. A. Vandenbark, and H. Offner Transfer of Severe Experimental Autoimmune Encephalomyelitis by IL-12- and IL-18-Potentiated T Cells Is Estrogen Sensitive J. Immunol., May 1, 2003; 170(9): 4802 - 4809. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Gao, X.-Y. Zhou, Y. Yashiro-Ohtani, Y.-F. Yang, N. Sugimoto, S. Ono, T. Nakanishi, S. Obika, T. Imanishi, T. Egawa, et al. The unique target specificity of a nonpeptide chemokine receptor antagonist: selective blockade of two Th1 chemokine receptors CCR5 and CXCR3 J. Leukoc. Biol., February 1, 2003; 73(2): 273 - 280. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Losana, C. Bovolenta, L. Rigamonti, I. Borghi, F. Altare, E. Jouanguy, G. Forni, J.-L. Casanova, B. Sherry, M. Mengozzi, et al. IFN-{gamma} and IL-12 differentially regulate CC-chemokine secretion and CCR5 expression in human T lymphocytes J. Leukoc. Biol., October 1, 2002; 72(4): 735 - 742. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Rodriguez-Sosa, A. R. Satoskar, R. Calderon, L. Gomez-Garcia, R. Saavedra, R. Bojalil, and L. I. Terrazas Chronic Helminth Infection Induces Alternatively Activated Macrophages Expressing High Levels of CCR5 with Low Interleukin-12 Production and Th2-Biasing Ability Infect. Immun., July 1, 2002; 70(7): 3656 - 3664. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ariel, D. Novick, M. Rubinstein, C. A. Dinarello, O. Lider, and R. Hershkoviz IL-12 and IL-18 induce MAP kinase-dependent adhesion of T cells to extracellular matrix components J. Leukoc. Biol., July 1, 2002; 72(1): 192 - 198. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Tang, T. P. Cheng, D. Agnello, C.-Y. Wu, B. D. Hissong, W. T. Watford, H.-J. Ahn, J. Galon, J. Moss, M. Vaughan, et al. Cybr, a cytokine-inducible protein that binds cytohesin-1 and regulates its activity PNAS, February 20, 2002; (2002) 52712999. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Tang, T. P. Cheng, D. Agnello, C.-Y. Wu, B. D. Hissong, W. T. Watford, H.-J. Ahn, J. Galon, J. Moss, M. Vaughan, et al. Cybr, a cytokine-inducible protein that binds cytohesin-1 and regulates its activity PNAS, March 5, 2002; 99(5): 2625 - 2629. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||
