Division of Respiratory Medicine, Institute for Lung Health, University of Leicester Medical School, Leicester, United Kingdom
Correspondence: Dr. Peter Bradding, Department of Respiratory Medicine, Glenfield Hospital, Groby Road, Leicester LE3 9QP, UK. E-mail: pbradding{at}hotmail.com
|
|
|---|
Key Words: human mast cells chloride potassium
|
|
|---|
Although it is clear that immunoglobulin (Ig) E-dependent activation of both human and rodent mast cells is characterized by an influx of extracellular Ca2+, which is essential for subsequent release of both preformed (granule-derived) mediators and newly generated prostaglandin D2, leukotriene C4, and cytokines, additional ion currents are likely to regulate Ca2+ entry by modulating membrane potential. In fact, in many cells, K+, Cl-, and Na+ currents clearly regulate numerous cellular processes of relevance to both normal tissue homeostasis and disease, including cell proliferation [2 ], differentiation [3 ], chemotaxis [4 ], activation [5 ], and apoptosis [6 ]. The role that these ion channels play in these events in human mast cells is unknown, but our overarching hypothesis is that proinflammatory pathways giving rise to the pathological mast cell phenotype will alter the activity of the final "effector" ion channels controlling mast cell function.
In both the rat basophil leukemic cell line RBL-2H3, a model of mucosal
mast cells, and rat interleukin-3-dependent bone marrow-derived mast
cells, an inwardly rectifying K+ channel (Kir) is open when
the cells are at rest (i.e., in the nonsecreting state)
[7
, 8
]. This channel, which is considered
to be Kir2.1 because of its current-voltage characteristics coupled
with coexpression of Kir2.1 mRNA [9
], induces a resting
membrane potential of
-70 mV. After rodent mast cell activation,
several other currents appear, including a nonselective
Ca2+ influx pathway [10
], specific
Ca2+ influx through store-operated calcium channels
[11
], an outwardly rectifying Cl-
conductance [12
], a latent outwardly rectifying
K+ channel which is activated in a GTP-dependent and
pertussis toxin-sensitive manner [13
], and a selective
sodium influx pathway [14
]. However, to date there has
been no published data on human mast cell ion currents.
Because there are important differences between rodent models and human mast cells with respect to mediator content as well as secretory and pharmacological responsiveness, studies must be ultimately performed on human cells. The human mast cell line HMC-1, originating from a patient with mast cell leukemia and expressing several features of mature human mast cells, has proved a valuable model for studying human mast cell biology [15 ]. In this study, we used whole-cell and cell-attached patch-clamp electrophysiological recordings to identify the ion currents expressed by this cell line and, for comparison, resting unactivated human skin mast cells (HSMCs).
|
|
|---|
Culture media
Iscoves medium, RPMI
1640-Glutamax-N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic
acid (HEPES), nonessential amino acid solution, antibiotic/antimycotic
solution, and iron-supplemented fetal calf serum were purchased from
Life Technologies (Paisley, Scotland, UK). Monothioglycerol was
purchased from Sigma.
Cell lines
The human mast cell line HMC-1 was a generous gift from Dr. J.
Butterfield (Mayo Clinic, Rochester, MN). The cells were cultured, as
described previously, in Iscoves medium containing 10%
iron-supplemented fetal calf serum and 1.2 mM
-thioglycerol.
Skin mast cell purification
HSMCs were dispersed from human umbilical cords obtained within
1 h of delivery, using the method previously described for lung
mast cells [12
]. Mast cells were purified using
immunomagnetic affinity selection with anti-mouse IgG1 magnetic beads
(Dynal, Wirral, UK) coated with the mouse anti-c-kit monoclonal
antibody YB5.B8 [12
]. The final mast cell purity was
100% for two donors and 70% for another, while viability was >97%
in all preparations. The contaminating cells were a single population
of large cells with punctate granules, presumably c-kit+
melanocytes, which were readily distinguishable from mast cells
morphologically. After purification, HSMCs were cultured overnight on
1% bovine serum albumin-coated plastic (to prevent adhesion) in RPMI
1640-Glutamax-HEPES containing antibiotic-antimycotic solution,
nonessential amino acids, 10% fetal calf serum, and 10 ng/mL of stem
cell factor.
Electrophysiology
The whole-cell and cell-attached versions of the patch-clamp
technique were used [16
]. Patch pipettes were made from
borosilicate-fiber-containing glass (Clark Electromedical Instruments,
Reading, UK), and their tips were heat polished, resulting in
resistances of typically 46 M
. The standard pipette solution
contained 140 mM KCl, 2 mM MgCl2, 5 mM EGTA, and 10 mM
HEPES, pH 7.2. The standard external solution contained 140 mM NaCl, 5
mM KCl, 2 mM CaCl2, 1 mM MgCl2, and 10 mM
HEPES, pH 7.3. These and other solutions used are shown in Table 1
. For recordings, mast cells were placed in 35-mm-diameter dishes
containing standard external solution.
|
View this table: [in a new window] |
Table 1. Ionic Composition of Commonly Used Solutions
|
3 mV;
therefore, they were ignored during analyses. Experiments were
performed at a range of temperatures between room temperature
(2025°C) and 35°C, with the temperature being controlled by a
Peltier device (we are uncertain of the manufacturer for this device).
Experiments were performed with a perfusion system (Automated
Scientific Inc., San Francisco, CA) to allow solution changes, although
drugs were added directly to the recording chamber.
Reverse Transcription-PCR
HMC-1 cells were pelleted, and total cellular RNA was extracted
using an SV total-RNA isolation kit (Promega, Madison, WI). Total RNA
was subjected to a one-tube reverse transcription (RT)-PCR, using an
Access RT-PCR kit (Promega) according to the manufacturers
instructions. RT was carried out at 48°C for 45 min, after which PCR
amplification was performed for 40 cycles in a DNA thermal cycler
(Perkin-Elmer, Norwalk, CT), with each cycle set for 94°C for 30 s, 60°C for 1 min, and 68°C for 2 min. Ten µL of PCR product were
electrophoresed in a 1.5% agarose gel. Control reactions were
performed in the absence of reverse transcriptase. Forward and reverse
PCR primer sequences for the human CLC-3, -4, and -5 genes were
synthesized as follows: ClC-3 forward,
5'-(1960)GCTGCTGACGTTATGAGACCTCG(1982)-3'; CIC-3 reverse,
5'-(2194)CCCGAGAACTGCCAACGATACCT(2172)-3'; CIC-4 forward,
5'-(1919)GAGACTCCGAGCGCCTCATTGG(1940)-3'; CIC-4 reverse,
5'-(2060)CTGTTGGCCGGCAGCTCGGGGGG(2038)-3'; ClC-5 forward,
5'-(2072)TGTTGACTGTCCTTACTCAG(2091)-3'; and CIC-5 reverse,
5'-(2340)GAGGATGTTCCGAAGCTTTA(2321)-3'. (The numbers in parentheses
refer to the nucleotide positions in the mRNA, with the translation
initiation site being assigned the value +1.) Predicted band sizes were
235 bp (ClC-3), 142 bp (ClC-4), and 269 bp (ClC-5).
Data presentation and statistical analysis
Data are expressed as means ± SE unless
otherwise stated. Differences between groups of data were explored
using Students paired or unpaired t-test (two-tailed) as
appropriate. A P value of <0.05 was considered
statistically significant.
|
|
|---|
![]() View larger version (25K): [in a new window] |
Figure 1. (a) Typical whole-cell membrane current recorded from an HMC-1 cell
(left graph). The cell was clamped at a holding potential of -20 mV,
and 100-ms voltage commands were applied from -140 to +140 mV in 10-mV
steps (shown on the right). (b) Current-voltage relationship from the
same cell. (c) Current-voltage relationship demonstrating the reduction
of the outwardly rectifying current and positive shift in reversal
potential after replacement of extracellular Cl- with
methanesulfonate ions. Values are means of data from five experiments.
(d) Current-voltage relationship showing the relative permeability of
iodide and nitrate ions compared with that of chloride ions. Values are
means of data from four experiments. (e) Current-voltage relationship
showing that increasing the extracellular K+ concentration
from 5 to 140 mM has no effect on the outwardly rectifying current.
Note, however, that a small inward current is revealed by the higher
concentration. Values are means of data from four experiments.
|
Another observation was of interest: with standard intracellular and extracellular solutions, the baseline whole-cell current generally remained stable for up to 30 min after the whole-cell configuration was achieved. However, in spite of clear evidence of a dominant Cl- conductance, the baseline current rapidly declined when the cells were dialyzed against intracellular NaCl or Na+ methanesulfonate, suggesting that disturbance of the normal cation distribution within the cell may have a critical effect on Cl- channel function.
A small inward current was also evident in
50% of HMC-1 cells. This
current was not affected by alterations in extracellular
Cl- concentration, but a consistent increase in inward
current was demonstrated on switching from 5 mM to either 70 or 140 mM
K+ external (from -12.3±1.9 pA to -38.5±4.2 pA for 140
mM K+ at -130 mV; P=0.021, n=4),
indicating that a K+ conductance was present (Fig. 1e)
.
This was particularly evident when cells were recorded with
intracellular NaCl and rundown of the outward current (n=3).
With NaCl internal and 140 mM KCl external, an inward current activated
only
0 mV rather than the predicted +70 mV for the calculated
K+ reversal potential, suggestive of voltage-dependent
activation. This current was inwardly rectifying but was not blocked by
addition of barium to the bath in concentrations up to 300 µM (data
not shown). This current was therefore not consistent with the presence
of a member of the inwardly rectifying family of K+
channels (Kir), which are extremely sensitive to the presence of
barium. This current requires further characterization.
In contrast to HMC-1, HSMCs (11 cells from three donors) were electrically silent at rest, with no detectable inward or outward currents, in either physiological or 140 mM extracellular K+ and thus resemble rat peritoneal mast cells [7 ]. It was not possible to characterize the response of these cells to IgE-dependent activation or A23187 because of the instability of membrane seals after addition of these reagents.
Cell-attached single-channel characteristics of the resting HMC-1
chloride conductance
To identify the characteristics of the resting Cl-
conductance in more detail, currents were recorded under resting
conditions in the cell-attached patch-clamp configuration, using NaCl
in the patch pipette. This revealed the presence of a distinct single
population of channels with an estimated single-channel slope
conductance of 41.8 ± 6.1 pS (n=4) and a reversal
potential of
-15 mV (Fig. 2
). From the Nernst equation, this suggests that the intracellular
Cl- concentration is
66 mM.
![]() View larger version (13K): [in a new window] |
Figure 2. (a) Single-channel activity recorded in a cell-attached patch at the
three potentials shown. (b) Amplitude histogram of channels, recorded
at 160 mV. In this cell, a single-channel amplitude of 6.27 pA was
obtained from a Gaussian fit to the histogram. (c) Single-channel
current-voltage relationship obtained from four cells. The plotted line
represents a linear least-squares fit to the data. The slope gives a
single-channel conductance of 41.8 ± 6.1 pS and an extrapolated
zero-current intercept (reversal potential) of -15 mV.
|
100% (112%±27%;
P=0.003, n=16) within 3 min (Fig. 3a
and b
). The current appeared rapidly and, in some
cells, demonstrated slower time-dependent activation than the resting
current, suggesting that a distinct set of channels was opened. In 12
cells, this current remained stable for up to 10 min, but in 4 cells it
ran down rapidly, returning to baseline within 5 min. This effect of
A23187 was seen only when the intracellular solution contained a 90 nM
concentration of nominal free Ca2+ (Table 1
, solution I 2)
(16 of 16 cells) and never when the intracellular solution contained 5
mM EGTA (solution I 1) (6 of 6 cells), indicative of the presence of a
calcium-activated current. In addition, it was not seen when
Ca2+ was omitted from the external bath solution
(n=4). The resting membrane potential was -13.6 ± 2.1
mV with a nominal 90 nM free Ca2+ in the pipette
(n=20), which was significantly lower than that with 5 mM
internal EGTA (P<0.0001). After addition of A23187, the
membrane potential fell from -9.1 ± 2.0 mV to -18.3 ± 2.2
mV (P<0.0001, n=16), suggestive of the presence
of a dominant Cl- conductance as well as a contribution
from a K+ conductance (Fig. 3a
and 3b)
. To eliminate the
possibility of contributions from K+ ions, cells were
recorded with NaCl internal (solution I 3) and NaCl external (solution
E 1). As mentioned above, recording with intracellular NaCl led to
rapid rundown of the baseline Cl- current, which permitted
further examination of the ionophore-induced current. In these sodium
solutions, A23187 still induced an outward current within minutes of
addition to the bath solution (eight of eight cells) (Fig. 3c)
, which
demonstrated a decrease in outward current on reduction of the
extracellular Cl- concentration by using Na+
methanesulfonate (29%±9%; P=0.017, n=4). Thus,
HMC-1 opened a Ca2+-activated Cl- channel
after an influx of extracellular calcium.
![]() View larger version (20K): [in a new window] |
Figure 3. (a) Current recordings obtained before (i) and after (ii) application
of 1 µM A23187 to an HMC-1. The lower trace (iii) shows the
subtracted current, revealing the A23187-induced component. (b) Mean
current-voltage relationship of the currents recorded in 16 cells: (i)
at baseline, (ii) after addition of A23187, and (iii) the difference
between i and ii. For readability, error bars are omitted from the
subtracted trace (open squares). (c) Effect of A23187 on HMC-1 cells,
recorded using internal and external NaCl. Note the smaller currents in
these solutions. Values are means of data from eight experiments.
|
![]() View larger version (21K): [in a new window] |
Figure 4. (a) Tail current in a cell, recorded with internal K+
methanesulfonate containing 90 nM nominal free Ca2+ and
extracellular Na+ methanesulfonate before (i) and after
(ii) addition of 1 µM A23187. Tail currents were recorded by applying
voltage commands to +140 mV from a holding potential of -70 mV and
then postcommand voltage potentials of -140 to +130 mV in 10-mV steps.
Note the large tail current after the application of A23187. The right
trace (iii) shows the subtracted current, revealing the A23187-induced
component. (b) Mean current-voltage relationship of the tail currents
from six cells, recorded under the same conditions as used for the
traces in panel a: (i) at baseline, (ii) after addition of A23187, and
(iii) the difference between i and ii. For the sake of readability,
error bars are omitted from the subtracted trace (open squares). (c)
Mean current-voltage relationship of the tail currents from four cells
recorded in 5 mM external K+ and 145 mM external
K+. The shift in reversal potential from -75 to 0 mV
indicates the presence of a dominant K+ current.
|
Response of HMC-1 to hypotonicity
On exposure to a hypotonic solution, nearly all mammalian cells
activate a Cl- conductance, which is believed to regulate
cell volume under such conditions. Addition of water to reduce the
osmolality to 0.75 N led to variable increases in inward and outward
currents. Recording immediately after switching back to a normal
external solution with normal ion concentrations revealed an even
larger increase in inward and, more predominantly, outward currents
(from 0.61±0.11 nA to 1.23±0.17 nA at +130 mV; P=0.012,
n=3), with a reversal potential of
0 mV (Fig. 5
). Subsequent subtraction of the baseline current revealed the
presence of a whole-cell current exhibiting a weaker outward
rectification than the baseline current, with a reversal potential of 0
mV, consistent with opening of the ubiquitously expressed
volume-regulatory voltage-dependent Cl- channel ClC-3
(Fig. 5)
.
![]() View larger version (20K): [in a new window] |
Figure 5. Current-voltage relationship showing the baseline current (i) and the
current after reduction of the osmolarity to 0.75 N and then returning
to the normal extracellular solution (ii). The subtracted current (iii)
demonstrates the development of a current exhibiting weaker outward
rectification, with a reversal potential of 0 mV, suggesting the
existence of a dominant Cl- conductance. Values are means
of data from three experiments.
|
![]() View larger version (54K): [in a new window] |
Figure 6. RT-PCR for the voltage-dependent chloride channels ClC-3, ClC-4, and
ClC-5, using HMC-1 mRNA, demonstrating bands of the predicted size for
ClC-3 and ClC-5. See the text for details of the methods used.
|
|
|
|---|
In rodent mast cells, several ion conductances have been described at rest and after activation, including those for Cl-, K+, Na+, and Ca2+ [7 8 9 10 11 12 13 14 ]. Interestingly, rodent mast cells of different phenotypes have been reported to express different currents, which may explain, in part, mast cell functional heterogeneity. For example, the rat basophilic leukemic cell line and rodent bone marrow-derived mast cells, which are considered to represent a mucosal mast cell phenotype, express at rest a strong inwardly rectifying K+ current which sets a stable resting membrane potential close to the K+ reversal potential, at about -70 mV. In contrast, rat peritoneal mast cells, typical of connective-tissue-type mast cells, either are electrically silent at rest or express an outwardly rectifying Cl- conductance [18 ]. HMC-1 and HSMCs are therefore unlike rodent mucosal type mast cells but more closely resemble rat peritoneal mast cells in terms of ion currents expressed at rest.
The most striking observation in this study was the presence in HMC-1, at rest, of a voltage-dependent Cl- conductance exhibiting rapid activation kinetics and extreme outward rectification, with electrophysiological characteristics similar to those of the voltage-dependent Cl- channels ClC-4 and ClC-5 [19 , 20 ]. In humans, ClC-4 mRNA is expressed most abundantly in skeletal muscle, the heart, and the brain [19 , 21 ] while ClC-5 is located predominantly in the kidney [22 ]. Interestingly, both of these channels have been identified only in plasma membranes when overexpressed after transfection of Xenopus oocytes and Chinese hamster ovary cells [19 , 20 ]. This is, therefore, the first description of this type of current in a native leukocyte. In transfected cells, both channels exhibit extreme outward rectification, with currents visible at membrane potentials positive to about +20 mV. In terms of channel electrophysiology, there are conflicting data on the sensitivity of these two channels to the putative Cl- channel blocker DIDS and the relative permeability of chloride versus iodide [19 , 20 ]. Thus, the rapid current activation and inactivation kinetics (no tail currents), whole-cell current-voltage relationship (extreme outward rectification), greater iodide than chloride permeability, and relative insensitivity to DIDS are consistent with the presence of ClC-4 or -5 or a novel, closely related ClC family member in the HMC-1 plasma membrane. Using RT-PCR, we have demonstrated the presence of mRNA for ClC-5, but not ClC-4, in HMC-1, which suggests that the current observed may indeed be carried by ClC-5. Rat peritoneal and bone marrow-derived mast cells also express a strong outwardly rectifying Cl- conductance [18 ], but this is activated instantaneously, is dependent on temperature, and is exquisitely sensitive to DIDS, suggesting that the current is not being carried by ClC-4 or -5.
Using immunohistochemistry, Gunther and co-workers have demonstrated
that ClC-5 is found in intracellular vesicles within the renal tubules
and collecting ducts [23
]. There it colocalizes with the
H+-ATPase, and it has been hypothesized that it therefore
helps provide the electrical shunt for the efficient acidification of
vesicles and the reabsorption of tubular protein. The role ClC-4 or
ClC-5 might play in the cell membrane is unclear because both only
activate at membrane potentials positive to about +20 mV, a level that
many nonexcitable cells may never reach. However, even a small inward
Cl- current at negative membrane potentials will be
sufficient to set the cell membrane potential to
0 mV, which is
indeed the recorded resting membrane potential in HMC-1. The presence
of a ClC-4/5-like current in the plasma membrane is therefore likely to
have a profound effect on HMC-1 membrane potential and, thus, cell
function. Because HMC-1 was isolated from the blood of a patient with
mast cell leukemia, the expression of this Cl- conductance
raises the possibility that this current contributes to the malignant
phenotype of the cell. In support of this hypothesis, we have also
observed a similar current in the leukemic human basophil cell line
KU-812 (data not shown), and mature tissue mast cells from human skin,
which do not divide, did not express this current. Furthermore,
Steinmeyer and co-workers observed the presence of ClC-5 mRNA in
several cell lines (24)
, and a current very similar to
ClC-4/5 but with slower inactivation kinetics and partial dependency on
extracellular Ca2+ has been observed in primary cultures of
astrocytomas and astrocytoma cell lines (25)
, and is cell
cycle-dependent (26)
. Voets and co-workers have made
similar observations regarding a Cl- current in skeletal
muscle [27
] and have demonstrated that tamoxifen, an
inhibitor of endothelial Cl- conductance, also inhibits
endothelial-cell proliferation [28
].
HMC-1 also expressed currents in response to addition of the calcium ionophore A23187 to the bath solution. These currents never occurred when the internal pipette solution contained 5 mM EGTA or when Ca2+ was omitted from the bath solution, indicating that they are dependent on the influx of extracellular Ca2+. Manipulation of the pipette and bath solution and analysis of ionophore-induced tail currents indicated that both K+ and Cl- currents were invoked in response to A23187, both of which demonstrated outward rectification, in keeping with the Ca2+-activated K+ (KCA) and Cl- (ClCA) currents identified in many cell types [29 30 31 ]. The involvement of these types of currents in cell activation is predicted to be through the regulation of membrane potential, and thereby influencing Ca2+ influx via store-operated Ca2+ channels, which show inward rectification at negative membrane potentials [32 ]. While several calcium-dependent K+ channels have been cloned, only two human Ca2+-activated Cl- channels fall into this category, and they are expressed exclusively by epithelia [29 , 30 ]. Thus, while it should be possible to identify the HMC-1 KCA, further cloning may be required for the molecular identification of the ClCA.
Most cells open Cl- channels, which are believed to be important for the regulation of cell volume, in response to hypotonicity of the extracellular solution. Two members of the voltage-dependent family of Cl- channels, namely the inwardly rectifying channel ClC-2 and the outwardly rectifying channel ClC-3 [17 ], have been shown to be activated in response to reduced extracellular osmolality. HMC-1 activated an outwardly rectifying Cl- current in response to hypotonicity and expressed mRNA for ClC-3, suggesting that ClC-3 carries out the volume-regulatory role in these cells.
In this study, we have used the whole-cell configuration of the patch-clamp technique to analyze HMC-1 ionic currents. Because this meant that the cell was dialyzed against the pipette solution, there was the potential for washout of important intracellular constituents such as cyclic nucleotides, which may themselves modulate ion channel function. Thus, it is possible that HMC-1 expresses other currents that have not been identified in this study. Further analysis, using the perforated-patch technique, will help address this. In addition, in the present study, recording was generally limited to a temperature of 29°C because of the instability of seals at higher temperatures. However, on the occasions that we were able to record at higher temperatures, there were no apparent differences in the whole-cell resting current.
In summary, we have described, for the first time, ionic currents in a human mast cell, albeit a malignant leukemic mast cell line. This provides insight into the potential mechanisms for the electrical regulation of leukemic mast cell function and, in many situations, the electrical regulation of the mature human mast cell, which often exhibits biological responses similar to those of HMC-1 [33 34 35 ]. Intriguingly, HMC-1 expresses a resting Cl- conductance exhibiting extreme outward rectification and other characteristics of the voltage-dependent Cl- channels ClC-4 and ClC-5. However, this is the first time that these currents have been documented to occur in the plasma membrane of a native cell, thus indicating a role for these channels in the regulation of HMC-1 membrane potential and cell function. Furthermore, HMC-1 may provide a novel tool for investigating the role of these channels in cell biology.
We are very grateful to Marianne Kulka, University of Alberta, for supplying the rat ClC family RT-PCR primer sequences from which our human primers were modified. We are also very grateful to Karen Conway for technical assistance.
Received October 10, 2000; revised March 8, 2001; accepted April 9, 2001.
|
|
|---|
This article has been cited by other articles:
![]() |
L. Woodman, S. Siddiqui, G. Cruse, A. Sutcliffe, R. Saunders, D. Kaur, P. Bradding, and C. Brightling Mast Cells Promote Airway Smooth Muscle Cell Differentiation via Autocrine Up-Regulation of TGF-{beta}1 J. Immunol., October 1, 2008; 181(7): 5001 - 5007. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Shumilina, R. S. Lam, F. Wolbing, N. Matzner, I. M. Zemtsova, M. Sobiesiak, H. Mahmud, U. Sausbier, T. Biedermann, P. Ruth, et al. Blunted IgE-Mediated Activation of Mast Cells in Mice Lacking the Ca2+-Activated K+ Channel KCa3.1 J. Immunol., June 15, 2008; 180(12): 8040 - 8047. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. E. Wykes, M. Lee, S. M. Duffy, W. Yang, E. P. Seward, and P. Bradding Functional Transient Receptor Potential Melastatin 7 Channels Are Critical for Human Mast Cell Survival J. Immunol., September 15, 2007; 179(6): 4045 - 4052. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kaur, R. Saunders, P. Berger, S. Siddiqui, L. Woodman, A. Wardlaw, P. Bradding, and C. E. Brightling Airway Smooth Muscle and Mast Cell-derived CC Chemokine Ligand 19 Mediate Airway Smooth Muscle Migration in Asthma Am. J. Respir. Crit. Care Med., December 1, 2006; 174(11): 1179 - 1188. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Woodman, A. Sutcliffe, D. Kaur, M. Berry, P. Bradding, I. D. Pavord, and C. E. Brightling Chemokine Concentrations and Mast Cell Chemotactic Activity in BAL Fluid in Patients With Eosinophilic Bronchitis and Asthma, and in Normal Control Subjects. Chest, August 1, 2006; 130(2): 371 - 378. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Sutcliffe, D Kaur, S Page, L Woodman, C L Armour, M Baraket, P Bradding, J M Hughes, and C E Brightling Mast cell migration to Th2 stimulated airway smooth muscle from asthmatics Thorax, August 1, 2006; 61(8): 657 - 662. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kulka, R. Dery, D. Nahirney, M. Duszyk, and A. D. Befus Differential Regulation of Cystic Fibrosis Transmembrane Conductance Regulator by Interferon {gamma} in Mast Cells and Epithelial Cells J. Pharmacol. Exp. Ther., November 1, 2005; 315(2): 563 - 570. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Brightling, D. Kaur, P. Berger, A. J. Morgan, A. J. Wardlaw, and P. Bradding Differential expression of CCR3 and CXCR3 by human lung and bone marrow-derived mast cells: implications for tissue mast cell migration J. Leukoc. Biol., May 1, 2005; 77(5): 759 - 766. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bradding, Y. Okayama, N. Kambe, and H. Saito Ion channel gene expression in human lung, skin, and cord blood-derived mast cells J. Leukoc. Biol., May 1, 2003; 73(5): 614 - 620. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Duffy, W. J. Lawley, E. C. Conley, and P. Bradding Resting and Activation-Dependent Ion Channels in Human Mast Cells J. Immunol., October 15, 2001; 167(8): 4261 - 4270. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Yue, D. Merlin, M. E. Selsted, W. I. Lencer, J. L. Madara, and D. C. Eaton Cryptdin 3 forms anion selective channels in cytoplasmic membranes of human embryonic kidney cells Am J Physiol Gastrointest Liver Physiol, May 1, 2002; 282(5): G757 - G765. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||