Journal of Leukocyte Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duffy, S. M.
Right arrow Articles by Bradding, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duffy, S. M.
Right arrow Articles by Bradding, P.
(Journal of Leukocyte Biology. 2001;70:233-240.)
© 2001 by Society for Leukocyte Biology

Voltage-dependent and calcium-activated ion channels in the human mast cell line HMC-1

S. M. Duffy, M. L. Leyland, E. C. Conley and P. Bradding

Division of Respiratory Medicine, Institute for Lung Health, University of Leicester Medical School, Leicester, United Kingdom

Correspondence: Dr. Peter Bradding, Department of Respiratory Medicine, Glenfield Hospital, Groby Road, Leicester LE3 9QP, UK. E-mail: pbradding{at}hotmail.com


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The mechanisms underlying the recruitment, differentiation, and sustained activation of mast cells in disease are likely to include modulation of ion channels. Specific Ca2+, K+, and Cl- conductances have been identified in rodent mast cells, but there are no equivalent data on human mast cells. We have used the whole-cell patch-clamp technique to characterize macroscopic ion currents in both the human mast cell line HMC-1 and human skin mast cells (HSMCs) at rest and in HMC-1 after activation with calcium ionophore. HSMCs were electrically silent at rest. In contrast, HMC-1 expressed a strong outwardly rectifying voltage-dependent Cl- conductance characteristic of ClC-4 or ClC-5 and a small inwardly rectifying K+ current not carried by the classical Kir family of K+ channels. Calcium ionophore induced the appearance of outwardly rectifying Ca2+-activated Cl- and K+ currents, while hypotonicity induced another outwardly rectifying conductance typical of ClC-3. Reverse transcription-PCRs confirmed that mRNAs for the voltage-dependent Cl- channels ClC-3 and –5 were expressed. This is the first definitive description of a ClC-4/5-like current in a native leukocyte. We suggest that this current may contribute to the malignant phenotype while the Ca2+-activated K+ and Cl- currents may be involved in cell activation.

Key Words: human • mast cells • chloride • potassium


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mast cells play a significant role in the pathophysiology of many diverse diseases, including asthma and allergy, rheumatoid arthritis, and pulmonary fibrosis [1 ]. In most of these diseases there is increased recruitment of mast cells and sustained secretion of a plethora of proinflammatory mediators, including autacoids, cytokines, and proteases.

Although it is clear that immunoglobulin (Ig) E-dependent activation of both human and rodent mast cells is characterized by an influx of extracellular Ca2+, which is essential for subsequent release of both preformed (granule-derived) mediators and newly generated prostaglandin D2, leukotriene C4, and cytokines, additional ion currents are likely to regulate Ca2+ entry by modulating membrane potential. In fact, in many cells, K+, Cl-, and Na+ currents clearly regulate numerous cellular processes of relevance to both normal tissue homeostasis and disease, including cell proliferation [2 ], differentiation [3 ], chemotaxis [4 ], activation [5 ], and apoptosis [6 ]. The role that these ion channels play in these events in human mast cells is unknown, but our overarching hypothesis is that proinflammatory pathways giving rise to the pathological mast cell phenotype will alter the activity of the final "effector" ion channels controlling mast cell function.

In both the rat basophil leukemic cell line RBL-2H3, a model of mucosal mast cells, and rat interleukin-3-dependent bone marrow-derived mast cells, an inwardly rectifying K+ channel (Kir) is open when the cells are at rest (i.e., in the nonsecreting state) [7 , 8 ]. This channel, which is considered to be Kir2.1 because of its current-voltage characteristics coupled with coexpression of Kir2.1 mRNA [9 ], induces a resting membrane potential of ~-70 mV. After rodent mast cell activation, several other currents appear, including a nonselective Ca2+ influx pathway [10 ], specific Ca2+ influx through store-operated calcium channels [11 ], an outwardly rectifying Cl- conductance [12 ], a latent outwardly rectifying K+ channel which is activated in a GTP-dependent and pertussis toxin-sensitive manner [13 ], and a selective sodium influx pathway [14 ]. However, to date there has been no published data on human mast cell ion currents.

Because there are important differences between rodent models and human mast cells with respect to mediator content as well as secretory and pharmacological responsiveness, studies must be ultimately performed on human cells. The human mast cell line HMC-1, originating from a patient with mast cell leukemia and expressing several features of mature human mast cells, has proved a valuable model for studying human mast cell biology [15 ]. In this study, we used whole-cell and cell-attached patch-clamp electrophysiological recordings to identify the ion currents expressed by this cell line and, for comparison, resting unactivated human skin mast cells (HSMCs).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents and materials
Stem cell factor was obtained from R&D, Abingdon, UK. Physiological salts, diisothiocyanatostilbene-2,2-disulfonic acid (DIDS), and chlorotoxin were purchased from Sigma, Poole, Dorset, UK. Mouse IgG1 monoclonal antibody YB5B8 (anti-CD117) was from Cambridge Bioscience, Cambridge, UK. Sheep anti-mouse IgG1-coupled Dynabeads were obtained from Dynal, Oslo, Norway.

Culture media
Iscove’s medium, RPMI 1640-Glutamax-N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES), nonessential amino acid solution, antibiotic/antimycotic solution, and iron-supplemented fetal calf serum were purchased from Life Technologies (Paisley, Scotland, UK). Monothioglycerol was purchased from Sigma.

Cell lines
The human mast cell line HMC-1 was a generous gift from Dr. J. Butterfield (Mayo Clinic, Rochester, MN). The cells were cultured, as described previously, in Iscove’s medium containing 10% iron-supplemented fetal calf serum and 1.2 mM {alpha}-thioglycerol.

Skin mast cell purification
HSMCs were dispersed from human umbilical cords obtained within 1 h of delivery, using the method previously described for lung mast cells [12 ]. Mast cells were purified using immunomagnetic affinity selection with anti-mouse IgG1 magnetic beads (Dynal, Wirral, UK) coated with the mouse anti-c-kit monoclonal antibody YB5.B8 [12 ]. The final mast cell purity was 100% for two donors and 70% for another, while viability was >97% in all preparations. The contaminating cells were a single population of large cells with punctate granules, presumably c-kit+ melanocytes, which were readily distinguishable from mast cells morphologically. After purification, HSMCs were cultured overnight on 1% bovine serum albumin-coated plastic (to prevent adhesion) in RPMI 1640-Glutamax-HEPES containing antibiotic-antimycotic solution, nonessential amino acids, 10% fetal calf serum, and 10 ng/mL of stem cell factor.

Electrophysiology
The whole-cell and cell-attached versions of the patch-clamp technique were used [16 ]. Patch pipettes were made from borosilicate-fiber-containing glass (Clark Electromedical Instruments, Reading, UK), and their tips were heat polished, resulting in resistances of typically 4–6 M{Omega}. The standard pipette solution contained 140 mM KCl, 2 mM MgCl2, 5 mM EGTA, and 10 mM HEPES, pH 7.2. The standard external solution contained 140 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, and 10 mM HEPES, pH 7.3. These and other solutions used are shown in Table 1 . For recordings, mast cells were placed in 35-mm-diameter dishes containing standard external solution.


View this table:
[in this window]
[in a new window]
 
Table 1. Ionic Composition of Commonly Used Solutions

 
Whole-cell currents were recorded using an Axoclamp 200A amplifier (Axon Instruments, Foster City, CA), and currents were usually evoked by applying voltage commands to a range of potentials in 10-mV steps from a holding potential of -20 mV. Other experimental protocols used are described where appropriate. The currents were digitized (sampled at a frequency of 10 kHz), stored on a computer, and subsequently analyzed using pClamp software (Axon Instruments). Capacitance transients were minimized by using the capacitance neutralization circuits on the amplifier. Correction for series resistance was not routinely applied. Junction potential changes during Cl- substitution experiments were measured and found to be <=3 mV; therefore, they were ignored during analyses. Experiments were performed at a range of temperatures between room temperature (20–25°C) and 35°C, with the temperature being controlled by a Peltier device (we are uncertain of the manufacturer for this device). Experiments were performed with a perfusion system (Automated Scientific Inc., San Francisco, CA) to allow solution changes, although drugs were added directly to the recording chamber.

Reverse Transcription-PCR
HMC-1 cells were pelleted, and total cellular RNA was extracted using an SV total-RNA isolation kit (Promega, Madison, WI). Total RNA was subjected to a one-tube reverse transcription (RT)-PCR, using an Access RT-PCR kit (Promega) according to the manufacturer’s instructions. RT was carried out at 48°C for 45 min, after which PCR amplification was performed for 40 cycles in a DNA thermal cycler (Perkin-Elmer, Norwalk, CT), with each cycle set for 94°C for 30 s, 60°C for 1 min, and 68°C for 2 min. Ten µL of PCR product were electrophoresed in a 1.5% agarose gel. Control reactions were performed in the absence of reverse transcriptase. Forward and reverse PCR primer sequences for the human CLC-3, -4, and -5 genes were synthesized as follows: ClC-3 forward, 5'-(1960)GCTGCTGACGTTATGAGACCTCG(1982)-3'; CIC-3 reverse, 5'-(2194)CCCGAGAACTGCCAACGATACCT(2172)-3'; CIC-4 forward, 5'-(1919)GAGACTCCGAGCGCCTCATTGG(1940)-3'; CIC-4 reverse, 5'-(2060)CTGTTGGCCGGCAGCTCGGGGGG(2038)-3'; ClC-5 forward, 5'-(2072)TGTTGACTGTCCTTACTCAG(2091)-3'; and CIC-5 reverse, 5'-(2340)GAGGATGTTCCGAAGCTTTA(2321)-3'. (The numbers in parentheses refer to the nucleotide positions in the mRNA, with the translation initiation site being assigned the value +1.) Predicted band sizes were 235 bp (ClC-3), 142 bp (ClC-4), and 269 bp (ClC-5).

Data presentation and statistical analysis
Data are expressed as means ± SE unless otherwise stated. Differences between groups of data were explored using Student’s paired or unpaired t-test (two-tailed) as appropriate. A P value of <0.05 was considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Resting ion currents in the human mast cell line HMC-1 and in HSMCs
Nearly all HMC-1 cells (>200) expressed a strong outwardly rectifying whole-cell current at rest (Fig. 1a and b ), with the resting membrane potential ranging from -10–+20 mV (mean±SE, 2.2±0.2 mV) when the pipette contained 5 mM EGTA [solution I 1 (Table 1) ] (n=94). This current was consistent at temperatures ranging from 21–35°C. The resting whole-cell current exhibited rapid activation and was strongly dependent on membrane voltage, activating at values positive to +30 mV. The steady-state amplitude of the current evoked by a +140-mV command was 0.842 ± 0.047 nA (n=94). Switching the external Cl- concentration from 140 to 11 mM with Na+ methanesulfonate [solution E 4 (Table 1) ] reduced the outward current by 48 ± 18% (P=0.014, n=5) at +130 mV and produced a positive shift in reversal potential, from -7.0 ± 1.8 to 19 ± 1.9 mV (P<0.0001), consistent with a dominant Cl- conductance (Fig. 1c) . Analysis of permeability to other anions revealed the order nitrate > iodide > chloride (four of four cells), with the current increasing by 68.8% ± 14.6% on switching from extracellular Cl-- to I- (P=0.018) and increasing a further 38% ± 11.8% on switching from extracellular I- to NO3- (P=0.048) (Fig. 1d) . These changes were reversed on switching back to normal extracellular Cl- (data not shown). The putative Cl- channel blocker DIDS produced a partial inhibition of the outward current (39%±16% at +140 mV) (P=0.012, n=4) but only at a high concentration of 1 mM, whereas the small-conductance Cl- channel blocker chlorotoxin had no effect at concentrations up to 1 mM over a 15-min period in five cells. In contrast to the observations made with the manipulation of intracellular and extracellular Cl- concentrations, switching from 5 mM to 70 or 140 mM external K+ did not affect the outward current, suggesting that there was not a significant K+ conductance contributing to this (Fig. 1e) .



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. (a) Typical whole-cell membrane current recorded from an HMC-1 cell (left graph). The cell was clamped at a holding potential of -20 mV, and 100-ms voltage commands were applied from -140 to +140 mV in 10-mV steps (shown on the right). (b) Current-voltage relationship from the same cell. (c) Current-voltage relationship demonstrating the reduction of the outwardly rectifying current and positive shift in reversal potential after replacement of extracellular Cl- with methanesulfonate ions. Values are means of data from five experiments. (d) Current-voltage relationship showing the relative permeability of iodide and nitrate ions compared with that of chloride ions. Values are means of data from four experiments. (e) Current-voltage relationship showing that increasing the extracellular K+ concentration from 5 to 140 mM has no effect on the outwardly rectifying current. Note, however, that a small inward current is revealed by the higher concentration. Values are means of data from four experiments.

 
To investigate the voltage dependence of the whole-cell Cl- current in greater detail, tail currents were recorded, but their durations were too short for meaningful analyses. Recording cells with intracellular K+ methanesulfonate (solution I 4) and normal extracellular solution gave a Cl- reversal potential of about -70 mV. However, under these conditions the whole-cell current continued to activate positively to +30 mV (five cells), providing further evidence that channel opening is dependent on membrane voltage.

Another observation was of interest: with standard intracellular and extracellular solutions, the baseline whole-cell current generally remained stable for up to 30 min after the whole-cell configuration was achieved. However, in spite of clear evidence of a dominant Cl- conductance, the baseline current rapidly declined when the cells were dialyzed against intracellular NaCl or Na+ methanesulfonate, suggesting that disturbance of the normal cation distribution within the cell may have a critical effect on Cl- channel function.

A small inward current was also evident in ~50% of HMC-1 cells. This current was not affected by alterations in extracellular Cl- concentration, but a consistent increase in inward current was demonstrated on switching from 5 mM to either 70 or 140 mM K+ external (from -12.3±1.9 pA to -38.5±4.2 pA for 140 mM K+ at -130 mV; P=0.021, n=4), indicating that a K+ conductance was present (Fig. 1e) . This was particularly evident when cells were recorded with intracellular NaCl and rundown of the outward current (n=3). With NaCl internal and 140 mM KCl external, an inward current activated only ~0 mV rather than the predicted +70 mV for the calculated K+ reversal potential, suggestive of voltage-dependent activation. This current was inwardly rectifying but was not blocked by addition of barium to the bath in concentrations up to 300 µM (data not shown). This current was therefore not consistent with the presence of a member of the inwardly rectifying family of K+ channels (Kir), which are extremely sensitive to the presence of barium. This current requires further characterization.

In contrast to HMC-1, HSMCs (11 cells from three donors) were electrically silent at rest, with no detectable inward or outward currents, in either physiological or 140 mM extracellular K+ and thus resemble rat peritoneal mast cells [7 ]. It was not possible to characterize the response of these cells to IgE-dependent activation or A23187 because of the instability of membrane seals after addition of these reagents.

Cell-attached single-channel characteristics of the resting HMC-1 chloride conductance
To identify the characteristics of the resting Cl- conductance in more detail, currents were recorded under resting conditions in the cell-attached patch-clamp configuration, using NaCl in the patch pipette. This revealed the presence of a distinct single population of channels with an estimated single-channel slope conductance of 41.8 ± 6.1 pS (n=4) and a reversal potential of ~-15 mV (Fig. 2 ). From the Nernst equation, this suggests that the intracellular Cl- concentration is ~66 mM.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 2. (a) Single-channel activity recorded in a cell-attached patch at the three potentials shown. (b) Amplitude histogram of channels, recorded at 160 mV. In this cell, a single-channel amplitude of 6.27 pA was obtained from a Gaussian fit to the histogram. (c) Single-channel current-voltage relationship obtained from four cells. The plotted line represents a linear least-squares fit to the data. The slope gives a single-channel conductance of 41.8 ± 6.1 pS and an extrapolated zero-current intercept (reversal potential) of -15 mV.

 
Activation-dependent ion currents in HMC-1
Addition of the calcium ionophore A23187 (1 µM) to the HMC-1 bath solution increased the outward current by ~100% (112%±27%; P=0.003, n=16) within 3 min (Fig. 3a and b ). The current appeared rapidly and, in some cells, demonstrated slower time-dependent activation than the resting current, suggesting that a distinct set of channels was opened. In 12 cells, this current remained stable for up to 10 min, but in 4 cells it ran down rapidly, returning to baseline within 5 min. This effect of A23187 was seen only when the intracellular solution contained a 90 nM concentration of nominal free Ca2+ (Table 1 , solution I 2) (16 of 16 cells) and never when the intracellular solution contained 5 mM EGTA (solution I 1) (6 of 6 cells), indicative of the presence of a calcium-activated current. In addition, it was not seen when Ca2+ was omitted from the external bath solution (n=4). The resting membrane potential was -13.6 ± 2.1 mV with a nominal 90 nM free Ca2+ in the pipette (n=20), which was significantly lower than that with 5 mM internal EGTA (P<0.0001). After addition of A23187, the membrane potential fell from -9.1 ± 2.0 mV to -18.3 ± 2.2 mV (P<0.0001, n=16), suggestive of the presence of a dominant Cl- conductance as well as a contribution from a K+ conductance (Fig. 3a and 3b) . To eliminate the possibility of contributions from K+ ions, cells were recorded with NaCl internal (solution I 3) and NaCl external (solution E 1). As mentioned above, recording with intracellular NaCl led to rapid rundown of the baseline Cl- current, which permitted further examination of the ionophore-induced current. In these sodium solutions, A23187 still induced an outward current within minutes of addition to the bath solution (eight of eight cells) (Fig. 3c) , which demonstrated a decrease in outward current on reduction of the extracellular Cl- concentration by using Na+ methanesulfonate (29%±9%; P=0.017, n=4). Thus, HMC-1 opened a Ca2+-activated Cl- channel after an influx of extracellular calcium.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. (a) Current recordings obtained before (i) and after (ii) application of 1 µM A23187 to an HMC-1. The lower trace (iii) shows the subtracted current, revealing the A23187-induced component. (b) Mean current-voltage relationship of the currents recorded in 16 cells: (i) at baseline, (ii) after addition of A23187, and (iii) the difference between i and ii. For readability, error bars are omitted from the subtracted trace (open squares). (c) Effect of A23187 on HMC-1 cells, recorded using internal and external NaCl. Note the smaller currents in these solutions. Values are means of data from eight experiments.

 
At rest, with 0.5 mM EGTA in the pipette, small tail currents were present; these currents frequently increased in amplitude and duration after addition of A23187. In 10 of 12 cells recorded with standard solutions or dialyzed against internal K+ methanesulfonate (solution I 4) and external Na+ methanesulfonate (solution E 4), a significant tail current developed (in 4 of 8 for normal solutions and in 6 of 10 for methanesulfonate solutions). Analysis of the tail currents in six cells recorded in methanesulfonate solutions identified a mean baseline reversal potential of -26.1 ± 3.9 mV, which fell to-67.3 ± 3.9 mV after addition of A23187 (P=0.0002), with a shift in reversal from -68.4 ± 8.5 to -3.2 ± 2.1 mV when the extracellular solution was switched to 140 mM K+ methanesulfonate (P=0.011, n=4) (Fig. 4 ), thus indicating the presence of a Ca2+-activated K+ conductance. Similarly, analysis of tail currents after A23187-dependent activation in cells dialyzed against intracellular NaCl (solution I 3) and extracellular KCl (solution E 3) demonstrated tail currents reversing at +68.0 ± 12.0 mV (n=3), which is close to the calculated K+ reversal potential for cells in these solutions (data not shown).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. (a) Tail current in a cell, recorded with internal K+ methanesulfonate containing 90 nM nominal free Ca2+ and extracellular Na+ methanesulfonate before (i) and after (ii) addition of 1 µM A23187. Tail currents were recorded by applying voltage commands to +140 mV from a holding potential of -70 mV and then postcommand voltage potentials of -140 to +130 mV in 10-mV steps. Note the large tail current after the application of A23187. The right trace (iii) shows the subtracted current, revealing the A23187-induced component. (b) Mean current-voltage relationship of the tail currents from six cells, recorded under the same conditions as used for the traces in panel a: (i) at baseline, (ii) after addition of A23187, and (iii) the difference between i and ii. For the sake of readability, error bars are omitted from the subtracted trace (open squares). (c) Mean current-voltage relationship of the tail currents from four cells recorded in 5 mM external K+ and 145 mM external K+. The shift in reversal potential from~-75 to 0 mV indicates the presence of a dominant K+ current.

 
In contrast to the findings with A23187, we were unable to demonstrate any change in macroscopic currents with stem cell factor (100 ng/mL) or phorbol myristate acetate (50 ng/mL) for up to 15 min after addition of one of these substances to the bath (data not shown).

Response of HMC-1 to hypotonicity
On exposure to a hypotonic solution, nearly all mammalian cells activate a Cl- conductance, which is believed to regulate cell volume under such conditions. Addition of water to reduce the osmolality to 0.75 N led to variable increases in inward and outward currents. Recording immediately after switching back to a normal external solution with normal ion concentrations revealed an even larger increase in inward and, more predominantly, outward currents (from 0.61±0.11 nA to 1.23±0.17 nA at +130 mV; P=0.012, n=3), with a reversal potential of ~0 mV (Fig. 5 ). Subsequent subtraction of the baseline current revealed the presence of a whole-cell current exhibiting a weaker outward rectification than the baseline current, with a reversal potential of 0 mV, consistent with opening of the ubiquitously expressed volume-regulatory voltage-dependent Cl- channel ClC-3 (Fig. 5) .



View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. Current-voltage relationship showing the baseline current (i) and the current after reduction of the osmolarity to 0.75 N and then returning to the normal extracellular solution (ii). The subtracted current (iii) demonstrates the development of a current exhibiting weaker outward rectification, with a reversal potential of 0 mV, suggesting the existence of a dominant Cl- conductance. Values are means of data from three experiments.

 
Molecular identification of HMC-1 chloride channels
Both the electrophysiological characteristics and the whole-cell current-voltage relationship of the resting Cl- conductance suggested that the operative channel might be either ClC-4 or ClC-5, both of which are members of the voltage-dependent family of Cl- channels. Using RT-PCR, we observed a strong band of the predicted size for ClC-5 and a weak equivocal band for ClC-4 (Fig. 6 ). The ClC-4 PCR product was therefore cloned and sequenced, which confirmed that the PCR signal was not in fact from ClC-4 DNA. RT-PCR also revealed the presence of Cl- channel ClC-3 mRNA, which is expressed in many cell types [17 ] and is activated by hypotonicity. This is consistent with the current observed after exposure of HMC-1 to low osmolality. No bands for the above-described channels were observed if the RT step was omitted.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 6. RT-PCR for the voltage-dependent chloride channels ClC-3, ClC-4, and ClC-5, using HMC-1 mRNA, demonstrating bands of the predicted size for ClC-3 and ClC-5. See the text for details of the methods used.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we used the whole-cell and cell-attached variations of the patch-clamp technique to investigate ion currents in the plasma membrane of HSMCs at rest and the human leukemic mast cell line HMC-1 at rest and after cellular activation. To our knowledge, in spite of extensive literature concerning the conductive properties of rodent mast cells, this is the first study of human mast cell ionic currents.

In rodent mast cells, several ion conductances have been described at rest and after activation, including those for Cl-, K+, Na+, and Ca2+ [7 8 9 10 11 12 13 14 ]. Interestingly, rodent mast cells of different phenotypes have been reported to express different currents, which may explain, in part, mast cell functional heterogeneity. For example, the rat basophilic leukemic cell line and rodent bone marrow-derived mast cells, which are considered to represent a mucosal mast cell phenotype, express at rest a strong inwardly rectifying K+ current which sets a stable resting membrane potential close to the K+ reversal potential, at about -70 mV. In contrast, rat peritoneal mast cells, typical of connective-tissue-type mast cells, either are electrically silent at rest or express an outwardly rectifying Cl- conductance [18 ]. HMC-1 and HSMCs are therefore unlike rodent mucosal type mast cells but more closely resemble rat peritoneal mast cells in terms of ion currents expressed at rest.

The most striking observation in this study was the presence in HMC-1, at rest, of a voltage-dependent Cl- conductance exhibiting rapid activation kinetics and extreme outward rectification, with electrophysiological characteristics similar to those of the voltage-dependent Cl- channels ClC-4 and ClC-5 [19 , 20 ]. In humans, ClC-4 mRNA is expressed most abundantly in skeletal muscle, the heart, and the brain [19 , 21 ] while ClC-5 is located predominantly in the kidney [22 ]. Interestingly, both of these channels have been identified only in plasma membranes when overexpressed after transfection of Xenopus oocytes and Chinese hamster ovary cells [19 , 20 ]. This is, therefore, the first description of this type of current in a native leukocyte. In transfected cells, both channels exhibit extreme outward rectification, with currents visible at membrane potentials positive to about +20 mV. In terms of channel electrophysiology, there are conflicting data on the sensitivity of these two channels to the putative Cl- channel blocker DIDS and the relative permeability of chloride versus iodide [19 , 20 ]. Thus, the rapid current activation and inactivation kinetics (no tail currents), whole-cell current-voltage relationship (extreme outward rectification), greater iodide than chloride permeability, and relative insensitivity to DIDS are consistent with the presence of ClC-4 or -5 or a novel, closely related ClC family member in the HMC-1 plasma membrane. Using RT-PCR, we have demonstrated the presence of mRNA for ClC-5, but not ClC-4, in HMC-1, which suggests that the current observed may indeed be carried by ClC-5. Rat peritoneal and bone marrow-derived mast cells also express a strong outwardly rectifying Cl- conductance [18 ], but this is activated instantaneously, is dependent on temperature, and is exquisitely sensitive to DIDS, suggesting that the current is not being carried by ClC-4 or -5.

Using immunohistochemistry, Gunther and co-workers have demonstrated that ClC-5 is found in intracellular vesicles within the renal tubules and collecting ducts [23 ]. There it colocalizes with the H+-ATPase, and it has been hypothesized that it therefore helps provide the electrical shunt for the efficient acidification of vesicles and the reabsorption of tubular protein. The role ClC-4 or ClC-5 might play in the cell membrane is unclear because both only activate at membrane potentials positive to about +20 mV, a level that many nonexcitable cells may never reach. However, even a small inward Cl- current at negative membrane potentials will be sufficient to set the cell membrane potential to ~0 mV, which is indeed the recorded resting membrane potential in HMC-1. The presence of a ClC-4/5-like current in the plasma membrane is therefore likely to have a profound effect on HMC-1 membrane potential and, thus, cell function. Because HMC-1 was isolated from the blood of a patient with mast cell leukemia, the expression of this Cl- conductance raises the possibility that this current contributes to the malignant phenotype of the cell. In support of this hypothesis, we have also observed a similar current in the leukemic human basophil cell line KU-812 (data not shown), and mature tissue mast cells from human skin, which do not divide, did not express this current. Furthermore, Steinmeyer and co-workers observed the presence of ClC-5 mRNA in several cell lines (24) , and a current very similar to ClC-4/5 but with slower inactivation kinetics and partial dependency on extracellular Ca2+ has been observed in primary cultures of astrocytomas and astrocytoma cell lines (25) , and is cell cycle-dependent (26) . Voets and co-workers have made similar observations regarding a Cl- current in skeletal muscle [27 ] and have demonstrated that tamoxifen, an inhibitor of endothelial Cl- conductance, also inhibits endothelial-cell proliferation [28 ].

HMC-1 also expressed currents in response to addition of the calcium ionophore A23187 to the bath solution. These currents never occurred when the internal pipette solution contained 5 mM EGTA or when Ca2+ was omitted from the bath solution, indicating that they are dependent on the influx of extracellular Ca2+. Manipulation of the pipette and bath solution and analysis of ionophore-induced tail currents indicated that both K+ and Cl- currents were invoked in response to A23187, both of which demonstrated outward rectification, in keeping with the Ca2+-activated K+ (KCA) and Cl- (ClCA) currents identified in many cell types [29 30 31 ]. The involvement of these types of currents in cell activation is predicted to be through the regulation of membrane potential, and thereby influencing Ca2+ influx via store-operated Ca2+ channels, which show inward rectification at negative membrane potentials [32 ]. While several calcium-dependent K+ channels have been cloned, only two human Ca2+-activated Cl- channels fall into this category, and they are expressed exclusively by epithelia [29 , 30 ]. Thus, while it should be possible to identify the HMC-1 KCA, further cloning may be required for the molecular identification of the ClCA.

Most cells open Cl- channels, which are believed to be important for the regulation of cell volume, in response to hypotonicity of the extracellular solution. Two members of the voltage-dependent family of Cl- channels, namely the inwardly rectifying channel ClC-2 and the outwardly rectifying channel ClC-3 [17 ], have been shown to be activated in response to reduced extracellular osmolality. HMC-1 activated an outwardly rectifying Cl- current in response to hypotonicity and expressed mRNA for ClC-3, suggesting that ClC-3 carries out the volume-regulatory role in these cells.

In this study, we have used the whole-cell configuration of the patch-clamp technique to analyze HMC-1 ionic currents. Because this meant that the cell was dialyzed against the pipette solution, there was the potential for washout of important intracellular constituents such as cyclic nucleotides, which may themselves modulate ion channel function. Thus, it is possible that HMC-1 expresses other currents that have not been identified in this study. Further analysis, using the perforated-patch technique, will help address this. In addition, in the present study, recording was generally limited to a temperature of 29°C because of the instability of seals at higher temperatures. However, on the occasions that we were able to record at higher temperatures, there were no apparent differences in the whole-cell resting current.

In summary, we have described, for the first time, ionic currents in a human mast cell, albeit a malignant leukemic mast cell line. This provides insight into the potential mechanisms for the electrical regulation of leukemic mast cell function and, in many situations, the electrical regulation of the mature human mast cell, which often exhibits biological responses similar to those of HMC-1 [33 34 35 ]. Intriguingly, HMC-1 expresses a resting Cl- conductance exhibiting extreme outward rectification and other characteristics of the voltage-dependent Cl- channels ClC-4 and ClC-5. However, this is the first time that these currents have been documented to occur in the plasma membrane of a native cell, thus indicating a role for these channels in the regulation of HMC-1 membrane potential and cell function. Furthermore, HMC-1 may provide a novel tool for investigating the role of these channels in cell biology.


    ACKNOWLEDGEMENTS
 
This work was supported by the Wellcome Trust, UK.

We are very grateful to Marianne Kulka, University of Alberta, for supplying the rat ClC family RT-PCR primer sequences from which our human primers were modified. We are also very grateful to Karen Conway for technical assistance.

Received October 10, 2000; revised March 8, 2001; accepted April 9, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bradding, P., Walls, A. F., Church, M. K. (1995) Mast cells and basophils: their role in initiating and maintaining inflammatory responses Holgate, S. T. eds. Immunopharmacology of the Respiratory System ,53-84 Academic Press London.
  2. Shirihai, O., Merchav, S., Attali, B., Dagan, D. (1996) K+ channel antisense oligodeoxynucleotides inhibit cytokine-induced expansion of human hemopoietic progenitors Pflugers Arch 431,632-638[Medline]
  3. Arcangeli, A., Ricupero, L., Olivotto, M. (1987) Commitment to differentiation of murine erythroleukemia cells involves a modulated plasma membrane depolarization through Ca2+-activated K+ channels J. Cell. Physiol. 132,387-400[Medline]
  4. Oiki, S., Okada, Y. (1988) C1q induces chemotaxis and K+ conductance activation coupled to increased cytosolic Ca2+ in mouse fibroblasts J. Immunol. 141,3177-3185[Abstract]
  5. Koo, G. C., Blake, J. T., Talento, A., Nguyen, M., Lin, S., Sirotina, S., Shah, K., Mulvany, K., Hora, D. J., Cunningham, P., Wunderler, D. L., McManus, O. B., Slaughter, R., Bugianesi, R., Felix, J., Garcia, M., Williamson, J., Kaczorowski, G., Sigal, N. H., Springer, M. S., Feeney, W. (1997) Blockade of the voltage-gated potassium channel Kv1.3 inhibits immune responses in vivo J. Immunol. 158,5120-5128[Abstract]
  6. Hughes, F. M. J., Bortner, C. D., Purdy, G. D., Cidlowski, J. A. (1997) Intracellular K+ suppresses the activation of apoptosis in lymphocytes J. Biol. Chem. 272,30567-30576[Abstract/Free Full Text]
  7. Lindau, M., Fernandez, J. M. (1986) A patch-clamp study of histamine-secreting cells J. Gen. Physiol. 88,349-368[Abstract/Free Full Text]
  8. McCloskey, M. A., Qian, Y. X. (1994) Selective expression of potassium channels during mast cell differentiation J. Biol. Chem. 269,14813-14819[Abstract/Free Full Text]
  9. Wischmeyer, E., Lentes, K. U., Karschin, A. (1995) Physiological and molecular characterization of an IRK-type inward rectifier K+ channel in a tumour mast cell line Pflugers Arch 429,809-819[Medline]
  10. Fasolato, C., Hoth, M., Matthews, G., Penner, R. (1993) Ca2+ and Mn2+ influx through receptor-mediated activation of nonspecific cation channels in mast cells Proc. Natl. Acad. Sci. USA 90,3068-3072[Abstract/Free Full Text]
  11. Hoth, M., Penner, R. (1993) Calcium release-activated calcium current in rat mast cells J. Physiol. 465,359-386[Abstract/Free Full Text]
  12. Matthews, G., Neher, E., Penner, R. (1989) Chloride conductance activated by external agonists and internal messengers in rat peritoneal mast cells J. Physiol. 418,131-144[Abstract/Free Full Text]
  13. Qian, Y. X., McCloskey, M. A. (1993) Activation of mast cell K+ channels through multiple G protein-linked receptors Proc. Natl. Acad. Sci. USA 90,7844-7848[Abstract/Free Full Text]
  14. Parekh, A. B. (1996) Nonhydrolyzable analogues of GTP activate a new Na+ current in a rat mast cell line J. Biol. Chem. 271,23161-23168[Abstract/Free Full Text]
  15. Butterfield, J. H., Weiler, D., Dewald, G., Gleich, G. J. (1988) Establishment of an immature mast cell line from a patient with mast cell leukemia Leuk. Res. 12,345-355[Medline]
  16. Hamill, O. P., Marty, A., Neher, E., Sakmann, B., Sigworth, F. J. (1981) Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches Pflugers Arch 391,85-100[Medline]
  17. Duan, D., Winter, C., Cowley, S., Hume, J. R., Horowitz, B. (1997) Molecular identification of a volume-regulated chloride channel Nature (London) 390,417-421[Medline]
  18. Hill, P. B., Martin, R. J., Miller, H. R. (1996) Characterization of whole-cell currents in mucosal and connective tissue rat mast cells using amphotericin-B-perforated patches and temperature control Pflugers Arch 432,986-994[Medline]
  19. Kawasaki, M., Fukuma, T., Yamauchi, K., Sakamoto, H., Marumo, F., Sasaki, S. (1999) Identification of an acid-activated Cl- channel from human skeletal muscles Am. J. Physiol. 277,C948-C954[Abstract/Free Full Text]
  20. Friedrich, T., Breiderhoff, T., Jentsch, T. J. (1999) Mutational analysis demonstrates that ClC-4 and ClC-5 directly mediate plasma membrane currents J. Biol. Chem. 274,896-902[Abstract/Free Full Text]
  21. van Slegtenhorst, M. A., Bassi, M. T., Borsani, G., Wapenaar, M. C., Ferrero, G. B., de Conciliis, L., Rugarli, E. I., Grillo, A., Franco, B., Zoghbi, H. Y. (1994) A gene from the Xp22.3 region shares homology with voltage-gated chloride channels Hum. Mol. Genet. 3,547-552[Abstract/Free Full Text]
  22. Fisher, S. E., Black, G. C., Lloyd, S. E., Hatchway, E., Wrong, O., Thicker, R. V., Craig, I. W. (1994) Isolation and partial characterization of a chloride channel gene which is expressed in kidney and is a candidate for Dent’s disease (an X-linked hereditary nephrolithiasis) Hum. Mol. Genet. 3,2053-2059
  23. Gunther, W., Luchow, A., Cluzeaud, F., Vandewalle, A., Jentsch, T. J. (1998) ClC-5, the chloride channel mutated in Dent’s disease, colocalizes with the proton pump in endocytotically active kidney cells Proc. Natl. Acad. Sci. USA 95,8075-8080[Abstract/Free Full Text]
  24. Steinmeyer, K., Schwappach, B., Bens, M., Vandewalle, A., Jentsch, T. J. (1995) Cloning and functional expression of rat CLC-5, a chloride channel related to kidney disease J. Biol. Chem. 270,31172-31177[Abstract/Free Full Text]
  25. Ullrich, N., Sontheimer, H. (1996) Biophysical and pharmacological characterization of chloride currents in human astrocytoma cells Am. J. Physiol. 270,C1511-C1521[Abstract/Free Full Text]
  26. Ullrich, N., Sontheimer, H. (1997) Cell cycle-dependent expression of a glioma-specific chloride current: proposed link to cytoskeletal changes Am. J. Physiol. 273,C1290-C1297[Abstract/Free Full Text]
  27. Voets, T., Wei, L., De Smet, P., Van Driessche, W., Eggermont, J., Droogmans, G., Nilius, B. (1997) Downregulation of volume-activated Cl- currents during muscle differentiation Am. J. Physiol. 272,C667-C674[Abstract/Free Full Text]
  28. Voets, T., Szucs, G., Droogmans, G., Nilius, B. (1995) Blockers of volume-activated Cl- currents inhibit endothelial cell proliferation Pflugers Arch 431,132-134[Medline]
  29. Gruber, A. D., Elble, R. C., Ji, H. L., Schreur, K. D., Fuller, C. M., Pauli, B. U. (1998) Genomic cloning, molecular characterization, and functional analysis of human CLCA1, the first human member of the family of Ca2+-activated Cl- channel proteins Genomics 54,200-214[Medline]
  30. Gruber, A. D., Schreur, K. D., Ji, H. L., Fuller, C. M., Pauli, B. U. (1999) Molecular cloning and transmembrane structure of hCLCA2 from human lung, trachea, and mammary gland Am. J. Physiol. 276,C1261-C1270[Abstract/Free Full Text]
  31. Krause, K. H., Welsh, M. J. (1990) Voltage-dependent and Ca2+-activated ion channels in human neutrophils J. Clin. Invest. 85,491-498
  32. Hoth, M., Penner, R. (1992) Depletion of intracellular calcium stores activates a calcium current in mast cells Nature (London) 355,353-356[Medline]
  33. Baghestanian, M., Hofbauer, R., Kress, H. G., Wojta, J., Fabry, A., Binder, B. R., Kaun, C., Muller, M. R., Mehrabi, M. R., Kapiotis, S., Sengoelge, G., Ghannadan, M., Lechner, K., Valent, P. (1997) Thrombin augments vascular cell-dependent migration of human mast cells: role of MGF Thromb. Haemost. 77,577-584[Medline]
  34. Jaffe, J. S., Raible, D. G., Post, T. J., Wang, Y., Glaum, M. C., Butterfield, J. H., Schulman, E. S. (1996) Human lung mast cell activation leads to IL-13 mRNA expression and protein release Am. J. Respir. Cell Mol. Biol. 15,473-481[Abstract]
  35. Sanmugalingam, D., Wardlaw, A. J., Bradding, P. (2000) Adhesion of human lung mast cells to bronchial epithelium: evidence for a novel carbohydrate-mediated mechanism J. Leukoc. Biol. 68,38-46[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
L. Woodman, S. Siddiqui, G. Cruse, A. Sutcliffe, R. Saunders, D. Kaur, P. Bradding, and C. Brightling
Mast Cells Promote Airway Smooth Muscle Cell Differentiation via Autocrine Up-Regulation of TGF-{beta}1
J. Immunol., October 1, 2008; 181(7): 5001 - 5007.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Shumilina, R. S. Lam, F. Wolbing, N. Matzner, I. M. Zemtsova, M. Sobiesiak, H. Mahmud, U. Sausbier, T. Biedermann, P. Ruth, et al.
Blunted IgE-Mediated Activation of Mast Cells in Mice Lacking the Ca2+-Activated K+ Channel KCa3.1
J. Immunol., June 15, 2008; 180(12): 8040 - 8047.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. C. E. Wykes, M. Lee, S. M. Duffy, W. Yang, E. P. Seward, and P. Bradding
Functional Transient Receptor Potential Melastatin 7 Channels Are Critical for Human Mast Cell Survival
J. Immunol., September 15, 2007; 179(6): 4045 - 4052.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
D. Kaur, R. Saunders, P. Berger, S. Siddiqui, L. Woodman, A. Wardlaw, P. Bradding, and C. E. Brightling
Airway Smooth Muscle and Mast Cell-derived CC Chemokine Ligand 19 Mediate Airway Smooth Muscle Migration in Asthma
Am. J. Respir. Crit. Care Med., December 1, 2006; 174(11): 1179 - 1188.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
L. Woodman, A. Sutcliffe, D. Kaur, M. Berry, P. Bradding, I. D. Pavord, and C. E. Brightling
Chemokine Concentrations and Mast Cell Chemotactic Activity in BAL Fluid in Patients With Eosinophilic Bronchitis and Asthma, and in Normal Control Subjects.
Chest, August 1, 2006; 130(2): 371 - 378.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
A Sutcliffe, D Kaur, S Page, L Woodman, C L Armour, M Baraket, P Bradding, J M Hughes, and C E Brightling
Mast cell migration to Th2 stimulated airway smooth muscle from asthmatics
Thorax, August 1, 2006; 61(8): 657 - 662.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M. Kulka, R. Dery, D. Nahirney, M. Duszyk, and A. D. Befus
Differential Regulation of Cystic Fibrosis Transmembrane Conductance Regulator by Interferon {gamma} in Mast Cells and Epithelial Cells
J. Pharmacol. Exp. Ther., November 1, 2005; 315(2): 563 - 570.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. E. Brightling, D. Kaur, P. Berger, A. J. Morgan, A. J. Wardlaw, and P. Bradding
Differential expression of CCR3 and CXCR3 by human lung and bone marrow-derived mast cells: implications for tissue mast cell migration
J. Leukoc. Biol., May 1, 2005; 77(5): 759 - 766.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
P. Bradding, Y. Okayama, N. Kambe, and H. Saito
Ion channel gene expression in human lung, skin, and cord blood-derived mast cells
J. Leukoc. Biol., May 1, 2003; 73(5): 614 - 620.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. M. Duffy, W. J. Lawley, E. C. Conley, and P. Bradding
Resting and Activation-Dependent Ion Channels in Human Mast Cells
J. Immunol., October 15, 2001; 167(8): 4261 - 4270.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
G. Yue, D. Merlin, M. E. Selsted, W. I. Lencer, J. L. Madara, and D. C. Eaton
Cryptdin 3 forms anion selective channels in cytoplasmic membranes of human embryonic kidney cells
Am J Physiol Gastrointest Liver Physiol, May 1, 2002; 282(5): G757 - G765.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duffy, S. M.
Right arrow Articles by Bradding, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duffy, S. M.
Right arrow Articles by Bradding, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS