RI in human basophils


* Johns Hopkins Asthma and Allergy Center, Baltimore, Maryland, and
Virginia Commonwealth University, Richmond, Virginia
Correspondence: Dr. Donald MacGlashan, Jr., Johns Hopkins Asthma and Allergy Center, 5501 Hopkins Bayview Circle, Baltimore, MD 21224. E-mail: dmacglas{at}jhmi.edu
|
|
|---|
RI). We report that removing IgE from
occupied Fc
RI resulted in an accelerated loss only in the unoccupied
receptor, with no loss of occupied receptors and no loss of total
receptors when all receptors were occupied. Together with previous
studies, these results establish that there was IgE-regulated loss of
receptors. An examination of synthetic rates of Fc
RI
using
pulse-labeling with 35S-methionine indicated no difference
in synthetic rates in the presence or absence of IgE. Similarly, the
presence or absence of IgE had no influence on the levels of mRNA for
either
, ß, or
subunits of Fc
RI. Using model simulations,
we found that regulated-synthesis models could be distinguished from
regulated-loss/constant-synthesis models on the basis of the
relationship between starting Fc
RI densities and changes in density
after culture for 1 week in the absence of IgE. Experimental data from
this type of study fit a regulated-loss model that did not include
regulation of synthesis. Taken together, these results suggest that IgE
regulates cell surface expression of Fc
RI only by regulating the
rate that receptor is lost from the cell surface.
Key Words: regulated loss regulated synthesis receptor
|
|
|---|
RI) on basophils and mast
cells [1
2
3
4
5
6
7
], and this process is manifested in a
relationship between total serum IgE titers and expression of Fc
RI
on peripheral blood basophils [8
9
10
]. The induction of
increased expression on human basophils appears to result from binding
of IgE to Fc
RI itself [11
]. The up-regulation
requires only monomeric IgE because dimeric or higher oligomeric IgE
actually inhibits up-regulation [3
]. Conversely,
elimination of IgE during culture of these cells results in
down-regulation of cell surface expression. The mechanisms underlying
the induction of increased expression or the down-regulation of
expression in the absence of IgE are not known. The simplest model for
this system that includes sensitivity to IgE concentrations is one in
which either synthesis is inducible by the presence of IgE or removal
is inhibitable by IgE. Precedence for the latter model can be found
with Fc
RI on rat basophilic leukemia (RBL) cells [12
]
or Fc
RII on lymphocytes [13
]. Cell surface expression
of Fc
RII is regulated by a metalloprotease whose enzymatic activity
for proteolytic cleavage of the extracellular portion of Fc
RII is
blocked by bound IgE [14
]. The mechanism of loss on RBL
cells is unknown. Therefore, one working hypothesis for regulation of
Fc
RI has been that synthesis of Fc
RI
is constitutive and that
removal of cell surface Fc
RI
(and presumably Fc
RIß
2)
depends on whether IgE is bound. Without bound IgE, Fc
RI
is
susceptible to removal by means unknown.
Further reflection about a model in which IgE blocks the removal of
Fc
RI
from the cell surface led to some of the experiments carried
out in this study. Previous in vitro studies indirectly suggested that
removal was dependent on the presence of unoccupied receptors. The rate
of Fc
RI
down-regulation is slow; receptor expression in the
absence of extracellular IgE is decreased by 50% in 13 days. But this
appears to result from the slower than expected dissociation of IgE
from Fc
RI. Based on published dissociation rates, dissociation in
our studies was slower by about 10-fold; published measurements yield a
half-life for IgE bound to Fc
RI
of 1824 h
[15
16
17
18
] whereas in vitro culture data indicated that
the half-life is closer to 710 days [3
]. This
dissociation rate is not altered by inclusion of an IgE trap to prevent
its rebinding. These results imply that receptor is not lost until it
becomes unoccupied. A second, subtler indication from the in vitro
studies is that receptor loss is not strictly proportional to the
number of unoccupied receptors. During the first 5 days of culture
without IgE, Fc
RI expression stays relatively constant, but bound
IgE levels begin to fall. It is not until there is a substantial
increase in the number of unoccupied receptors that Fc
RI expression
begins to fall. Together these data suggest that receptor loss happens
only to unoccupied receptors and the rate of loss is not a constant but
in some manner is dependent on the density of unoccupied receptors. The
study we report here was designed to test this hypothesis.
The other half of this process involves Fc
RI
synthetic rates.
Loading of Fc
RI on the cell surface could be either constant or
regulated/modulated by IgE. The in vitro studies suggest that synthetic
rates are quite low, 300500 molecules of Fc
RI per h. This
apparently low synthetic rate limits the kinds of studies that can be
done with human basophils, but basic pulse-labeling experiments of
Fc
RI
protein are possible. As a first test of whether IgE induces
Fc
RI
synthesis, we examined basophils for changes in Fc
RI
mRNA expression during culture with IgE antibody and performed some
simple pulse-labeling experiments.
One additional aspect of the experimental data has not been readily
explained by available information. The 50% effective concentration
(EC50) for up-regulation by IgE is 12 nM, 10- to 100-fold higher than
would be expected based on the affinity of the IgE-Fc
RI
interaction as either published [16
17
18
] or recently
estimated [3
]. Using the experimental observations
obtained from the experiments reported here, we present a mathematical
model of receptor expression regulation with two purposes: (1) to
develop some understanding of how the EC50 for up-regulation is
compatible with the known properties of the system and (2) to
distinguish between IgE-regulated synthesis or constant-synthesis
models.
|
|
|---|
Buffers
The buffers used in these experiments included PIPES (Sigma
Chemical Co.) stock buffer25 mM PIPES containing 110 mM NaCl, 5 mM
KCl, and 40 mM NaOH adjusted to pH 7.3 and stored at 10-fold the above
concentration; PIPES-albumin-glucose (PAG)PIPES (1x) containing
0.003% HSA (Miles Laboratories, Inc., Elkhart, IN) and 0.1% glucose;
PAG with 1.0 mM CaCl2 and 1.0 mM MgCl2;
PAG-EDTAPAG with 1.0 mM EDTA, lactic elution buffer containing 0.01 M
sodium acetate, 0.14 M NaCl, 5 mM KCl, and 0.03% HSA at pH 3.9
[20
]; lysis buffer containing 20 mM Tris (pH 7.8), 150
mM sodium chloride, 1% Nonidet P-40, 5% glycerol, 1 mM PMSF, 1 mM
sodium orthovanadate, 1 mM sodium fluoride, 1 mM benzamidine, and 1
µg/mL of aprotinin. In the electrophoresis studies, 2x sample buffer
contained 0.5 M Tris-HCl (pH 6.8), 10% (w/v) SDS, 0.1% bromophenol
blue, 20% glycerol, and 5% mercaptoethanol; TBST buffer contained 12
mM Tris base (pH7.5), 150 mM NaCl, and 0.05% Tween-20; running buffer
contained 25 mM Tris base, 192 mM glycine, and 0.1% SDS; transfer
buffer contained 12 mM Tris base, 96 mM glycine, and 20% methanol;
stripping buffer contained 7 M guanidine hydrochloride.
Cell preparation
Two types of basophil preparations were employed. Most of the
studies used cells obtained from leukapheresis and were prepared as
previously described [21
]. Basophil purities in these
preparations ranged from 1595% with a median of 33%. In some
experiments, cells were isolated by the double Percoll method used for
fresh blood [22
]. The blood was diluted with
EDTA-saline, centrifuged at 500 g for 15 min to obtain a
buffy coat. The buffy coat cells were diluted in saline and layered
onto a two-step Percoll gradient, 1.065 g/mL-1.079 g/mL, as described
previously [23
]. After centrifugation at 450
g for 15 min, the interface between the 1.065 Percoll/plasma
upper layer and the 1.079 lower Percoll layer was harvested and washed
as above (basophil purities of 845%). Which cell preparations were
used are noted below.
Cell counting
Basophils were stained with Alcian blue and counted in a Spiers
Levy hemocytometer [24
]. Viability was also assessed by
trypan blue exclusion, and, for these studies, basophil viability
was >95%.
Cell culture
Enriched basophil preparations were cultured in Iscoves
modified Dulbeccos medium (Life Technologies, Rockville, MD)
containing 2% fetal calf serum, 40 µg/mL of gentamycin, and 10 ng/mL
of interleukin (IL)-3. The total cell density was 2 x
106/mL, and culturing was done in 96-, 24-, or 6-well
tissue culture-treated plates (Costar, Cornell, NY). Cell viability in
short cultures, <2 days, averages 95% whereas for longer cultures
(>2 days), it averages 89%.
Flow cytometry
A flow-cytometric technique incorporating light scatter
characteristics was used to quantify cell surface IgE and Fc
RI
chain expression on basophils as described [25
]. Cell
surface IgE was detected using a monoclonal anti-human IgE (TES-19 or
E10-95-3; Tanox Biosystems, Houston, TX). Cell surface expression of
Fc
RI
chain was detected using a mouse IgG1 anti-human Fc
RI
chain mAb 22E7; generously provided by J. Kochan, Roche Biochemicals,
Indianapolis, IN [26
]) and was compared with labeling
with the same concentration of irrelevant mouse IgG1 (Coulter, Hialeah,
FL). The 22E7 antibody has been shown to recognize an epitope that is
unaffected by Fc
RI
occupancy [26
]. The mAb 15A5
(also a gift from J. Kochan) was used to detect unoccupied Fc
RI
[26
]. Aliquots of cells were labeled in
phosphate-buffered saline containing 0.2% HSA with 1 mg/mL of human
IgG to minimize nonspecific binding to FcgR [25
]. Each
of the monoclonal antibodies was used at concentrations predetermined
to be optimal for labeling. Binding of monoclonal antibodies was
detected using saturating concentrations of R-phycoerythrin-conjugated
polyclonal goat anti-mouse IgG (Tago, Burlingame, CA). An EPICS Profile
flow cytometer (Coulter, Inc., Hialeah, FL) was used to analyze
fluorescent signals after excitation at 488 nm. "Bitmap" gates,
intermediate between the forward and side scatter characteristics of
lymphocytes and monocytes, were used to select for a population of
cells which were predominantly basophils. Since the cells were already
enriched in basophils, these bitmaps could select a population of cells
that is generally greater than 80% basophils, with the primary
contaminants being lymphocytes. Data were expressed as the mean
fluorescence in labeled cells minus the mean fluorescence of IgG1
controls. Day-to-day variability in the sensitivity of the flow
cytometer was corrected by noting or adjusting the photomultiplier tube
voltage to generate the same signal for a set of standard calibration
beads (Immunochek; Coulter).
In previous studies, the flow-cytometric measurements were calibrated
by examining the fluorescence staining of six donors basophils, which
spanned a moderate range of staining intensities (7120 fluorescence
units or 8,000140,000 Fc
RI per basophil) and simultaneously
assessing receptor or IgE density by the acetate elution method
[3
]. A linear plot (R=0.963) of 22E7 staining
(ordinate) compared with total Fc
RI density by acetate elution
yielded a conversion factor in which a fluorescence measurement of 100
represented approximately 120,000 receptors.
Statistics
Some statistical comparisons were made with a Students
t-test, and others where made with a nonparametric Wilcoxon
signed-rank statistic. Results were expressed as means plus or minus
standard errors of the means unless otherwise indicated.
Metabolic labeling
Cells were preincubated for 30 min at 37°C in methionine-free
RPMI-1640 medium (Gibco-BRL Life Technologies), and then labeled with
0.1 mCi/mL of 35S-methionine (NEN Life Science, Boston, MA)
in methionine-free RPMI-1640 containing 40 µg/mL of gentamycin and 10
ng/mL of IL-3 for 6 h at 37°C in the presence or absence of IgE
(5 µg/mL). Cells were collected and lysed in ice-cold lysis buffer
containing 1% Triton X-100, phosphate-buffered saline (pH7.4), 5 mM
EDTA, 5 mM dithiothreitol, 1 mM PMSF, 20 µg/mL of leupeptin, and 100
µg/mL of aprotinin. For autoradiography of beta particles, the
membranes were exposed to high-performance autoradiography film
(Amersham) with intensifying screens (Kodak) at -80°C for 24100 h.
Lysate preparation
Purified human basophils (>97%) were counted (see above) and
then directly spun down (14,000 g for 10 s) and lysed
in 1x sample buffer at a final concentration of 25 x
106 per mL, then boiled at 100°C for 5 min. Samples were
then stored at -130°C until analyzed by SDS-polyacrylamide gel
electrophoresis and Western blotting.
Immunoprecipitation
For some preparations, immunoprecipitation was also performed.
Briefly, centrifuged lysates, as obtained above, were precleared with
protein G-Sepharose beads for 30 min at 4°C. The precleared lysates
were then washed and incubated with 5 µg/mL of 22E7 prebound to
protein G-Sepharose beads. After gentle rotation for 1 h at 4°C,
the beads were washed and the immunoadsorbed proteins were eluted from
the beads by boiling in 2x SDS sample buffer. Control experiments
revealed that an irrelevant IgG antibody or 22E7 in the absence of
lysate did not pull down Fc
RI
in the immunoprecipitates.
SDS-polyacrylamide gel electrophoresis and Western blotting
Proteins were separated in a 420% Tris-glycine gel under
reducing conditions and electrotransferred on to a nitrocellulose
membrane. The free binding sites were blocked by incubating the
membrane overnight at 4°C with 4% bovine serum albumin in TBST.
After exposure of hyperfilm to the nitrocellulose membranes, they were
then Western blotted with 22E7 or UBI anti-Fc
RI
(Upstate
Biotechnology, Inc., Lake Placid, NY). The membrane was then washed
with TBST prior to the addition of an anti-mouse or anti-rabbit
horseradish peroxidase conjugate (1:3,000 dilution) for 1 h at
room temperature. After further washing of the membranes with TBST, the
proteins were visualized using ECL. The nitrocellulose membrane was
exposed to ECL hyperfilm for various times ranging from 15 s to 5
min, a time course previously determined to provide exposures that
yielded reasonably linear quantification of Fc
RI
protein. After
exposure to chemiluminescence detection agents, the intensity of each
band was determined using densitometric analysis with a Kodak DC120
digital camera and acquisition software.
mRNA expression
Total RNA was isolated from enriched human basophils by RNAzol
according to the manufacturers instructions. Briefly, 0.5 x
106 basophils were resuspended in 0.6 mL of RNAzol. The
total mRNA was then extracted by a chloroform/isopropanol technique.
Any contamination was then removed by an ethanol wash. Dried ethanol
precipitates were resuspended in diethyl pyrocarbonate-treated
water. All samples were stored at -70°C until mRNA was quantified
using dilutional PCR, competitive reverse-transcriptase (RT)-PCR, or
real-time PCR.
Competitive RT-PCR
Cells lysates processed by RNAzol B were analyzed by competitive
RT-PCR using primers, competitor cRNA molecules, and procedures as
previously described [27
]. For competitive RT-PCR, the
amounts of competitor cRNAs included in the reverse-transcriptase
mixture were determined empirically. For PCR, 5 µL of the cDNA
products were mixed with 1x reaction buffer [10 mM Tris-CL (pH 8.3),
50 mM KCl, 1.5 mM MgCl2, and 0.02% gelatin), 200 µM
deoxynucleotide triphospatase mix (Boehringer Mannheim, Indianapolis,
IN), 400 nM primers, and 0.625 U of AmpliTaq (Perkin-Elmer Corp.,
Foster City, CA) in a total volume of 25 µL. The hot start technique
was used to reduce nonspecific priming, and reactions were run for 35
cycles, each consisting of denaturation at 94°C for 1 min., annealing
at 55°C for 1 min and extension at 72°C for 1 min. After each PCR,
10 µL of the products were analyzed by electrophoresis in a 10%
polyacrylamide gel containing 89 mM Tris, 89 mM boric acid, and 2 mM
EDTA at pH 8.3 (Novex) and photographed. Films were scanned and band
intensities were measured by densitometry. Data were analyzed as
described previously [27
]. Briefly, the ratio of target
to competitor was determined, and concentrations of the target
calculated from this ratio and the known concentration of competitor.
Real-time PCR
Forward and reverse oligo primers for Fc
RI
and ß were
constructed using Primer Express software and previously published cDNA
sequences. For Fc
RI
, the forward primer was
5'-GTGAACCTGTGTACCTGGAAGTCTT-3' (nucleotide position 408; Genbank
accession number X06948), and the reverse primer was
CATCCCAGTTCCTCCAACCA (position 524). For Fc
RIß the forward primer
and reverse primer were 5'-CCAGGAAGTATCTTCAGGCAGACT-3' (nucleotide
position 140; Genbank accession number M89796) and
5'-TCAAAACTGTCAGCCATGTATGC-3' respectively. The probe sequences were
5'-TGACTGGCTGCTCCTTCAGGCCTC-3' and 5'-TTGAAGTCGGCCTCATCCCCACC-3' for
Fc
RI
and ß respectively. The primers for IL-4 were
5'-CGACTGCACAGCAGTTCCA-3' and 5'-CAGGCCCCAGAGGTTCC-3', and the probe
was 5'-TCCGATTCCTGAAACGGCTCGACA-3'. For all probes the 5'-reporter dye
was 6-carboxyfluorescein and the 3'-quencher dye was
6-carboxytetramethylrhodamine. The real-time PCR method is based on the
cleavage of fluorescent-dye-labeled probes by the 5'-3' exonuclease
activity of the Taq DNA polymerase during PCR and
measurement of fluorescence intensity by a Sequence Detection System
(Perkin-Elmer,7700) [28
]. With this instrumentation,
seven measurements of fluorescence per well per PCR cycle are made
during a 40-cycle amplification, and the point at which fluorescence
exceeds a predetermined threshold (occurring within the linear region
of the amplification curve) determines a cycle number (the so-called
"CT") for the sample. Because multiple measurements are
made during each cycle, the analytical software produces fractional
cycle numbers for each sample. This system provided small coefficients
of variation for mRNA levels for Fc
RI
and ß. In pilot
experiments, serial dilutions of our Fc
RI
mRNA standard were
evaluated, and it was determined that each unit increase in cycle
number (average
CT =1.02 ±0.03 for multiple
twofold dilutions) was equivalent to a twofold decrease in mRNA for
both Fc
RI
and ß. The final PCR product was run on a 2.5%
agarose gel to confirm that a single product at the correct base pair
length was produced.
Model simulations
Mathematical modeling of this system was simplified to address
broader questions about the need for IgE-regulated loss or synthesis.
We focused on models with some heuristic properties (i.e., general
properties rather than explicit representations of what is actually
occurring in the cell) that required as few parameters as possible.
There were two basic goals. The first goal was to determine what
conditions led to the higher than expected EC50 for receptor
up-regulation. Our second interest was to determine whether there were
parameters or conditions that would easily discriminate between a model
in which synthesis of the receptor was constitutive versus one in which
occupied receptor signaled the cell to make more receptor. One
additional variation was considered; two compartments for the receptor
with or without bound IgE were postulated, one being the plasma
membrane surface where there is free exchange of IgE with the receptor
and one internal compartment from which receptors are removed if they
are unoccupied. The primary motivation for exploring this later model
is derived from the assumption that our experimental measurements of
IgE dissociation from the receptor reflect its actual dissociation
rate. A two-compartment model allows for faster intrinsic dissociation
rates to be masked by a pool of IgE and receptor that is cycling to
(and from) the cell membrane. Figure 1
summarizes the general schemes examined by simulation. It should
be stressed that this modeling effort was intentionally kept very
simple because the wealth of possible reactions can not be known. In
essence, our model was akin to a simple steady-state problem, e.g., the
filling of a basin with water flowing in and out. The difference that
makes this model more useful is that the interaction between IgE and
Fc
RI
is well known and also a potential regulator of the process.
In other words, the flow in (loading of the plasma membrane with
Fc
RI) and the flow out (loss of receptor from the plasma membrane)
might be controlled by the presence of IgE in the receptor.
![]() View larger version (23K): [in a new window] |
Figure 1. Schematic representation of the four models of receptor expression
examined.
|
RI
down-regulation indicate that the rate of
loss is markedly faster when a 5- to 10-fold-greater number of
unoccupied receptors is present, the parameters for this heuristic
expression can be chosen also to fit this constraining information. The
model sets the down-regulation of receptor to match a process in which
the Km for the reaction is high enough that the rate of down-regulation
increases when the number of unoccupied receptors increases from a few
thousand to tens of thousands. As noted, synthesis is set to be
constitutive, and this rate is readily determined from the rate the
receptors are acquired by basophils incubated with high IgE
concentrationsconditions which should stop all loss.
Models in which synthesis is induced are more involved because of the
wide variety of ways one can view induction. There are several aspects
to consider. First, we briefly examined models in which loss was
effectively constant. These failed to replicate the characteristics of
down-regulation across a large range of starting receptor densities and
were rejected (more on this below). Second, if induction of synthesis
is strictly a function of the number of occupied receptors, the
up-regulation curves "accelerate" as receptor expression increases.
This occurs because accumulating receptor densities generate a greater
signal, which increases the signal for synthesis (in a
positive-feedback loop). Therefore, we dictated that synthetic
rates saturated at some value that could be estimated from the rate of
up-regulation in the presence of high concentrations of IgE. At high
levels of "stimulation," this model is similar to that of
constitutive synthesis; i.e., at high densities of occupied receptors,
the rate of up-regulation reaches its saturation point and appears
constant as in the constitutive model. However, at the low end of the
curve, the rate of synthesis is variable, and it should be possible to
detect changes in synthetic rate experimentally under the correct
conditions. These models of IgE-regulated synthesis of Fc
RI
can
be viewed two ways, one in which a signal for increased receptor
synthesis is always generated by an occupied receptor and one in which
the signal from an occupied receptor exists for only a short time after
the initial binding of IgE to an unoccupied receptor. As it turns out,
these two approaches result in qualitatively and quantitatively similar
simulations with only modest differences in some of the parameters.
Figure 1C shows that we considered regulated loss and constant synthesis, regulated synthesis and constant loss (with two variations in regulated synthesis), regulated loss and regulated synthesis, and finally a two-compartment model with regulated loss and constant synthesis. The rate relationships for the regulated loss/constant synthesis model are as follows:
![]() | (1) |
![]() | (2) |
![]() | (3) |
RI; and
kr is the reverse rate-binding constant for IgE
dissociation from Fc
RI;
is the adjustable parameter controlling
the steepness of the rate expression for loss, and
is cell density
in culture (cells per mL).
Equation 1
shows the simplicity of the model; receptor is lost from the
plasma membrane or loaded into the plasma membrane, and once in the
membrane, the amount of unoccupied versus occupied receptor is a result
of interaction with solution phase IgE (the expressions of which are
simple reaction kinetics from two-component binding). The middle term
in Equation 1, L, is used to represent the loading rate, a
term which is chosen to encompass all the factors that contribute to
expressing new receptor on the cell surface. This would include both
synthesis and transport from the endoplasmic reticulum (ER) to the
Golgi and to the plasma membrane, processes that might be independently
regulated. As discussed above, the loss is a standard expression for
enzyme kinetics. The initial conditions specify values for
RF, RO, and
IgET, i.e., the initial density of occupied and unoccupied
receptors (known from many previous studies) and the solution phase IgE
(a variable parameter both experimentally and in this model). The model
includes some fixed conditions, volume of the reaction and cell
densities (
), that are consistent with the conditions used
experimentally. Equation 2
is the reaction rate expressions for
association of IgE and Fc
RI
, keeping in mind that in this model,
only unoccupied receptor is loaded into the membrane or lost from the
membrane(as experiments in this study indicate). Equation 3
is
just the mass balance for IgE in solution.
If synthesis (included under the generic term of loading) is regulated
by IgE, a simple heuristic expression using an inverse exponential is
used to provide a maximal rate of synthesis and a midpoint
(1/e) for reaching this maximal rate:
![]() | (4) |
|
|
|---|
RI
(22E7 mAb), total IgE (mAb TES-19
or 10-95-3), or unoccupied Fc
RI
(mAb 15A5) by flow cytometry at
the start of culture or after culture for 24 h. Figure 2
summarizes the results of three experiments. In an important
control for the effects of lactic acid treatment as well as to
determine whether occupied receptors are lost, cells that had been
resensitized with IgE showed no loss of Fc
RI
(with 22E7 mAb as
the detection reagent), indicating both that occupied receptors are not
lost and that lactic acid treatment was not deleterious to cell
survival and function. Stripped cells lost 50% of their 15A5 binding
in 24 h and 25% of total receptors (22E7), but there was no loss
of bound IgE (mAbs TES-19 or 10-95-3).
![]() View larger version (58K): [in a new window] |
Figure 2. Changes in receptor densities after lactic acid elution of IgE.
Enriched basophils were first treated with lactic acid to remove some
cell-bound IgE. After this dissociation, a portion of the cells was
rapidly resensitized to saturate unoccupied receptors and then placed
into culture with the remaining cells. Flow-cytometric measurements
using 22E7, 15A5, and TES-19 were made on cells before and after a 24-h
culture. The ordinate plots the ratios of these measurements for each
antibody probe. The data shown represent the means of three experiments
(±SE), and the mean starting intensity of 22E7 staining
was 88 ± 11 ( 104,000 receptors).
|
5% loss of receptors in
1 day, the studies reported here showed a 25% loss of total receptors
and a 50% loss of unoccupied receptors in 1 day. This magnitude of
change provided a means to test for the effects of metalloprotease
inhibitors on loss of Fc
RI
expression. We examined compounds
under development at SmithKline Beecham; all except one of these
compounds were known to be active in the 0.11.0 µM range as
inhibitors of the metalloprotease that removes CD23
[14
]. These compounds included SKB202968 (batimastat),
SKB235854 (marimastat), and SKB257702, 245210, 249737, 242113, 238746,
236502, and 224002, the last of which is inactive. We were unable to
alter the loss of receptors in a 24-h culture of lactic-acid-treated
basophils with any of the inhibitors at concentrations up to 2 µM
[three- to sixfold their reported 50% inhibitory concentration for
CD23 loss (data not shown)].
Synthesis regulated by IgE
A more difficult question was whether IgE changed the rate of
Fc
RI
synthesis. We initially approached this problem by examining
the cells for changes in expression of Fc
RI
mRNA, using
dilutional RT-PCR (data not shown), real-time RT-PCR and competitive
RT-PCR. The more extensive data set involves real-time PCR for
Fc
RI
, and data for these experiments are shown in Figure 3
. Basophils were cultured ± 3 µg/mL of PS myeloma for the
times shown. This plot represents a composite of a variety of
experiments in which the times examined varied. Our previous
up-regulation studies indicated that up-regulation begins immediately
after starting a culture with IgE antibody although this can be hard to
detect because the differences between expression values for most
donors basophils on day 0 and day 1 are small. Nevertheless, this
trend in the previously published data suggested that if IgE were
exerting an influence on synthetic rates of Fc
RI
, it should occur
within hours. Thus, the largest number of experiments focused on times
that were
24 h of culture, but we also examined later time periods.
For many of these experiments, portions of the cells were also
evaluated for Fc
RI
expression by flow cytometry, but for
experiments in which the analysis of mRNA was done on cells cultured
for less than several days, a subset of cells was cultured for 7 days
to obtain data that could be compared with previous 7-day results. In
Figure 3A
are shown the relative levels of Fc
RI
mRNA for cells
cultured with and without IgE. There was no change in mRNA at any of
the time points examined. In those experiments in which flow cytometry
was done in parallel, there was an average increase in Fc
RI
expression of 2.8-fold, a value consistent with previous studies
(average starting receptor 22E7 mean fluorescence intensity =24
or
29,000 receptors).
![]() View larger version (13K): [in a new window] |
Figure 3. Changes in mRNA levels for Fc RI during culture in the
presence and absence of IgE. (A) Ratio of mRNA levels ± 3 µg/mL
of IgE for the times shown, as determined by real-time PCR. The plot is
a composite of eight experiments, but not all experiments included the
time points shown (n=5 for 1-, 2-, and 24-h time points;
n=2 for the 4-h time point; n=3 for the 72-h time
point; and n=1 for the 120-h time point). (B) Changes in
mRNA for Fc RI ( ) culture ± actinomycin D at 5 µM. The
ordinate is the ratio of mRNA levels determined by real-time PCR for
+actinomycin/-actinomycin (n=3). As a reference, similar
measurements were made for IL-4 mRNA () whose time course has been
previously described.
|
RI
, ß, and
using a competitive RT-PCR technique. Times up
to 24 h were examined. The results for Fc
RI
were similar to
real-time PCR data in Figure 3
; for times of 14 h, +IgE/-IgE ratios
were 0.96 ± 0.22 (n=6), and for 24 h, the ratio
was 0.96 ± 0.10 (n=3). Results for Fc
RIß and
are shown in Figure 4
. As observed for Fc
RI
, there were no consistent changes in
the mRNAs for these receptor subunits when comparing cultures with and
without IgE (3 µg/mL). The competitive RT-PCR results also allowed an
estimation of the absolute mRNA levels in these samples, 12120,
110, and 10100 molecules per basophil for Fc
RI
, ß, and
,
respectively.
![]() View larger version (14K): [in a new window] |
Figure 4. Changes in mRNA levels for Fc RIß and during culture in the
presence and absence of IgE. (A) Ratio of mRNA levels ± 3 µg/mL
of IgE for the times shown as determined by competitve RT-PCR for
Fc RIß; (B) Data for Fc RI . Individual experimental points
were plotted (each symbol representing a separate experiment), and not
all time points were part of each experiment.
|
RI
mRNA appeared to be a very stable species in that no
significant changes were observed throughout these experiments. To
determine whether this mRNA species is particularly stable (as often
found for so-called housekeeping genes), we treated cells with
actinomycin D and monitored mRNA levels for both Fc
RI
and IL-4
over the course of 4 h. Previous studies have shown that the low
constitutive level of IL-4 in basophils decays with a half-life of
approximately 1 h [in the absence of stimulation (J. T.
Schroeder, personal communication)]. Figure 3B
shows that Fc
RI
mRNA also decayed with a half-life similar to that of IL-4 mRNA.
While receptor mRNA expression was unaltered by incubation with IgE, it
remained possible that synthesis was under translational control.
However, receptor synthesis is extremely slow (see below); <500
molecules per h is a reasonable estimate. Nevertheless, we have found
that weak bands can be quantitated. Basophils were cultured with and
without IgE in medium containing only 35S-methionine as its
source of methionine. Cultures were limited to 6 h due to a low
absolute concentration of methionine, which appears to disallow a good
response of the basophil to the IL-3 in the cultures and therefore
significant apoptosis with longer cultures. Basophils were cultured for
6 h with and without IgE (5 µg/mL), and cell lysates were
analyzed by immunoprecipitation with 22E7, electrophoresis, and Western
blotting. Hyperfilm MP was exposed to the nitrocellulose for 24100 h
to develop for 35S-methionine, and then the nitrocellulose
was analyzed for Fc
RI
by Western blotting with UBI
anti-Fc
RI
and detection by ECL. Figure 5
shows one of the 35S-methionine exposures and the ECL
blot for of this experiment. After correcting for lane loading (based
on the Western blot) and averaging two separate experiments, the ratio
of +IgE/-IgE was 0.84 ± 0.16.
![]() View larger version (72K): [in a new window] |
Figure 5. Synthesis of Fc RI as determined by 35S-methionine
labeling. Basophils (average purity, 29%) were cultured in RPMI-1640
supplemented with all amino acids except methionine, which was replaced
with 35S-methionine for 6 h prior to harvesting and
lysis for immunoprecipitation with 22E7. Electrophoresis of the IP
material was followed by film exposure for 24 h (A). The
nitrocellulose membrane was then Western blotted with UBI
anti-Fc RI , and film was developed for ECL (B).
|
is varied. For example,
experimental dissociation rates of IgE from the receptor constrain
kr. As discussed below, multiple combinations of
kr and kf result in
similar fits of the model to the experimental data that make up Figure 6C (the EC50 for up-regulation). However, only one of the
kr/kf pairs that results
in a good fit for Figure 6C
also generates a good fit to Figure 6A
because of the constraint on the dissociation rate. With this
constraint, the best
kr/kf pair becomes 1 x 10-6 s-1 and
3 x 104 M-1
s-1, respectively. This is a particularly
interesting result because previous studies of the forward binding
constant have also given the estimate of 3 x 104
M-1 sec-1
[3
, 30
]. The rate of receptor loss is also
constrained by the data in Figure 6A
, in which rates of loss average
about 200 per h for the density of unoccupied receptors in these
experiments. Factoring in the experimental data presented above,
VR and KRO (Equation 1)
can be estimated. The synthetic rate is well defined by data in Figure 6B
and the high end of the curve in Figure 6C
. In the presence of a
high concentration of IgE, there is essentially no loss of receptor, so
the loading rate can be readily estimated (450 receptors per h per
cell). This fit of the rate based on the kinetics of up-regulation
(combined with knowledge of the removal rates) predicts the curves in
Figures 6C
and 6D
, which can be seen to readily fit the experimental
data for these plots. Thus, despite the use of five or six parameters,
the three ways of measuring receptor changes experimentally constrain
the choice of parameters, and the choices then further fit the fourth
experimental data set shown in Figure 6D
. The Figure 6
legend
summarizes the values of the parameters that optimally fit these four
plots. It should be noted that, with this choice of parameters and
starting with the number of unoccupied receptors that were generated in
the lactic acid strip experiments shown in Figure 2
, results in the
model predict a 17% loss of total receptors in 1 day, similar to that
found experimentally.
![]() View larger version (23K): [in a new window] |
Figure 6. Relationship of experimental to model simulation data. These four plots
of Fc RI expression changes in basophils were derived from previous
studies. The lines in the plots show the data derived from the model
simulation in which kf = 3 x
104 M-1
s-1; kr =
1.25 x 10-6
M-1; VR = 4,600
receptors/h/basophil; KRO = 125,000
receptors/basophil; L = 450 receptors/h/basophil; and
= 1. The data points were taken from the previously published
data [3]. (A) Changes in total receptor ( ) and IgE ( ) on
basophils cultured in the absence of IgE; (B) Changes in total receptor
on basophils cultured in the presence of 500 ng/mL of IgE; (C)
Relationship between up-regulation of receptors (D7/D0 values) in 7-day
culture at different concentrations of IgE; (D) Relationship between
starting density of receptor and the fold up-regulation during 7 days
of culture with 500 ng/mL of IgE.
|
parameter as a refinement to the regulated-loss
aspect of the model because the data in Figure 6A
suggested that a
value of
greater than one would better replicate the experimental
relationship between the rate of loss of IgE and receptor. However,
exploration of other values of
did not significantly improve the
ability of the model to simulate the experimental data (this is not to
say that changing
had little on the outcome of the various
simulationsit didonly that as all parameters were adjusted to the
new value of
and for optimal fit of the various plots, the fitting
was not markedly improved), so
was fixed to a value of one for the
rest of the models in which it was applicable.
The initial goal for these modeling efforts was to determine whether a
simple model of expression would also result in an EC50 for
up-regulation on the order of 200250 ng/mL. This was found to be the
case for all the models examined. The simulated curves in the plots in
Figure 6
can be generated for all four types of model. Figure 7
demonstrates the relationship between the value of either the
forward or reverse binding constants and the EC50 for up-regulation (as
determined by the model). In Figure 7A
, the forward-rate constant is
varied while the reverse-rate constant is held constant at 1 x
10-6 s-1, whereas in
Figure 7B
, the forward-rate constant was held constant at 3 x
104 M-1
s-1, while the reverse-rate constant
was varied. The curves were generated using the
regulated-loss/constant-synthesis model, but similar curves could be
generated with any of the models (data not shown). These results
indicate that the forward-binding constant has a linear relationship
with EC50 over a broad range whereas the reverse-binding constant has a
marked effect on the EC50 only at values that are not likely to
represent the dissociation of IgE from Fc
RI
.
![]() View larger version (9K): [in a new window] |
Figure 7. Relationship between the EC50 for receptor up-regulation in the
presence of IgE and the forward or reverse rate constants for IgE
binding to the receptor. (A) Reverse-rate constant held constant at
1 x 10-6 M-1
while the forward rate constant was varied in the model simulation.
Calculated results obtained from the concentration-dependence
relationship between IgE and fold up-regulation in a simulated 7-day
culture were used to obtain an EC50 of up-regulation for each value of
kf used in the simulation. (B) Calculated
results for the reverse-rate constant while holding the forward-rate
constant at 3 x 104 M-1
s-1. The gray zone indicates the range of
kr that seems to best fit our experimental data
using a one-compartment model.
|
RI
density and its change during a 7-day incubation in the
absence of IgE. The lower generated curve for the
regulated-synthesis/regulated-loss model (based on parameters that
allow all four relationships in Figure 6
to be fit) has the attribute
that the lower the starting density, the lower the ratio of D7/D0
expression; i.e., at low starting densities, there continues to be loss
of receptor. In contrast, for the constant-synthesis/regulated-loss
model, starting with low densities results in an increase over the
course of 7 days (this counterintuitive result is discussed below). The
model generates a steady-state point that occurs at approximately
25,000 receptors. If the cell starts with less than this number, it
increases to this number. If it starts with expression greater than
25,000 receptors, it decreases to this number (but not below). For many
of the experiments used to generate the parameters used for the
simulations (but only those that utilized freshly isolated basophils),
the experimental conditions included 7-day culture without IgE. These
data are shown in Figure 8
and indicate that the experimental data set
most reasonably follows the constant-synthesis/regulated-loss model. An
alternative way of analyzing this experimental data is to focus on
those experiments in which the starting receptor expression was below
25,000; this value would be 17,000 ± 1,700 (n=24) on
day 0 and 25,000 ± 2,600 after 7 days in culture without IgE.
![]() View larger version (23K): [in a new window] |
Figure 8. Experimental and simulated relationship between the starting receptor
density and its final density after a 7-day culture in the absence of
IgE. Two of the models were used for the calculated results; both
included regulated loss although one used constant synthesis and the
other used IgE-regulated synthesis. The data points were derived from
experiments performed under these conditions.
|
|
|
|---|
RI during
culture in the presence of IgE, with an eye towards demonstrating
whether IgE regulated either loss or gain or both. Our previous in
vitro studies suggested that the loss of receptors was very slow (5%
per day once sufficient IgE had dissociated) and also raised the
possibility that only unoccupied receptors were lost. Dissociating IgE
from basophils with lactic acid supported this viewpoint and also
indicated that the maximal rate of loss was not restricted to the low
rates estimated in previous studies. Indeed, 50% of unoccupied
receptors could be lost in 1 day. The data in Figure 2
suggest that we
had opened up
50,000 receptors (the starting receptor density was
100,000, 25% of which were lost in 1 day, and only unoccupied
receptors were lost) and that 25,000 would be lost in 24 h.
Although these receptors were lost (as reflected by decreases
in 15A5 binding), there was no loss of IgE (mAb TES-19 or 10-95-3), and
if the cells were fully sensitized, there was no loss of receptor
(22E7). These studies solidified our previous interpretation of the
data, i.e., that occupied receptor is protected from loss. How loss is
accomplished remains unknown. In this context, we also found that a
variety of metalloprotease inhibitors (all with hydroxamic acid
moieties and able to bind zinc), some reasonably selective for the CD23
metalloprotease [14
], do not appear to influence the
rate of Fc
RI
loss. The concentrations used for these experiments
have been shown to be effective in a variety of other systems, but
these drugs are also toxic in cell culture, so significantly higher
concentrations could not be examined.
The other side of this process relates to whether IgE induces synthesis
of Fc
RI
. Because receptor up-regulation, even in the presence of
high IgE concentrations, is very slow, we initially examined basophils
for any IgE-mediated changes in mRNA expression. This was done by three
techniques, all of which returned the same result. IgE had no
meaningful influence on expression of mRNA for Fc
RI
, ß, and
. We also could find no evidence for a change in synthetic rates as
determined by 35S-methionine labeling of Fc
RI
. It is
important that an ideal radiolabeling study for this purpose would be
designed to inhibit loss so that any changes in label accumulation
could not be ascribed to changes in the loss rate rather than the
synthesis rate. However, in these studies we can put the model
simulation to work and demonstrate that for a short incubation, changes
in the amount of labeling can be primarily attributed to changes in
synthetic rates. This occurred because there was already an existing
large pool of receptor, relative to the labeled receptor being
generated, that diluted out the labeled receptor so that any loss
mechanism sampled labeled receptor from this surface pool rather than
from the synthetic pool. Simulating a model in which the receptor can
be radiolabeled (or not) shows that within the first 12 h, loss
could contribute only a few percent to the accumulation of receptor
under the conditions of our experiments. Having said this, the data
indicate that there was no difference in the incorporation of
35S-methionine into Fc
RI
.
It is becoming increasingly evident that several factors lead to
expression of Fc
RI
[31
]. One aspect that we have
not examined which might still result in altered "loading" rates
relates to the regulatory mechanisms for transport of completed
Fc
RI
to the plasma membrane. These cells might synthesize
receptor at a higher rate than it is exported to the plasma membrane,
which would lead to an accumulation internally such that the export
rate could be modulated by IgE up to the point of the synthetic rate.
For example, 500 receptors per h might be synthesized, but under
conditions of low IgE, only 400 per h might be transported to the
plasma membrane. There would then be an accumulation of 100 receptors
per h internally (e.g., in the ER or Golgi apparatus) under
this scheme. Recently published results by Donnadieu et al.
[31
] raise the possibility of an accumulating internal
pool in the absence of Fc
RIß expression. As will be shown in a
forthcoming study, there does appear to be an internal pool of
receptors in freshly isolated basophils [32
]. Based on
the sensitivity of this pool to endoglycosidase H, this internal pool
appears to be a pre-Golgi pool in human basophils, but a clear
understanding of what this pool is doing in basophils is not yet in
hand. Its presence does open up the possibility for another level of
control for receptor loading on the plasma membrane.
To address this possibility, we searched for a relationship in our experimental data set that could be used to distinguish between a model that used regulated versus constant synthesis. We found that although the two models were not easily distinguished on the basis of the four relationships shown in Figure 6 , they were distinguished by the relationship shown in Figure 8 . This relationship indicated that the better model would be one of constant "loading," which would therefore indicate that there is no level at which the "loading" rate is modified by the presence of IgE, including the scheme discussed above in which transport to the plasma membrane was a potential area of regulation.
This notion of constant synthesis/regulated loss leading to an increase
in receptor expression in the absence of IgE when the starting density
is low is counter-intuitive. For any model in which there is other than
zero synthesis in the absence of IgE, there will necessarily be a
steady state at which loading is balanced by loss. The system is always
migrating to the appropriate steady state, and, because we force the
model to start with certain experimental conditions that are not
necessarily steady state for the model, the system naturally migrates
to this steady state. Therefore, the question becomes why this happens
in the in vitro experimental system? If the model parameters represent
what happens in vivo, then it should not be possible to observe an
increase in culture in the absence of IgE. The answer to this question
is not currently known, but we can speculate that culturing basophils
in media containing 10 ng/mL of IL-3 results in a change in the
synthetic or export rate of Fc
RI
. Thus, it is not IgE which
regulates the loading rate but IL-3. This may be testable under the
right conditions, although excluding IL-3 from these cultures is not
possible for extended periods due to the induction of apoptosis.
However, it is unlikely that many individuals have circulating IL-3
levels as high as 10 ng/mL, and IL-3 at these concentrations is known
to induce a variety of phenotypic changes in basophils. It is possible
that the loading rates of Fc
RI
are one of the processes
controlled by IL-3. If so, transferring cells from in vivo conditions
to in vitro conditions would shift the steady-state point higher, thus
causing basophils with low levels of expression to increase expression
even in the absence of IgE. A combination of recent results by our
group and other data recently published suggest one possibility. As
noted above, Donnadieu et al. [31
] have shown that
Fc
RIß regulates the rate at which Fc
RI
2 is
transferred from the ER to post-ER processing steps (Golgi and
transport). We have recently shown that IL-3 markedly up-regulates the
expression of Fc
RIß (increases in protein and mRNA)
[32
]. When these results are taken together, we could
suggest that once placed in culture, donor basophils that begin with
very low receptor levels (and therefore do not express much Fc
RIß)
would increase the rate of ER-to-Golgi processing, effectively
increasing the loading rate and therefore altering the steady-state set
point upwards.
The other goal of the modeling was to determine whether a simple model
could explain the unexpectedly high IgE EC50 for Fc
RI
up-regulation. Parameters that allowed a good fit with the
down-regulatory and up-regulatory kinetics resulted in an excellent fit
with the EC50 relationship. For all the models examined, the forward
rate constant played a dominant role in positioning the EC50 point.
This is an intuitively correct result; if loss is controlled by
receptor occupancy, then the rate that IgE can occupy the receptor
would influence the ability of the cell to accumulate receptor. The
parameter kr that fits the data set best is
entirely consistent with previously determined values [3
,
30
].
We also examined the effect of including a second circulation
compartment in the model. One interesting aspect to the two-compartment
model is that it allows for a faster dissociation constant to be used
in the model and still retains the quality of data fitting shown in
Figure 6
. Rates of dissociation faster than the one we have used in the
one-compartment model would be more consistent with reported
dissociation rates. However, it is not yet known what happens to
receptor removed from the cell surface. Studies in RBL cells in the
1980s indicated that monomeric receptors undergo coendocytosis with
aggregated Fc
RI cycles through an internal compartment
[33
]. On the other hand, under resting conditions,
unoccupied receptors on RBL cells disappear by mechanisms unknown
[12
]. One could conclude that when receptors are lost
under these conditions, they become unable to bind IgE because
the technique used to isolate receptor depends on IgE binding. This
result would suggest that there is no receptor recycling under
resting-cell conditions in RBL cells. The simulated two-compartment
model also appears to shift the steady-state receptor density (the
value the system settles into in the absence of IgE) upward
significantly, to values that are not as compatible with the
experimental results we have found. Whether, this is an indication of
the absence of a cycling second compartment requires experimental
verification.
In summary, these studies strongly suggest that regulation of
Fc
RI
expression on basophils is mediated by a process of
IgE-regulated loss in the presence of constant synthesis. We have
strengthened our data which indicate that loss occurs only with
unoccupied receptors. The nature of the down-regulatory process remains
unknown. At both the mRNA level and protein level, there was no
indication that IgE regulates synthetic rates.
If the model of constitutive synthesis and regulated loss is
correct, there are two specific steady solutions that have biological
implications. The steady-state solution with no IgE present for
Equations 1-3 is calculated as follows:
![]() |
RI should be 13,554 receptors. This result appears
different from the one shown in Figure 8
. However, the data in Figure 8 indicate a crossover point for the in vitro system under study; i.e.,
the point where basophils cultured in the absence of IgE do not lose
and do not gain receptors appears to be
25,000. The cause for
this discrepancy lies in the method by which the experiment was
performed in Figure 8
. To simulate what is happening in the
experimental cultures, it was necessary to include the fact that the
basophils come preloaded with some IgE. In the low range of receptors
where the cells gain receptors even in the absence of IgE, experimental
measurements indicate that receptor occupancy ranges from 30 to 70%
depending on the starting density. For the purposes of the simulation,
a variety of experimental studies led to a simple relationship between
starting density and occupancy which was used to do the simulation. The
effect of including some resident IgE on the basophil is that the
starting receptor density is approximated by the unoccupied receptor
density in this type of experiment. Some of the resident IgE
dissociates (and reaches an approximate equilibrium with the receptors)
so that the final result is a steady state loosely based on the
unoccupied-receptor density. At 25,000 receptors, occupancy is such
that there is no net gain or loss of total receptors in a 7-day
culture. This result is therefore different from a situation in which
IgE concentrations are very low in vivo. Here, the cell surface density
of receptors more closely approaches the prediction of the steady-state
solution. For example, for values of IgE <1 ng/mL, 1 week of
accumulation from 0 (see below) would be within 10% of the
steady-state value noted above.
A second issue relates to the maximum numbers of receptors that
could be expressed on basophils. In this model, during the first weeks
of receptor accumulation, the process appeared linear, but a maximum
does exist in this model. Although the accumulation to a maximum occurs
asymptotically, the time to reach this asymptote is extremely long for
concentrations of IgE considered typical for atopic patients (at 500
ng/mL of IgE, reaching this maximum requires over a year). Furthermore,
the asymptote is a linear function of the IgE concentration (as is the
time required to closely approximate the asymptote at concentrations
above
3 ng/mL); at 500 ng/mL of IgE, the maximum number of receptors
would be approximately 720,000 (using the parameters supplied in the
Figure 6 legend). It is apparent that the in vitro loading rate for
basophils is fairly slow such that if no receptors are lost because the
IgE concentration is high, 450 receptors per hour translates to only
75,000 receptors per week in the first weeks of the process. Atopic
donors have receptor densities that average 250,000 per cell. The
implication is that the basophils must circulate for weeks to obtain
this value. The only published reports for the human basophil life span
conclude that it is on the order of 2 days [34
]. Other
anecdotal reports have placed the life span closer to 12 weeks. In
either case, further information is necessary. Prior to being moved
into the circulation, developing basophils express receptors
[35
]. However, the following information is missing: (1)
the residence time of the basophil in the bone marrow, (2) when, during
its development, the basophil begins behaving like a circulating
basophil with respect to the control of Fc
RI expression, and (3) the
titers of IgE in the marrow. As noted in the discussion, the regulation
of Fc
RI
synthetic rates may not be a function of IgE but of other
factors, such as the cytokine environment. Therefore, the actual rates
of loading may be different in the marrow than in the circulation.
Therefore, although the analysis is incomplete due to a lack of
information, there are clearly some issues raised which, if addressed,
may shed new insight into the process of Fc
RI expression.
Received November 25, 2000; revised February 11, 2001; accepted February 15, 2001.
|
|
|---|
RI expression on human basophils during in vivo treatment of atopic patients with anti-IgE antibody J. Immunol. 158,1438-1445[Abstract]
RI
expression on human basophils by IgE antibody Blood 91,1633-1643
RI expression in vitro and in vivo: evidence for a novel amplification mechanism in IgE-dependent reactions J. Exp. Med. 185,663-672
RI expression in vivo J. Immunol. 158,2517-2521[Abstract]
RI on human basophils by IgE antibody is mediated by interaction of IgE with Fc
RI J. Allergy Clin. Immunol. 104,492-498[Medline]
RI) is sufficient for high affinity IgE binding J. Biol. Chem. 265,22079-22081
RI): analysis of functional domains of the
-subunit with monoclonal antibodies J. Biol. Chem. 266,11245-11251
RI
and Fc
RIg mRNAs in human mast cells and basophils by competitive reverse transcription-polymerase chain reaction J. Immunol. 154,5472-5480[Abstract]
RIbeta subunit Immunity 12,515-523[Medline]
RI
and Fc
RIb in human blood basophils J. Allergy Clin. Immunol. 107,832-841[Medline]This article has been cited by other articles:
![]() |
S. S. Ishmael and D. W. MacGlashan Jr. Syk expression in peripheral blood leukocytes, CD34+ progenitors, and CD34-derived basophils J. Leukoc. Biol., February 1, 2010; 87(2): 291 - 300. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Zaidi and D. W. MacGlashan Regulation of Fc{varepsilon}RI Expression during Murine Basophil Maturation: The Interplay between IgE, Cell Division, and Fc{varepsilon}RI Synthetic Rate J. Immunol., February 1, 2010; 184(3): 1463 - 1474. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. MacGlashan Jr. Endocytosis, recycling, and degradation of unoccupied Fc{epsilon}RI in human basophils J. Leukoc. Biol., October 1, 2007; 82(4): 1003 - 1010. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gomez, S. Jogie-Brahim, M. Shima, and L. B. Schwartz Omalizumab Reverses the Phenotypic and Functional Effects of IgE-Enhanced Fc{epsilon}RI on Human Skin Mast Cells J. Immunol., July 15, 2007; 179(2): 1353 - 1361. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Schroeder, A. P. Bieneman, H. Xiao, K. L. Chichester, K. Vasagar, S. Saini, and M. C. Liu TLR9- and Fc{epsilon}RI-Mediated Responses Oppose One Another in Plasmacytoid Dendritic Cells by Down-Regulating Receptor Expression J. Immunol., November 1, 2005; 175(9): 5724 - 5731. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mack, M. A. Schneider, C. Moll, J. Cihak, H. Bruhl, J. W. Ellwart, M. P. Hogarth, M. Stangassinger, and D. Schlondorff Identification of Antigen-Capturing Cells as Basophils J. Immunol., January 15, 2005; 174(2): 735 - 741. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||