Journal of Leukocyte Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yao, L.
Right arrow Articles by Tosato, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yao, L.
Right arrow Articles by Tosato, G.
(Journal of Leukocyte Biology. 2001;69:779-784.)
© 2001 by Society for Leukocyte Biology

Interleukin-18 expression induced by Epstein-Barr virus-infected cells

Lei Yao*, Joyce Setsuda*, Cecilia Sgadari{dagger}, Barry Cherney{ddagger} and Giovanna Tosato*

* Transplantation Immunology Department, Medicine Branch, Division of Clinical Sciences, National Cancer Institute, National Institutes of Health, and
{ddagger} Division of Therapeutic Proteins, Center for Biologics Evaluation and Research, Bethesda, MD; and
{dagger} Laboratorio di Virologia, Istituto Superiore di Sanitá, Rome, Italy

Correspondence: Lei Yao, Transplantation Immunology Department, Medicine Branch, DCS, NCI, NIH, Bldg. 10, Room 12C07, Bethesda, MD 20892. E-mail: Yaol{at}mail.nih.gov


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human Epstein-Barr virus (EBV)-negative Burkitt lymphomas cells usually grow as malignant subcutaneous tumors in athymic mice, but these tumors regress when the Burkitt cells are injected in conjunction with EBV-positive lymphoblastoid cells or when the Burkitt cells are transfected with the EBV latent membrane protein-1 (LMP-1) gene. Tumor regression is mediated, in part, by murine interferon {gamma} (IFN-{gamma}) and the IFN-{gamma}-induced murine chemokine IFN-{gamma}-inducible protein-10 (IP-10). The mechanisms by which EBV-LMP-1 promotes the expression of IFN-{gamma} has remained unclear. Here we show that murine interleukin (IL)-18 was consistently expressed in regressing Burkitt tumors but was either expressed at low levels or absent from progressively growing Burkitt tumors. By immunohistochemical methods, IL-18 protein was visualized in regressing but not in progressively growing Burkitt tumors. In contrast, IL-12 p35 and IL-12 p40 were only rarely expressed in regressing Burkitt tumors. In splenocyte cultures, EBV-infected lymphoblastoid cells and LMP-1-transfected Burkitt cells promoted the expression of IL-18 but not the expression of IL-12 p35 and IL-12 p40. A neutralizing antibody directed at murine IL-18 reduced murine IP-10 expression induced by EBV-immortalized cells in splenocyte cultures. These results provide evidence for IL-18 expression in response to a viral latency protein and suggest that IL-18 may play an important role as an endogenous inducer of IFN-{gamma} expression, thereby contributing to tumor regression.

Key Words: Burkitt lymphoma • interferon {gamma} • angiogenesis • latent membrane protein-1 • tumor regression


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Host responses to Epstein-Barr virus (EBV) infection include T-cell-mediated cytotoxic responses, antibody responses, and the production of interferons (IFNs), cytokines, and chemokines [1 ]. In an experimental athymic mouse model, EBV-immortalized lymphoblastoid cells have been shown to elicit a T-cell-independent host response that either prevents these human cells from giving rise to tumors or leads to the complete regression of small tumors that might form [2 ]. When injected subcutaneously together with a variety of human tumor-derived cell lines that are malignant in this model, EBV-immortalized cells consistently lead to the regression of tumors through necrosis and scarring [3 ].

Previous studies have found that the EBV-encoded latency protein LMP-1 is responsible for the antitumor response elicited by EBV-immortalized cells in athymic mice [4 ]. In athymic mice, EBV-negative Burkitt cells transfected with the LMP-1 gene and expressing the protein at high levels give rise to tumors that spontaneously regress through necrosis and scarring, whereas the parental cells or control transfectants give rise to progressively growing malignant tumors.

Efforts to clarify the host response leading to tumor regression induced by the EBV-LMP-1 protein have shown that two murine chemokines—interferon-inducible protein 10 (IP-10) and the monokine induced by interferon-{gamma} (Mig)—serve as downstream mediators of the antitumor response by inhibiting tumor angiogenesis [5 , 6 ]. IP-10 and Mig, structurally related CXC chemokines that share CXCR3 as a signaling receptor, are active as chemotactic factors for T and natural killer (NK) cells, inhibit angiogenesis, and exert antitumor effects [7 ]. In earlier studies, we found IFN-{gamma}, IP-10, and Mig to be expressed at significantly higher levels in mice having Burkitt tumors undergoing regression compared with mice having Burkitt tumors growing progressively [5 ]. EBV-negative Burkitt cells transfected with IP-10 give rise to tumors that undergo massive spontaneous necrosis and display widespread histological evidence of vascular damage [5 ]. When inoculated into mice with progressively growing Burkitt tumors, IP-10 and Mig produce extensive tumor necrosis and vascular damage [5 , 6 ]. However, the mechanism by which EBV-LMP-1 can elicit the expression of IFN-{gamma}, IP-10, and Mig, all of which mediate tumor tissue necrosis in this murine model, has remained unclear.

The multifunctional cytokines IL-12 and IL-18 have been identified as potent inducers of IFN-{gamma} [8 , 9 ]; therefore, we examined the potential contribution of IL-12 and IL-18 to the antitumor responses elicited by EBV-LMP-1 in athymic mice.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cells and cell lines
The Burkitt lymphoma cell lines CA46 and BL-41, the EBV-immortalized lymphoblastoid cell line VDS-O, and the EBV-infected marmoset cell line B95-8 were cultured in RPMI 1640 medium (Biofluids, Rockville, MD) supplemented with 10% heat-inactivated fetal bovine serum (BioWhittaker, Walkersville, MD), 2 mmol/L of L-glutamine (GIBCO-BRL, Grand Island, NY), and 5 µg/mL of gentamicin (Sigma Chemical Co., St. Louis, MO). The LMP-1-transfected and the control vector-transfected BL-41 cell lines (a gift of E. Kieff, Harvard Medical School, Boston, MA) were maintained in guanosine triphosphate selection medium. Splenocytes obtained from 4- to 6-week-old female BALB/c nu/nu mice through standard techniques were incubated (2 x 106 cells/mL) in 24-well tissue culture plates (Costar, Corning, NY) in complete tissue culture medium consisting of a 1:1 mixture of RPMI 1640 medium (BioWhittaker, Walkersville, MD) and enriched Eagle’s medium (Biofluids, Inc., Rockville MD) supplemented with 10% fetal bovine serum (BioWhittaker), 2mmol/L of L-glutamine (Life Technologies, Grand Island, NY), 10-4 mol/L of 2-mercaptoethanol (GIBCO), and 5 µg/mL of gentamicin (Sigma).

Antibodies
Rabbit anti-murine IP-10 and rabbit anti-murine Mig were gifts of J. M. Farber [Laboratory of Clinical Investigation, National Institutes of Allergy and Infectious Diseases, National Institutes of Health (NIH), Bethesda, MD]; mouse anti-rat IFN-{gamma} monoclonal antibody (clone DB-1; cross-reactive with mouse protein) was a gift of D. Finbloom [Center for Biologics Evaluation and Research, U.S. Food and Drug Administration (FDA), Bethesda, MD]; rabbit anti-murine IL-18 antisera were purchased from PeproTech (Rocky Hill, NJ) and R&D Systems Inc. (Minneapolis, MI); a monoclonal anti-murine IL-18 antibody was purchased from R&D Systems Inc.; and an antibody against murine IL-12 was a gift of Genetics Institute, Inc., Cambridge, MA.

Animal studies
Four- to 6-week-old BALB/c nu/nu mice (National Cancer Institute, Bethesda, MD) maintained in pathogen-limited conditions were used throughout. Mice received 400 Rads of total body irradiation and 24 h later were injected subcutaneously in the right abdominal quadrant with 107 exponentially growing CA46 Burkitt lymphoma cells. Some of the mice received weekly intratumor injections of buffer alone (0.1 mL), whereas other mice received weekly intratumor inoculations of 107 exponentially growing VDS-O lymphoblastoid cells (0.1-mL total injection volume). All animals were observed twice weekly, and tumor sizes were recorded as the product of two-dimensional caliper measurements. Tumors were removed 4 weeks after initial cell inoculation.

Reverse transcriptase-polymerase chain reaction
Total cellular RNA was isolated from tumors and splenocytes by standard methods (using RNAzol solution; GIBCO-BRL, Gaithersburg, MD). Four milligrams of RNA were reverse transcribed using the SuperScript preamplification system (GIBCO-BRL). Complementary DNA (cDNA) corresponding to 80 ng of total RNA was subjected to polymerase chain reaction (PCR) amplification in a 50-µg reaction mixture containing 20 mmol/L of Tris-HCl (pH 8.4), 50 mmol/L of KCl, 1.5 mmol/L of MgCl2, 200 µmol/L of each deoxynucleotide triphosphate, 2.5 U of Taq DNA polymerase (GIBCO-BRL), and 0.2 µmol of each primer pair. The primers for amplification of murine IFN-{gamma}, IP-10, Mig, IL-12 p35, IL-12 p40, and granzyme B and the conditions for amplification were as previously described [5 , 10 ]. The primer pair for amplification of murine IL-18 was 5' ACTGTACAACCGCAGTAATACGG and 3' AGTGAACATACAGATTTATCCC [11 ]. The primer pair for amplification of the murine housekeeping gene encoding cytochrome oxidase subunit II (MCOII) included 5' TGGCCTACCCATTCCAACTT and 3' GGTTAACGCTCTTAGCTTCA. All primer pairs were specific for murine RNA and discriminated human RNA. For semiquantitative results, the amount of RNA from each sample was selected on the basis of equivalent amounts of MCO II cDNA amplified from each sample, and the number of amplification cycles was selected experimentally for each primer pair to fit the linear part of the sigmoid curve reflecting the relationship between the number of amplification cycles and the amount of PCR product. PCR products were detected with 32P-labeled nucleotides ([{alpha}-32P]dCTP [specific activity, ~3,000 Ci/mmol; Amersham, Arlington Heights, IL] on 8% acrylamide [Long Ranger; AT Biochem, Malvern, PA])-Tris-borate ethylenediamine tetraacetate gels, followed by autoradiography.

Immunohistochemistry
Paraffin-embedded tissue sections were deparaffinized twice in xylene and twice in 100% ethanol, incubated in 3% hydrogen peroxide in methanol, and rehydrated through graded ethanol washes followed by Tris-buffered saline (TBS). After blocking with 3% serum in TBS, sections were incubated overnight at 4°C with dilutions of selected primary antibodies (1:200 dilution of rabbit anti-murine IP-10, 1:200 dilution of rabbit anti-murine Mig, 1:200 dilution of rabbit anti-mouse IL-18, or 1:100 dilution of rat anti-mouse IFN-{gamma} monoclonal antibody). After washing, biotinylated goat anti-rabbit, goat anti-rat, or horse anti-mouse secondary antibody (2 µg/mL; Vector Labs, Burlingame, CA) was applied followed by VECTASTAIN ABC peroxidase complex (Elite ABC kit; Vector Labs). The sections were developed using peroxidase 3,3'-diaminobenzidine substrate and counterstained with hematoxylin. All sections were mounted, dehydrated, and examined by light microscopy.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Cytokine and chemokine gene expression in mice infected with experimental Burkitt lymphoma
Burkitt tumors were established in 12 BALB/c nu/nu mice by subcutaneous inoculation of 107 CA46 Burkitt lymphoma cells. To promote tumor regression, six of the mice were treated with weekly intratumor inoculations of 107 VDS-O lymphoblastoid cells. The remaining mice received weekly intratumor inoculations of medium alone. All tumors were harvested 4 weeks after cell inoculation, and their total RNA was extracted. Control tumors grew progressively, and 4 weeks after cell inoculation the tumors were significantly larger in size than the tumors treated with the lymphoblastoid cells, which displayed visible tumor necrosis and scarring (Fig. 1 ). As expected, the PCR products for murine IFN-{gamma}, granzyme B (Fig. 1) and the chemokines IP-10 and Mig (data not shown) were found to be more abundant in tumor tissues from regressing as opposed to progressively growing tumors. The murine IL-12 p35 and IL-12 p40 PCR products were generally undetected or detected at low levels in these tumors. In contrast, the PCR products for murine IL-18 were more abundant in tumor tissues from regressing as opposed to progressively growing tumors (Fig. 1) .



View larger version (53K):
[in this window]
[in a new window]
  		Figure 1. Patterns of cytokine and IFN-{gamma} gene expression in experimental Burkitt tumors. BALB/c nu/nu mice were injected subcutaneously with the EBV-negative Burkitt lymphoma CA46 cell line (106 cells/mouse). A group of mice (n = 6) was treated weekly with intratumor inoculations of 107 VDS-O lymphoblastoid cells (100 µL), whereas control mice (n = 6) were injected weekly into the tumor with buffer alone (100 µL). Four weeks after the Burkitt cells were inoculated, all tumors were removed and measured, and RNA was extracted from the regressing and progressively growing Burkitt tumors. Total RNA was subjected to semiquantitative reverse transcriptase-PCR analysis.

 
Paraffin-embedded sections from progressively growing and regressing Burkitt tumors were stained for murine IL-18, IL-12, and IFN-{gamma}. Whereas tumor tissues from progressively growing Burkitt tumors were generally negative for all tested proteins, tumor tissues from regressing Burkitt tumors invariably stained for murine IL-18, IFN-{gamma}, and IP-10. No staining for IL-12 was detected (data not shown). In representative samples (Fig. 2 ), murine IL-18 was present mostly in patchy areas at the interphase that demarcates live from necrotic tumor tissue. IL-18 resided in large cells with the morphology of macrophages, whereas IFN-{gamma} was diffuse throughout the tumor and resided in small cells with the morphology of lymphocytes (Fig. 2) . These experiments demonstrated that tumor regression in this model is associated with a murine host response that includes increased tumor tissue expression of murine IL-18 but not IL-12.



View larger version (74K):
[in this window]
[in a new window]
  		Figure 2. Immunohistochemical detection of IL-18 and IFN-{gamma} in regressing Burkitt tumors. Representative tissues from regressing Burkitt tumors were stained for murine IL-18 and IFN-{gamma} and counterstained with hematoxylin. Original magnification x40.

 
IL-18 expression induced in splenocytes by EBV-infected cells
The experiments above demonstrated increased IL-18 expression in Burkitt tumors treated with EBV-immortalized cells and subsequently regressing. To examine whether EBV-infected cells can induce IL-18 expression, we used an in vitro system in which murine BALB/c nu/nu splenocytes were cultured for 48–72 h with EBV-immortalized cells, EBV-LMP-1-expressing cells, and control cells. When the splenocytes were incubated with cells from the EBV-negative Burkitt cell line BL-41, BL-41 cells transfected with vector alone, or the EBV-negative Burkitt cell line CA46, the PCR products for murine IL-18 and IL-12 p40 were either undetectable or detectable at very low levels (Fig. 3 ). By contrast, when the splenocytes were cultured with cells from the EBV-infected lymphoblastoid cell lines (B95-8 or VDS-O) or with the LMP-1-transfected BL41 Burkitt cells, the PCR products for IL-18 but not for IL-12 p40 were abundant (Fig. 3) . Also detected were the PCR products for murine IFN-{gamma} from splenocytes cultured with the EBV-infected lymphoblastoid B95-8 and VDS-O cell lines. Thus, the pattern of murine cytokine and chemokine gene expression induced in splenocytes by EBV-positive cells was similar to that induced in BALB/c nu/nu mice bearing regressing Burkitt tumors.



View larger version (59K):
[in this window]
[in a new window]
  		Figure 3. Cytokine and IFN-{gamma} gene expression in splenocytes cultured with EBV-negative, EBV-positive, and LMP-1-expressing cell lines. BALB/c nu/nu splenocytes (106/mL) were cultured for 48 h with the indicated cell lines (106 cells/mL). At the end of incubation, total RNA was extracted, and cytokine gene expression was evaluated by semiquantitative reverse transcriptase-PCR.

 
Using this in vitro culture system, we looked for murine IL-18 and IP-10 proteins in the culture supernatants of splenocytes cultured in the presence of EBV-immortalized cells. We estimated that the lower limit of detection for IL-18 was approximately 2 ng/mL by enzyme-linked immunosorbent assay (ELISA) and 1.5 ng by immunoprecipitation, and that the lower limit of detection for murine IP-10 was approximately 1 ng/mL by ELISA and 1 ng/mL by immunoprecipitation. However, we were unable to detect IL-18 and IP-10 proteins by either the ELISAs or immunoprecipitation, raising the possibility that these proteins might be present in the culture supernatants at levels below the detection limit.

Effects of IL-18 neutralization on IP-10 expression induced by EBV-immortalized cells in splenocytes
IL-18 has previously been shown to induce expression of IFN-{gamma} [9 ]. In turn, IFN-{gamma} is known to be a potent inducer of IP-10 and other chemokines [7 ]. To examine whether IL-18 serves as a mediator of IP-10 expression induced by EBV-immortalized cells, we used a neutralizing monoclonal antibody against murine IL-18 (10 µg/mL; R&D Systems) in cultures of BALB/c nu/nu splenocytes culture with the lymphoblastoid VDS-O cell line. In parallel, we tested the effects of a neutralizing antibody against murine IL-12 (10 µg/mL; Genetics Institute) alone or in conjunction with the neutralizing antibody against murine IL-18 (10 µg/mL). Confirming the results above, murine IL-18 and murine IP-10 were undetectable in the culture supernatants of splenocytes cultured alone or in the presence of VDS-O cells (data not shown), presumably due to assay sensitivity. We therefore examined IP-10 expression by semiquantitative reverse transcriptase-PCR. As shown (Fig. 4 ), the PCR product for murine IP-10 was absent from splenocytes cultured in medium alone but was detected in splenocytes cultured with VDS-O cells. By comparison with splenocytes cultured with VDS-O cells alone, the PCR product for murine IP-10 was reduced from splenocytes cultured with neutralizing antibody against murine IL-18 either alone or in conjunction with neutralizing antibody against murine IL-12. By contrast, the IP-10 PCR product was only minimally reduced in splenocytes cultured with neutralizing antibody to murine IL-12 alone compared with cultures without antibody. These results indicate that IL-18, not IL-12, mediates, at least in part, IP-10 expression induced by EBV-immortalized cells in splenocytes.



View larger version (42K):
[in this window]
[in a new window]
  		Figure 4. IL-18 dependency of IP-10 expression induced by EBV-immortalized cells in splenocytes. BALB/c nu/nu splenocytes (106/mL) were cultured for 48 h with the lymphoblastoid cell line VDS-O (106 cells/mL) in medium alone, with neutralizing monoclonal antibody against murine IL-18 (10 µg/mL), with neutralizing antibody against murine IL-12 (10 µg/mL), or with anti-IL-18 (10 µg/mL) plus anti-IL-12 (10 µg/mL)-neutralizing antibodies together. At the end of incubation, total RNA was extracted, and cytokine gene expression was evaluated by semiquantitative reverse transcriptase-PCR. After normalization for the murine MCO II housekeeping gene, the results of phosphorimage analysis were plotted as arbitrary units (pixels). Lanes (left to right): 1, splenocytes in medium alone; 2, splenocytes plus VDS-O; 3, splenocytes plus VDS-O plus anti-IL-18; 4, splenocytes plus VDS-O plus anti-IL-12; 5, splenocytes plus VDS-O plus anti-IL-18 plus anti-IL-12.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, we show that murine IL-18 was consistently expressed in experimental Burkitt tumors that had been treated with EBV-immortalized cells and were regressing, but IL-18 was not expressed in control tumors growing progressively. We also show that, in contrast to IL-18, IL-12 p35 and IL-12 p40 were expressed in only a minority of regressing tumors. Previous studies have demonstrated that EBV-immortalized cells can induce a potent antitumor response in athymic mice and that this response is mediated, in part, by murine IFN-{gamma} and the IFN-{gamma}-inducible chemokines IP-10 and Mig [2 3 4 5 ]. The observation reported here that IL-18 but not IL-12 is consistently expressed in tumors that regress raises the possibility that IL-18 may represent a critical endogenous mediator of IFN-{gamma} production in the context of antitumor responses.

Two cytokines, IL-12 and IL-18, are presently regarded as the principal inducers of IFN-{gamma} during inflammatory responses, but their relative contribution to IFN-{gamma} production in various settings remains undefined [8 , 9 ]. Many studies support the notion that IL -12 and IL-18 act synergistically as IFN-{gamma} inducers. This synergy has been explained on the basis of the observations that IL-12 can stimulate the expression of the IL-18 receptor [12 , 13 ], that IL-12 and IL-18 can regulate the production of each other [14 , 15 ], and that IL-12 and IL-18 can regulate the IFN-{gamma} promoters but act at different levels [16 ]. By itself, IL-12 is a potent inducer of IFN-{gamma} [17 ]. When given to IL-1-converting-enzyme (ICE) knockout mice, IL-12 induced substantial IFN-{gamma} production independently of IL-18, which remained low in the circulatory system [18 ]. In IL-18 knockout mice, IL-12 promoted NK cell cytotoxicity [19 ]. However, recent observations suggest that endogenous IL-18 may contribute significantly to IFN-{gamma} stimulation by IL-12, both in vitro and in vivo [18 ].

IL-18 was originally described as an endotoxin-induced serum factor that stimulates IFN-{gamma} production [20 ]. Both in vivo and in vitro, neutralizing antibodies to murine IL-18 markedly reduced LPS-induced IFN-{gamma} production, suggesting that endogenous IL-18 is required for IFN-{gamma} production induced by microbial agents [11 , 18 ]. However, the ability of IL-18 to induce IFN-{gamma} is mostly dependent on the contribution of a second signal provided by mitogens, microbial agents, or IL-12 [21 22 23 ].

In our experimental system, we found no evidence of increased expression of IL-12 p35 and IL-12 p40 mRNA or increased levels of IL-12 protein in tumor tissue in which IFN-{gamma} was detected. We cannot exclude that small levels of IL-12 might be present and serve as a second signal for IFN-{gamma} production induced by IL-18 or that another molecule might substitute for IL-12. Another possibility is that the EBV-LMP-1-positive cells serve roles both as inducers of IL-18 secretion and as a source of a second signal for IFN-{gamma} production by IL-18. It is noteworthy that the EBV-positive cells promoted increased IL-18 mRNA expression in tumor tissue and splenocytes and increased accumulation of cell-associated IL-18 protein in tumor tissue. In addition, a neutralizing antibody to murine IL-18 reduced levels of murine IP-10 expression induced by EBV-immortalized cells in splenocytes, whereas an antibody to murine IL-12 had minimal effect in this system. Because mature IL-18 is produced from its inactive precursor by the ICE caspase-1, the expression of IL-18 mRNA is not always associated with the secretion of a functional IL-18 protein [24 ]. Indeed, mice deficient in caspase-1 fail to produce IFN-{gamma} in response to endotoxin due to the absence of mature IL-18 in these mice [18 , 25 , 26 ]. However, the presence of IFN-{gamma} mRNA and protein in the absence of detectable IL-12 p35 or IL-12 p40 mRNA supports the notion that biologically active IL-18 protein was being induced in this system.

A murine mammary carcinoma cell line transfected with the IL-18 gene was found to be less tumorigenic and to form tumors more slowly than control cells [27 ]. The antitumor effect of IL-18 in this system required IFN-{gamma} and was attributed to inhibition of angiogenesis by IL-18. We have previously demonstrated that inhibition of tumor angiogenesis is central to the antitumor effects of EBV-positive cells, and we have identified the IFN-{gamma}-inducible chemokines IP-10 and Mig as downstream mediators of this antiangiogenic effect. Furthermore, we have proposed that NK cells, recruited to the tumor site by the chemokines IP-10 and Mig and locally activated by IFN-{gamma}, are required for the antitumor effect [28 ]. By consistently detecting IL-18 expression in regressing Burkitt tumors, the current experiments provide evidence that IL-18 represents a missing link in the antitumor response induced by EBV-LMP-1-positive cells.

In addition to its more clearly defined role in inflammation, IL-18 may play an important role in natural responses to cancer. An analysis of patterns of cytokine and chemokine expression in human lymphoproliferative diseases demonstrated that IL-18, IFN-{gamma}, and Mig are present at significantly higher levels in lymphoid tissues from patients diagnosed with acute EBV-induced infectious mononucleosis as opposed to tissues with post-transplant lymphoproliferative disease [29 ]. Although both conditions are associated with EBV infection, acute infectious mononucleosis is mostly a self-limited illness, whereas post-transplant lymphoproliferative disease is associated with the unbridled expansion of EBV-infected cells. In the EBV-associated lymphoid granulomatosis and nasal or nasal-type T/NK cell lymphomas, IP-10 and Mig have also been found to be expressed at significantly higher levels than in tissues with lymphoid hyperplasia [30 ]. Recently, we found IL-18 and IFN-{gamma} also to be elevated in lymphoid granulomatosis and nasal or nasal-type T/NK cell lymphoma tissues (L. Yao, J. Setsuda, C. Sgadari, B. Cherney, and G. Tosato, unpublished data). The increased expression of IL-18, IFN-{gamma}, IP-10 and Mig in certain EBV-positive lymphoproliferative diseases with a benign outcome or prominent tumor tissue necrosis raises the possibility that IL-18 may participate in critical host responses designed to limit excessive or abnormal lymphoid cell growth.


   ACKNOWLEDGEMENTS
 
The authors thank Dr. Elaine Jaffe, Dr. Julie Teruya-Feldstein, and Dr. Elliott Kieff.

Received September 11, 2000; revised January 3, 2001; accepted January 5, 2001.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Masucci, M. G., Ernberg, I. (1994) Epstein-Barr virus: adaptation to a life within the immune system Trends Microbiol 2,125-130[Medline]
  2. Tosato, G., Sgadari, C., Taga, K., Jones, K. D., Pike, S. E., Rosenberg, A., Sechler, J. M., Magrath, I. T., Love, L. A., Bhatia, K. (1994) Regression of experimental Burkitt’s lymphoma induced by Epstein-Barr virus-immortalized human B cells Blood 83,776-784[Abstract/Free Full Text]
  3. Angiolillo, A. L., Sgadari, C., Sheikh, N., Reaman, G. H., Tosato, G. (1995) Regression of experimental human leukemias and solid tumors induced by Epstein-Barr virus-immortalized B cells Leuk. Lymphoma 19,267-276[Medline]
  4. Cherney, B. W., Sgadari, C., Kanegane, C., Wang, F., Tosato, G. (1998) Expression of the Epstein-Barr virus protein LMP1 mediates tumor regression in vivo Blood 91,2491-2500[Abstract/Free Full Text]
  5. Sgadari, C., Angiolillo, A. L., Cherney, B. W., Pike, S. E., Farber, J. M., Koniaris, L. G., Vanguri, P., Burd, P. R., Sheikh, N., Gupta, G., Teruya-Feldstein, J., Tosato, G. (1996) Interferon-inducible protein-10 identified as a mediator of tumor necrosis in vivo Proc. Natl. Acad. Sci. USA 93,13791-13796[Abstract/Free Full Text]
  6. Sgadari, C., Farber, J. M., Angiolillo, A. L., Liao, F., Teruya-Feldstein, J., Burd, P. R., Yao, L., Gupta, G., Kanegane, C., Tosato, G. (1997) Mig, the monokine induced by interferon-gamma, promotes tumor necrosis in vivo Blood 89,2635-2643[Abstract/Free Full Text]
  7. Farber, J. M. (1997) Mig and IP-10: CXC chemokines that target lymphocytes J. Leukoc. Biol. 61,246-257[Abstract]
  8. Trinchieri, G., Gerosa, F. (1996) Immunoregulation by interleukin-12 J. Leukoc. Biol. 59,505-511[Abstract]
  9. Dinarello, C. A., Novick, D., Puren, A. J., Fantuzzi, G., Shapiro, L., Muhl, H., Yoon, D. Y., Reznikov, L. L., Kim, S. H., Rubinstein, M. (1998) Overview of interleukin-18: more than an interferon-gamma inducing factor J. Leukoc. Biol. 63,658-664[Abstract]
  10. Kanegane, C., Sgadari, C., Kanegane, H., Teruya-Feldstein, J., Yao, L., Gupta, G., Farber, J. M., Liao, F., Liu, L., Tosato, G. (1998) Contribution of the CXC chemokines IP-10 and Mig to the antitumor effects of IL-12 J. Leukoc. Biol. 64,384-392[Abstract]
  11. Okamura, H., Tsutsi, H., Komatsu, T., Yutsudo, M., Hakura, A., Tanimoto, T., Torigoe, K., Okura, T., Nukada, Y., Hattori, K., et al (1995) Cloning of a new cytokine that induces IFN-gamma production by T cells Nature 378,88-91[Medline]
  12. Yoshimoto, T., Takeda, K., Tanaka, T., Ohkusu, K., Kashiwamura, S., Okamura, H., Akira, S., Nakanishi, K. (1998) IL-12 up-regulates IL-18 receptor expression on T cells, Th1 cells, and B cells: synergism with IL-18 for IFN-gamma production J. Immunol. 161,3400-3407[Abstract/Free Full Text]
  13. Ahn, H. J., Maruo, S., Tomura, M., Mu, J., Hamaoka, T., Nakanishi, K., Clark, S., Kurimoto, M., Okamura, H., Fujiwara, H. (1997) A mechanism underlying synergy between IL-12 and IFN-gamma-inducing factor in enhanced production of IFN-gamma J. Immunol. 159,2125-2131[Abstract/Free Full Text]
  14. Bohn, E., Sing, A., Zumbihl, R., Bielfeldt, C., Okamura, H., Kurimoto, M., Heesemann, J., Autenrieth, I. B. (1998) IL-18 (IFN-gamma-inducing factor) regulates early cytokine production in, and promotes resolution of, bacterial infection in mice J. Immunol. 160,299-307[Abstract/Free Full Text]
  15. Lauw, F. N., Dekkers, P. E., te Velde, A. A., Speelman, P., Levi, M., Kurimoto, M., Hack, C. E., van Deventer, S. J., van der Poll, T. (1999) Interleukin-12 induces sustained activation of multiple host inflammatory mediator systems in chimpanzees J. Infect. Dis. 179,646-652[Medline]
  16. Barbulescu, K., Becker, C., Schlaak, J. F., Schmitt, E., Meyer zum Buschenfelde, K. H., Neurath, M.F. (1998) IL-12 and IL-18 differentially regulate the transcriptional activity of the human IFN-gamma promoter in primary CD4+ T lymphocytes J. Immunol. 160,3642-3647[Abstract/Free Full Text]
  17. Chan, S. H., Kobayashi, M., Santoli, D., Perussia, B, Trinchieri, G. (1992) Mechanisms of IFN-gamma induction by natural killer cell stimulatory factor (NKSF/IL-12): role of transcription and mRNA stability in the synergistic interaction between NKSF and IL-2 J. Immunol. 148,92-98[Abstract]
  18. Fantuzzi, G., Reed, D. A., Dinarello, C. A. (1999) IL-12-induced IFN-gamma is dependent on caspase-1 processing of the IL- 18 precursor J. Clin. Invest. 104,761-767[Medline]
  19. Takeda, K., Tsutsui, H., Yoshimoto, T., Adachi, O., Yoshida, N., Kishimoto, T., Okamura, H., Nakanishi, K., Akira, S. (1998) Defective NK cell activity and Th1 response in IL-18-deficient mice Immunity 8,383-390[Medline]
  20. Nakamura, K., Okamura, H., Wada, M., Nagata, K., Tamura, T. (1989) Endotoxin-induced serum factor that stimulates gamma interferon production Infect. Immun. 57,590-595[Abstract/Free Full Text]
  21. Micallef, M. J., Ohtsuki, T., Kohno, K., Tanabe, F., Ushio, S., Namba, M., Tanimoto, T., Torigoe, K., Fujii, M., Ikeda, M., Fukuda, S., Kurimoto, M. (1996) Interferon-gamma-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon-gamma production Eur. J. Immunol. 26,1647-1651[Medline]
  22. Kohno, K., Kataoka, J., Ohtsuki, T., Suemoto, Y., Okamoto, I., Usui, M., Ikeda, M., Kurimoto, M. (1997) IFN-gamma-inducing factor (IGIF) is a costimulatory factor on the activation of Th1 but not Th2 cells and exerts its effect independently of IL-12 J. Immunol. 158,1541-1550[Abstract]
  23. Yoshimoto, T., Okamura, H., Tagawa, Y. I., Iwakura, Y., Nakanishi, K. (1997) Interleukin 18 together with interleukin 12 inhibits IgE production by induction of interferon-gamma production from activated B cells Proc. Natl. Acad. Sci. USA 94,3948-3953[Abstract/Free Full Text]
  24. Tsutsui, H., Nakanishi, K., Matsui, K., Higashino, K., Okamura, H., Miyazawa, Y., Kaneda, K. (1996) IFN-gamma-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones J. Immunol 157,3967-3973[Abstract]
  25. Ghayur, T., Banerjee, S., Hugunin, M., Butler, D., Herzog, L., Carter, A., Quintal, L., Sekut, L., Talanian, R., Paskind, M., Wong, W., Kamen, R., Tracey, D., Allen, H. (1997) Caspase-1 processes IFN-gamma-inducing factor and regulates LPS-induced IFN-gamma production Nature 386,619-623[Medline]
  26. Gu, Y., Kuida, K., Tsutsui, H., Ku, G., Hsiao, K., Fleming, M. A., Hayashi, N., Higashino, K., Okamura, H., Nakanishi, K., Kurimoto, M., Tanimoto, T., Flavell, R. A., Sato, V., Harding, M. W., Livingston, D. J., Su, M. S. (1997) Activation of interferon-gamma inducing factor mediated by interleukin- 1beta converting enzyme Science 275,206-209[Abstract/Free Full Text]
  27. Coughlin, C. M., Salhany, K. E., Wysocka, M., Aruga, E., Kurzawa, H., Chang, A. E., Hunter, C. A., Fox, J. C., Trinchieri, G., Lee, W. M. F. (1998) Interleukin-12 and interleukin-18 synergistically induce murine tumor regression which involves inhibition of angiogenesis J. Clin. Invest. 101,1441-1452[Medline]
  28. Yao, L., Sgadari, C., Furuke, K, Bloom, E. T., Teruya-Feldstein, J., Tosato, G. (1999) Contribution of natural killer cells to inhibition of angiogenesis by interleukin-12 Blood 93,1612-1621[Abstract/Free Full Text]
  29. Setsuda, J., Teruya-Feldstein, J., Harris, N. L., Ferry, J. A., Sorbara, L., Gupta, G., Jaffe, E. S., Tosato, G. (1999) Interleukin-18, interferon-gamma, IP-10, and Mig expression in Epstein-Barr virus-induced infectious mononucleosis and posttransplant lymphoproliferative disease Am. J. Pathol. 155,257-265[Abstract/Free Full Text]
  30. Teruya-Feldstein, J., Jaffe, E. S., Burd, P. R., Kanegane, H., Kingma, D. W., Wilson, W. H., Longo, D. L., Tosato, G. (1997) The role of Mig, the monokine induced by interferon-gamma, and IP-10, the interferon-gamma-inducible protein-10, in tissue necrosis and vascular damage associated with Epstein-Barr virus-positive lymphoproliferative disease Blood 90,4099-4105[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 BloodHome page
F. Pages, J. Galon, G. Karaschuk, D. Dudziak, M. Camus, V. Lazar, S. Camilleri-Broet, C. Lagorce-Pages, S. Lebel-Binay, G. Laux, et al.
Epstein-Barr virus nuclear antigen 2 induces interleukin-18 receptor expression in B cells
Blood, February 15, 2005; 105(4): 1632 - 1639.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
J. A. Gracie, S. E. Robertson, and I. B. McInnes
Interleukin-18
J. Leukoc. Biol., February 1, 2003; 73(2): 213 - 224.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yao, L.
Right arrow Articles by Tosato, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yao, L.
Right arrow Articles by Tosato, G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS